DOCSLIB.ORG

The TRAP Mediator Coactivator Complex Interacts Directly with Estrogen Receptors and Through the TRAP220 Subunit and Directly En

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The TRAP Mediator Coactivator Complex Interacts Directly with Estrogen Receptors and Through the TRAP220 Subunit and Directly En The TRAP͞Mediator coactivator complex interacts directly with estrogen receptors ␣ and ␤ through the TRAP220 subunit and directly enhances estrogen receptor function in vitro Yun Kyoung Kang, Mohamed Guermah, Chao-Xing Yuan*, and Robert G. Roeder† Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, New York, NY 10021 Contributed by Robert G. Roeder, December 31, 2001 Target gene activation by nuclear hormone receptors, including The possibility that TRAP͞Mediator might function with class I estrogen receptors (ERs), is thought to be mediated by a variety of (steroid hormone) nuclear receptors in addition to class II nuclear interacting cofactors. Here we identify a number of nuclear extract- receptors such as TR and VDR was suggested first by the obser- derived proteins that interact with immobilized ER ligand binding vation of a ligand-dependent interaction of intact TRAP220 with domains in a 17␤-estradiol-dependent manner. The most prominent estrogen receptor (ER)␣ (6). In support of this notion, subsequent of these are components of the thyroid hormone receptor-associated studies confirmed physical interactions of TRAP220 with ER␣ protein (TRAP)͞Mediator coactivator complex, which interacts with (15–17), demonstrated inhibitory effects of an ER-interacting frag- ER␣ and ER␤ in both unfractionated nuclear extracts and purified ment of TRAP220 (16) and an anti-TRAP220 antibody (18) on form. Studies with extracts from TRAP220؊͞؊ fibroblasts reveal that ER␣ function in transfected cells, and established the presence of these interactions depend on TRAP220, a TRAP͞Mediator subunit TRAP220 on the promoters of endogenous estrogen-responsive previously shown to interact with ER and other nuclear receptors in genes (19). However, interpretation of these studies is complicated a ligand-dependent manner. The physiological relevance of the in variously by (i) the stable association of TRAP220 with other vitro interaction is documented further by the isolation of an ER␣– TRAP͞Mediator components that may mediate (via different TRAP͞Mediator complex from cultured cells expressing an epitope- activators) TRAP͞Mediator recruitment and function, (ii) the tagged ER␣. Finally, the complete TRAP͞Mediator complex is shown failure to analyze suitable control genes and other cofactors for to enhance ER function directly in a highly purified cell-free transcrip- broader effects of agents designed to block TRAP220 functions, tion system. These studies firmly establish a direct role for TRAP͞ and (iii) an inability to demonstrate interactions of ER with the Mediator, through TRAP220, in ER function. intact TRAP͞Mediator complex, rather than isolated TRAP220 or TRAP220 fragments. In fact, it was suggested on the basis of the uclear hormone receptors comprise a superfamily of transcrip- latter results that ER might function through TRAP220 alone or through a different TRAP220 (sub)complex (16). Furthermore, tional activators that bind to and, in a ligand-dependent N there is some discrepancy regarding the ability of TRAP220 to manner, activate target genes involved in diverse physiological interact with ER␣ vs. ER␤ (16, 17). processes (1). Conserved nuclear receptor domains include the As part of a broader effort to identify novel ER-interacting central DNA binding domain and a C-terminal ligand binding factors (presumptive cofactors) that might show specificity for ER domain (LBD) that contains the ligand-induced AF-2 activation ␣ and ␤ subtypes (20) and͞or mediate tissue-selective functions of domain. Many receptors also contain N-terminal AF-1 activation selective ER modulators (reviewed in ref. 21), we have demon- domains that are less conserved (2). The function of nuclear strated ligand-dependent interactions of the complete TRAP͞ receptors on target genes involves a variety of commonly used Mediator complex with both ER␣ and ER␤. We further show that coactivators that in many cases show ligand-dependent interactions these interactions are direct and dependent on both TRAP220 and (directly or indirectly) with the AF-2 domain (3–5). One prominent ͞ ͞ the ER LBD (but apparently modulated by the AF-1 domain) and group includes the p160 SRC family and the interacting p300 CBP that TRAP͞Mediator directly facilitates ER function. and PCAF proteins, which function at least in part through intrinsic histone acetyltransferase activities that modify chromatin structure Materials and Methods to facilitate subsequent receptor͞coactivator-mediated recruitment ͞ Construction of Plasmids. Details of subcloning (not shown here) are and or function of the general transcription machinery (3–5). available on request. Briefly, plasmids encoding glutathione S- Another coactivator of increasing importance for nuclear recep- ␣ ␣ ͞ transferase (GST)–ER AB(1–180), GST–ER LBD(302–595), tors is the thyroid hormone receptor-associated protein (TRAP) GST–ER␤AB(1–153), and GST–ER␤LBD(243–530) were created Mediator complex. Although now known to mediate the activity of by inserting the corresponding PCR-generated human ER (hER) a number of distinct activators through specific subunit interactions ͞ derivatives into the pGEX vector (Amersham Pharmacia). A (refs. 6 and 7; reviewed in refs. 8 and 9), TRAP Mediator was plasmid expressing FLAG-tagged hER␣⌬AB (f:hER␣⌬AB) was identified first through a ligand-dependent interaction with thyroid created by inserting the FLAG-tagged C-terminal part (residues hormone receptor (TR) and shown to be essential for TR function 160–595) of hER␣ into pIRES-neo vector (CLONTECH). on DNA templates in a reconstituted cell-free system (10). The TRAP220 subunit was identified as the main anchor for TR on the basis of a selective ligand-dependent interaction of isolated Abbreviations: LBD, ligand binding domain; TRAP, thyroid hormone receptor-associated TRAP220 with TR (6), and analyses with TRAP220Ϫ͞Ϫ fibroblasts protein; TR, thyroid hormone receptor; VDR, vitamin D receptor; ER, estrogen receptor; GST, glutathione S-transferase; hER, human ER; MEF, mouse embryo fibroblast; E2,17␤- confirmed a receptor-selective function for TRAP220 (11, 12). The estradiol; TF, transcription factor. early demonstration of ligand-dependent interactions of TRAP220 *Present address: Bristol-Myers Squibb, Wilmington, DE 19803. with a number of other nuclear receptors further suggested a † ͞ To whom reprint requests should be addressed. E-mail: [email protected]. broader role for TRAP220 through TRAP Mediator in nuclear The publication costs of this article were defrayed in part by page charge payment. This receptor function (6, 13), as was shown subsequently for vitamin D article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. receptor (VDR; ref. 14). §1734 solely to indicate this fact. 2642–2647 ͉ PNAS ͉ March 5, 2002 ͉ vol. 99 ͉ no. 5 www.pnas.org͞cgi͞doi͞10.1073͞pnas.261715899 Downloaded by guest on September 23, 2021 Cell Line Establishment. A HeLa-derived cell line (C8) that stably expresses f:hER␣⌬AB was established by transfection using Lipo- fectamine (GIBCO͞BRL). At 72 h posttransfection, cells were passaged 1:10 in selective medium (DMEM containing 10% FBS and 0.5 mg͞ml G418). After 2 weeks of selection, G418-resistant colonies were picked and expanded. Mouse embryo fibroblasts (MEFs) from wild-type and TRAP220Ϫ͞Ϫ mice (11) were immor- talized by transformation with simian virus 40 large T antigen. Cell Culture, Extract Preparation, and Immunoaffinity Purification. Cell lines expressing FLAG (f)-tagged proteins f:TR (10), f:Nut2 (22), f:CDK8͞SRB10 (23), f:TRAP220AB (C.-X.Y. and R.G.R, ␣⌬ unpublished data), and f:hER AB were grown in DMEM-PO4 medium containing 10% calf serum. Corresponding complexes containing these FLAG-tagged proteins were purified from derived nuclear extracts by binding to M2 agarose and elution with FLAG peptide as described (10, 22, 23). MEFs were grown in DMEM containing 10% FBS. Recombinant Protein Purification. GST and GST-fusion proteins were expressed and purified as described (16). Recombinant FLAG-tagged ERs were expressed via baculovirus vectors and purified as described (24). GST Pull-Down Assays. GST pull-down assays were performed as described (25). Before incubation with HeLa nuclear extract, all glutathione-Sepharose bead-immobilized GST or GST-fusion pro- teins were normalized to equimolarity after quantitation by SDS͞ PAGE. After binding [20 mM Hepes, pH 7.9͞20% glycerol͞0.2 mM EDTA͞180 mM KCl͞1mMDTT͞0.05% Nonidet P-40͞0.5 mM ͞ ␮ ␤ PMSF 1 M17 -estradiol (E2) as indicated] and washing (20 mM Hepes, pH 7.9͞20% glycerol͞0.2 mM EDTA͞180 mM KCl͞1mMDTT͞0.1% Nonidet P-40͞0.5 mM PMSF), samples ␣ were eluted with 0.2% Sarkosyl in wash buffer, subjected to Fig. 1. E2-dependent interactions of HeLa nuclear extract proteins with ER and 4–20% gradient SDS͞PAGE, and then analyzed by either silver ER␤ LBDs. Immobilized GST (lanes 2 and 8), GST–ER␣LBD (lanes 3 and 4) and ␤ BIOCHEMISTRY staining with the Rapid Ag stain kit (ICN) or Western blot. GST–ER LBD (lanes 6 and 7) proteins were incubated with HeLa nuclear extract in the absence (Ϫ) or presence (ϩ)of1␮ME2, and bound proteins were eluted ͞ and analyzed by SDS͞PAGE and silver staining as described in Materials and Antibodies and Western Blot Analysis. Antibodies against TRAP Methods. Purified TRAP͞Mediator complex from f:Nut2-expressing cells is ana- Mediator subunits were described previously (6, 7, 22). Antibodies lyzed in lane 5. Standard molecular mass markers (SM) with sizes in kDa indicated against SRC-1 and
Load more

Recommended publications
  • AVILA-DISSERTATION.Pdf
    LOGOS EX MACHINA: A REASONED APPROACH TOWARD CANCER by Andrew Avila, B. S., M. S. A Dissertation In Biological Sciences Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Approved Lauren Gollahon Chairperson of the Committee Rich Strauss Sean Rice Boyd Butler Richard Watson Peggy Gordon Miller Dean of the Graduate School May, 2012 c 2012, Andrew Avila Texas Tech University, Andrew Avila, May 2012 ACKNOWLEDGEMENTS I wish to acknowledge the incredible support given to me by my major adviser, Dr. Lauren Gollahon. Without your guidance surely I would not have made it as far as I have. Furthermore, the intellectual exchange I have shared with my advisory committee these long years have propelled me to new heights of inquiry I had not dreamed of even in the most lucid of my imaginings. That their continual intellectual challenges have provoked and evoked a subtle sense of natural wisdom is an ode to their efficacy in guiding the aspirant to the well of knowledge. For this initiation into the mysteries of nature I cannot thank my advisory committee enough. I also wish to thank the Vice President of Research for the fellowship which sustained the initial couple years of my residency at Texas Tech. Furthermore, my appreciation of the support provided to me by the Biology Department, financial and otherwise, cannot be understated. Finally, I also wish to acknowledge the individuals working at the High Performance Computing Center, without your tireless support in maintaining the cluster I would have not have completed the sheer amount of research that I have.
    [Show full text]
  • Proteomic Analysis of the Mediator Complex Interactome in Saccharomyces Cerevisiae Received: 26 October 2016 Henriette Uthe, Jens T
    www.nature.com/scientificreports OPEN Proteomic Analysis of the Mediator Complex Interactome in Saccharomyces cerevisiae Received: 26 October 2016 Henriette Uthe, Jens T. Vanselow & Andreas Schlosser Accepted: 25 January 2017 Here we present the most comprehensive analysis of the yeast Mediator complex interactome to date. Published: 27 February 2017 Particularly gentle cell lysis and co-immunopurification conditions allowed us to preserve even transient protein-protein interactions and to comprehensively probe the molecular environment of the Mediator complex in the cell. Metabolic 15N-labeling thereby enabled stringent discrimination between bona fide interaction partners and nonspecifically captured proteins. Our data indicates a functional role for Mediator beyond transcription initiation. We identified a large number of Mediator-interacting proteins and protein complexes, such as RNA polymerase II, general transcription factors, a large number of transcriptional activators, the SAGA complex, chromatin remodeling complexes, histone chaperones, highly acetylated histones, as well as proteins playing a role in co-transcriptional processes, such as splicing, mRNA decapping and mRNA decay. Moreover, our data provides clear evidence, that the Mediator complex interacts not only with RNA polymerase II, but also with RNA polymerases I and III, and indicates a functional role of the Mediator complex in rRNA processing and ribosome biogenesis. The Mediator complex is an essential coactivator of eukaryotic transcription. Its major function is to communi- cate regulatory signals from gene-specific transcription factors upstream of the transcription start site to RNA Polymerase II (Pol II) and to promote activator-dependent assembly and stabilization of the preinitiation complex (PIC)1–3. The yeast Mediator complex is composed of 25 subunits and forms four distinct modules: the head, the middle, and the tail module, in addition to the four-subunit CDK8 kinase module (CKM), which can reversibly associate with the 21-subunit Mediator complex.
    [Show full text]
  • The Cyclin-Dependent Kinase 8 Module Sterically Blocks Mediator Interactions with RNA Polymerase II
    The cyclin-dependent kinase 8 module sterically blocks Mediator interactions with RNA polymerase II Hans Elmlund*†, Vera Baraznenok‡, Martin Lindahl†, Camilla O. Samuelsen§, Philip J. B. Koeck*¶, Steen Holmberg§, Hans Hebert*ʈ, and Claes M. Gustafsson‡ʈ *Department of Biosciences and Nutrition, Karolinska Institutet and School of Technology and Health, Royal Institute of Technology, Novum, SE-141 87 Huddinge, Sweden; †Department of Molecular Biophysics, Lund University, P.O. Box 124, SE-221 00 Lund, Sweden; ‡Division of Metabolic Diseases, Karolinska Institutet, Novum, SE-141 86 Huddinge, Sweden; §Department of Genetics, Institute of Molecular Biology, Oester Farimagsgade 2A, DK-1353 Copenhagen K, Denmark; and ¶University College of Southern Stockholm, SE-141 57 Huddinge, Sweden Communicated by Roger D. Kornberg, Stanford University School of Medicine, Stanford, CA, August 28, 2006 (received for review February 21, 2006) CDK8 (cyclin-dependent kinase 8), along with CycC, Med12, and Here, we use the S. pombe system to investigate the molecular Med13, form a repressive module (the Cdk8 module) that prevents basis for the distinct functional properties of S and L Mediator. RNA polymerase II (pol II) interactions with Mediator. Here, we We find that the Cdk8 module binds to the pol II-binding cleft report that the ability of the Cdk8 module to prevent pol II of Mediator, where it sterically blocks interactions with the interactions is independent of the Cdk8-dependent kinase activity. polymerase. In contrast to earlier assumptions, the Cdk8 kinase We use electron microscopy and single-particle reconstruction to activity is dispensable for negative regulation of pol II interac- demonstrate that the Cdk8 module forms a distinct structural tions with Mediator.
    [Show full text]
  • MED6 (NM 005466) Human Untagged Clone – SC317351 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC317351 MED6 (NM_005466) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: MED6 (NM_005466) Human Untagged Clone Tag: Tag Free Symbol: MED6 Synonyms: ARC33; NY-REN-28 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_005466, the custom clone sequence may differ by one or more nucleotides ATGGCGGCGGTGGATATCCGAGACAATCTGCTGGGAATTTCTTGGGTTGACAGCTCTTGGATCCCTATTT TGAACAGTGGTAGTGTCCTGGATTACTTTTCAGAAAGAAGTAATCCTTTTTATGACAGAACATGTAATAA TGAAGTGGTCAAAATGCAGAGGCTAACATTAGAACACTTGAATCAGATGGTTGGAATCGAGTACATCCTT TTGCATGCTCAAGAGCCCATTCTTTTCATCATTCGGAAGCAACAGCGGCAGTCCCCTGCCCAAGTTATCC CACTAGCTGATTACTATATCATTGCTGGAGTGATCTATCAGGCACCAGACTTGGGATCAGTTATAAACTC TAGAGTGCTTACTGCAGTGCATGGTATTCAGTCAGCTTTTGATGAAGCTATGTCATACTGTCGATATCAT CCTTCCAAAGGGTATTGGTGGCACTTCAAAGATCATGAAGAGCAAGATAAAGTCAGACCTAAAGCCAAAA GGAAAGAAGAACCAAGCTCTATTTTTCAGAGACAACGTGTGGATGCTTTACTTTTAGACCTCAGACAAAA ATTTCCACCCAAATTTGTGCAGCTAAAGCCTGGAGAAAAGCCTGTTCCAGTGGATCAAACAAAGAAAGAG GCAGAACCTATACCAGAAACTGTAAAACCTGAGGAGAAGGAGACCACAAAGAATGTACAACAGACAGTGA GTGCTAAAGGCCCCCCTGAAAAACGGATGAGACTTCAGTGA Restriction Sites: SgfI-MluI ACCN: NM_005466 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete
    [Show full text]
  • COFACTORS of the P65- MEDIATOR COMPLEX
    COFACTORS OF THE April 5 p65- MEDIATOR 2011 COMPLEX Honors Thesis Department of Chemistry and Biochemistry NICHOLAS University of Colorado at Boulder VICTOR Faculty Advisor: Dylan Taatjes, PhD PARSONNET Committee Members: Rob Knight, PhD; Robert Poyton, PhD Table of Contents Abstract ......................................................................................................................................................... 3 Introduction .................................................................................................................................................. 4 The Mediator Complex ............................................................................................................................. 6 The NF-κB Transcription Factor ................................................................................................................ 8 Hypothesis............................................................................................................................................... 10 Results ......................................................................................................................................................... 11 Discussion.................................................................................................................................................... 15 p65-only factors ...................................................................................................................................... 16 p65-enriched factors ..............................................................................................................................
    [Show full text]
  • Loss of TRIM33 Causes Resistance to BET Bromodomain Inhibitors Through MYC- and TGF-Β–Dependent Mechanisms
    Loss of TRIM33 causes resistance to BET PNAS PLUS bromodomain inhibitors through MYC- and TGF-β–dependent mechanisms Xiarong Shia, Valia T. Mihaylovaa, Leena Kuruvillaa, Fang Chena, Stephen Vivianoa, Massimiliano Baldassarrea, David Sperandiob, Ruben Martinezb, Peng Yueb, Jamie G. Batesb, David G. Breckenridgeb, Joseph Schlessingera,1, Benjamin E. Turka,1, and David A. Calderwooda,c,1 aDepartment of Pharmacology, Yale University School of Medicine, New Haven, CT 06520; bGilead Sciences, Foster City, CA 94404; and cDepartment of Cell Biology, Yale University School of Medicine, New Haven, CT 06520 Contributed by Joseph Schlessinger, May 24, 2016 (sent for review December 22, 2015; reviewed by Gary L. Johnson and Michael B. Yaffe) Bromodomain and extraterminal domain protein inhibitors (BETi) not characterized by genetic alterations in BET proteins. One key hold great promise as a novel class of cancer therapeutics. Because mechanism by which BETi suppress growth and survival of at least acquired resistance typically limits durable responses to targeted some types of cancer cells is by preferentially repressing tran- therapies, it is important to understand mechanisms by which scription of the proto-oncogene MYC, which is often under the tumor cells adapt to BETi. Here, through pooled shRNA screening control of BRD4 (5, 10, 12, 18). Thus, BETi may provide a new of colorectal cancer cells, we identified tripartite motif-containing mechanism to target MYC and other oncogenic transcription fac- protein 33 (TRIM33) as a factor promoting sensitivity to BETi. We tors, which lack obvious binding pockets for small molecules and are demonstrate that loss of TRIM33 reprograms cancer cells to a more thus typically considered to be “undruggable.” resistant state through at least two mechanisms.
    [Show full text]
  • Regulatory Functions of the Mediator Kinases CDK8 and CDK19 Charli B
    TRANSCRIPTION 2019, VOL. 10, NO. 2, 76–90 https://doi.org/10.1080/21541264.2018.1556915 REVIEW Regulatory functions of the Mediator kinases CDK8 and CDK19 Charli B. Fant and Dylan J. Taatjes Department of Biochemistry, University of Colorado, Boulder, CO, USA ABSTRACT ARTICLE HISTORY The Mediator-associated kinases CDK8 and CDK19 function in the context of three additional Received 19 September 2018 proteins: CCNC and MED12, which activate CDK8/CDK19 kinase function, and MED13, which Revised 13 November 2018 enables their association with the Mediator complex. The Mediator kinases affect RNA polymerase Accepted 20 November 2018 II (pol II) transcription indirectly, through phosphorylation of transcription factors and by control- KEYWORDS ling Mediator structure and function. In this review, we discuss cellular roles of the Mediator Mediator kinase; enhancer; kinases and mechanisms that enable their biological functions. We focus on sequence-specific, transcription; RNA DNA-binding transcription factors and other Mediator kinase substrates, and how CDK8 or CDK19 polymerase II; chromatin may enable metabolic and transcriptional reprogramming through enhancers and chromatin looping. We also summarize Mediator kinase inhibitors and their therapeutic potential. Throughout, we note conserved and divergent functions between yeast and mammalian CDK8, and highlight many aspects of kinase module function that remain enigmatic, ranging from potential roles in pol II promoter-proximal pausing to liquid-liquid phase separation. Introduction and MED13L associate in a mutually exclusive fash- ion with MED12 and MED13 [12], and their poten- The CDK8 kinase exists in a 600 kDa complex tial functional distinctions remain unclear. known as the CDK8 module, which consists of four CDK8 is considered both an oncogene [13–15] proteins (CDK8, CCNC, MED12, MED13).
    [Show full text]
  • MED21 Polyclonal Antibody
    PRODUCT DATA SHEET Bioworld Technology,Inc. MED21 polyclonal antibody Catalog: BS61042 Host: Rabbit Reactivity: Human,Mouse,Rat BackGround: Q13503 In mammalian cells, transcription is regulated in part by Purification&Purity: high molecular weight co-activating complexes that me- The antibody was affinity-purified from rabbit antiserum diate signals between transcriptional activators and RNA by affinity-chromatography using epitope-specific im- polymerase. These complexes include the SMCC (SRB munogen and the purity is > 95% (by SDS-PAGE). and MED protein cofactor complex), which consists of Applications: various subunits that share homology with several com- WB: 1:500~1:1000 ponents of the yeast transcriptional mediator complexes Storage&Stability: and including the human proteins Srb7, Med6 (also des- Store at 4°C short term. Aliquot and store at -20°C long ignated DRIP33) and Med7 (also designated DRIP34). term. Avoid freeze-thaw cycles. SMCC associates with the RNAPII (RNA polymerase II) Specificity: holoenzyme through Srb7 and, in turn, enhances MED21 polyclonal antibodydetects endogenous levels of gene-specific activation or repression induced by MED21 protein. DNA-binding transcription factors. Med6 and Med7, as DATA: well as other components of SMCC, associate with co-activator proteins from the TRAP (thyroid hormone receptor-activating protein) complex and DRIP (for vita- min D receptor interacting protein) complex to facilitate steroid receptor dependent transcriptional activation. Ad- ditionally, SMCC associates with PC4 (positive cofactor 4) to repress basal transcription independent of RNAPII activity. Western blot (WB) analysis of MED21 polyclonal antibody at 1:500 di- Product: lution Rabbit IgG, 1mg/ml in PBS with 0.02% sodium azide, Lane1:CT26 whole cell lysate(40ug) 50% glycerol, pH7.2 Lane2:HEK293T whole cell lysate(40ug) Molecular Weight: Lane3:HCT116 whole cell lysate(40ug) ~ 15 kDa Note: Swiss-Prot: For research use only, not for use in diagnostic procedure.
    [Show full text]
  • Cyclin Dl/Cdk4 Regulates Retinoblastoma Protein- Mediated Cell Cycle Arrest by Site-Specific Phosphorylation Lisa Connell-Crowley,* J
    Molecular Biology of the Cell Vol. 8, 287-301, February 1997 Cyclin Dl/Cdk4 Regulates Retinoblastoma Protein- mediated Cell Cycle Arrest by Site-specific Phosphorylation Lisa Connell-Crowley,* J. Wade Harper,* and David W. Goodrich"t *Verna and Marrs McLean Department of Biochemistry, Baylor College of Medicine, Houston, Texas 77030; and tDepartment of Tumor Biology, University of Texas M.D. Anderson Cancer Center, Houston, Texas 77030 Submitted October 9, 1996; Accepted November 22, 1996 Monitoring Editor: J. Michael Bishop The retinoblastoma protein (pRb) inhibits progression through the cell cycle. Although pRb is phosphorylated when G1 cyclin-dependent kinases (Cdks) are active, the mech- anisms underlying pRb regulation are unknown. In vitro phosphorylation by cyclin Dl /Cdk4 leads to inactivation of pRb in a microinjection-based in vivo cell cycle assay. In contrast, phosphorylation of pRb by Cdk2 or Cdk3 in complexes with A- or E-type cyclins is not sufficient to inactivate pRb function in this assay, despite extensive phos- phorylation and conversion to a slowly migrating "hyperphosphorylated form." The differential effects of phosphorylation on pRb function coincide with modification of distinct sets of sites. Serine 795 is phosphorylated efficiently by Cdk4, even in the absence of an intact LXCXE motif in cyclin D, but not by Cdk2 or Cdk3. Mutation of serine 795 to alanine prevents pRb inactivation by Cdk4 phosphorylation in the microinjection assay. This study identifies a residue whose phosphorylation is critical for inactivation of pRb-mediated growth suppression, and it indicates that hyperphosphorylation and inactivation of pRb are not necessarily synonymous. INTRODUCTION pRb is recognized by its characteristic decrease in electrophoretic mobility, and conditions that favor cell The retinoblastoma protein (pRb) functions to con- proliferation favor the appearance of these slower mi- strain cell proliferation and exerts its effects during the grating forms (Cobrinik et al., 1992; Hinds et al., 1992).
    [Show full text]
  • Anti-MED6 Antibody (ARG66412)
    Product datasheet [email protected] ARG66412 Package: 100 μl anti-MED6 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes MED6 Tested Reactivity Hu Tested Application IHC-P Host Rabbit Clonality Polyclonal Isotype IgG Target Name MED6 Antigen Species Human Immunogen Full length fusion protein of Human MED6. Conjugation Un-conjugated Alternate Names Activator-recruited cofactor 33 kDa component; Renal carcinoma antigen NY-REN-28; NY-REN-28; hMed6; Mediator of RNA polymerase II transcription subunit 6; ARC33; Mediator complex subunit 6 Application Instructions Application table Application Dilution IHC-P 1:25 - 1:100 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control IHC-P: Human brain; WB: HeLa, PC3, 231 and Human esophagus cancer tissue Calculated Mw 28 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS (pH 7.4), 0.05% Sodium azide and 40% Glycerol. Preservative 0.05% Sodium azide Stabilizer 40% Glycerol Concentration 1.8 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Gene Symbol MED6 Gene Full Name mediator complex subunit 6 Function Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.
    [Show full text]
  • A Functional Corepressor Required for Regulation of Neural-Specific Gene Expression
    Proc. Natl. Acad. Sci. USA Vol. 96, pp. 9873–9878, August 1999 Neurobiology CoREST: A functional corepressor required for regulation of neural-specific gene expression MARI´A E. ANDRE´S*†,CORINNA BURGER†‡,MARI´A J. PERAL-RUBIO†§,ELENA BATTAGLIOLI*, MARY E. ANDERSON*, ࿣ JULIA GRIMES*, JULIA DALLMAN*, NURIT BALLAS*¶, AND GAIL MANDEL* *Howard Hughes Medical Institute and Department of Neurobiology and Behavior, and ¶Department of Biochemistry and Cell Biology, State University of New York, Stony Brook, NY 11794 Communicated by William J. Lennarz, State University of New York, Stony Brook, NY, June 25, 1999 (received for review April 30, 1999) ABSTRACT Several genes encoding proteins critical to Two distinct repressor domains have been identified and the neuronal phenotype, such as the brain type II sodium characterized in REST (6, 7). These domains are located in the channel gene, are expressed to high levels only in neurons. amino and carboxyl termini of the protein. Both domains are This cell specificity is due, in part, to long-term repression in required for full repression in the context of the intact mole- nonneural cells mediated by the repressor protein cule, but each domain is sufficient to repress type II sodium REST͞NRSF (RE1 silencing transcription factor͞neural- channel reporter genes when expressed as a Gal4 fusion restrictive silencing factor). We show here that CoREST, a protein (6). The C-terminal repressor domain contains a C2H2 newly identified human protein, functions as a corepressor for class zinc finger beginning approximately 40 aa upstream of the REST. A single zinc finger motif in REST is required for stop codon.
    [Show full text]
  • WO 2013/064702 A2 10 May 2013 (10.05.2013) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2013/064702 A2 10 May 2013 (10.05.2013) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12Q 1/68 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (21) International Application Number: HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, PCT/EP2012/071868 KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, (22) International Filing Date: ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, 5 November 20 12 (05 .11.20 12) NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, (25) Filing Language: English TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, (26) Publication Language: English ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 1118985.9 3 November 201 1 (03. 11.201 1) GB kind of regional protection available): ARIPO (BW, GH, 13/339,63 1 29 December 201 1 (29. 12.201 1) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, (71) Applicant: DIAGENIC ASA [NO/NO]; Grenseveien 92, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, N-0663 Oslo (NO).
    [Show full text]