DOCSLIB.ORG

Table S1. Differentially Expressed Genes in TAM-/- and WT Testis. Gene Expression Patterns Were Analyzed with Genechip® Mouse

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Table S1. Differentially Expressed Genes in TAM-/- and WT Testis. Gene Expression Patterns Were Analyzed with Genechip® Mouse Table S1. Differentially expressed genes in TAM-/- and WT testis. Gene expression patterns were analyzed with GeneChip® Mouse Genome 430/2.0 (Affymetrix, Santa Clara, CA). The pooled RNAs of testes from 3 mice each genotype were subjected to microarray analysis. Up-regulated genes in TAM-/- testis. Signal intensity Gene Title Gene Symbol UniGene ID Fold Change Function KO N 1 RIKEN cDNA 1700097M23 gene 1700097M23Rik Mm.399360 116.83 2.48 47.02 unkown 2 fatty acid binding protein 9, testis Fabp9 Mm.26654 1219.27 45.72 26.67 transport 3 RIKEN cDNA 1700008K24 gene 1700008K24Rik Mm.46140 741.94 32.07 23.14 unkown 4 lactate dehydrogenase C Ldhc Mm.16563 1226.78 54.47 22.52 oxidation reduction a disintegrin and metallopeptidase 5 Adam2 Mm.422850 253.45 12.29 20.62 proteolysis domain 2 6 lactate dehydrogenase A-like 6B Ldhal6b Mm.432764 374.12 22.19 16.86 glycolysis 7 RIKEN cDNA 1700016M24 gene 1700016M24Rik Mm.263708 394.98 24.51 16.12 unkown 8 RIKEN cDNA 4930550L11 gene 4930550L11Rik Mm.391968 908.55 56.46 16.09 unkown 9 interferon activated gene 202B Ifi202b Mm.218770 55.32 3.63 15.24 immune response induction of apoptosis by 10 tumor necrosis factor α Tnf α Mm.1293 1383.03 99.47 13.9 extracellular signals 11 phosducin-like 2 Pdcl2 Mm.143764 571.17 42.49 13.44 phototransduction 12 RIKEN cDNA 1700029M20 gene 1700029M20Rik Mm.292326 665.07 62.07 10.72 unkown 13 RIKEN cDNA 1700102P08 gene 1700102P08Rik Mm.78287 1263.87 118.99 10.62 unkown 14 T-cell specific GTPase Tgtp --- 505.8 59.76 8.46 immune response 15 dickkopf-like 1 Dkkl1 Mm.27287 181.48 21.99 8.25 morphogenesis cell differentiation 16 piwi-like homolog 1 (Drosophila) Piwil1 Mm.272720 335.79 41.38 8.11 multicellular organismal development spermatogenesis 17 RIKEN cDNA 4933415F23 gene 4933415F23Rik Mm.431297 98.79 12.54 7.88 unkown 18 hematopoietic cell transcript 1 Hemt1 Mm.17336 1671.61 212.16 7.88 biological process regulatory factor X, 4 (influences regulation of transcription 19 Rfx4 Mm.79070 121.92 16.56 7.36 HLA class II expression) transcription 20 testicular cell adhesion molecule 1 Tcam1 Mm.159608 500.07 69.31 7.21 cell-cell adhesion 21 Transcribed locus --- Mm.399255 137.73 20.65 6.67 unkown 22 RIKEN cDNA 4930442P07 gene 4930442P07Rik Mm.395790 286.3 43.06 6.65 unkown 23 RIKEN cDNA 1700019P01 gene 1700019P01Rik Mm.86807 231.77 35.97 6.44 protein modification 24 glycerol kinase 2 Gk2 Mm.61206 128.1 20.31 6.31 unkown 25 testis specific gene A2 Tsga2 Mm.12743 2605.37 415.52 6.27 meiosis 26 RIKEN cDNA 1700006J14 gene 1700006J14Rik Mm.391448 126.27 20.46 6.17 unkown 27 GLI pathogenesis-related 1 like 2 Glipr1l2 Mm.292351 297.03 49.34 6.02 unkown multicellular organismal 28 sperm equatorial segment protein 1 Spesp1 Mm.263615 553.24 93.21 5.94 development 29 RIKEN cDNA 1700019A02 gene 1700019A02Rik Mm.307084 332.77 56.05 5.94 unkown 30 dynein, axonemal, heavy chain 7 Dnahc7 Mm.184692 118.79 20.26 5.86 biological process 31 Ly6/Plaur domain containing 4 Lypd4 Mm.189648 244.52 42.27 5.78 unkown regulation of transcription 32 gene model 739 Gm739 Mm.390371 262.86 46.41 5.66 transcription 33 RIKEN cDNA 1700100I10 gene 1700100I10Rik --- 99.25 17.59 5.64 unkown vesicle docking during 34 pallidin Pldn Mm.268921 84.2 14.97 5.63 exocytosis 35 hypothetical protein 9530028C05 9530028C05 --- 272.69 48.49 5.62 unkown 36 RIKEN cDNA 1700010I14 gene 1700010I14Rik Mm.67591 149.49 27.4 5.46 unkown cell differentiation metallothionein-like 5, multicellular organismal 37 Mtl5 Mm.209941 621.12 116.56 5.33 testis-specific (tesmin) development spermatogenesis 38 arylsulfatase K Arsk Mm.196399 108.04 20.29 5.32 biological process pyruvate dehydrogenase E1 alpha metabolic process 39 Pdha2 Mm.4223 864.58 162.69 5.31 2 oxidation reduction 40 RIKEN cDNA 1700010A17 gene 1700010A17Rik Mm.276332 461.89 87.22 5.3 unkown 41 F-box protein 39 Fbxo39 Mm.291131 650.19 124.97 5.2 cell cycle EP300 interacting inhibitor of 42 Eid3 Mm.399104 84.02 16.67 5.04 unkown differentiation 3 43 microrchidia 2B Morc2b Mm.157765 103.78 21.02 4.94 unkown cell differentiation multicellular organismal 44 calmegin Clgn Mm.358581 182.22 37.21 4.9 development spermatogenesis 45 patched domain containing 3 Ptchd3 Mm.61213 95.21 19.46 4.89 unkown cytochrome c oxidase subunit VIb 46 Cox6b2 Mm.29625 1299.49 271.02 4.79 biological process polypeptide 2 47 cDNA sequence AK162044 AK162044 Mm.54257 83.97 17.91 4.69 unkown 48 ankyrin repeat domain 48 Ankrd48 Mm.67300 155.6 33.39 4.66 regulation of transcription 49 coiled-coil domain containing 96 Ccdc96 Mm.42368 156.8 36.23 4.33 unkown cytokine and chemokine 50 interferon inducible GTPase 1 Iigp1 Mm.261140 334.93 78.64 4.26 mediated signaling pathway 51 Y box protein 2 Ybx2 Mm.29286 321.83 75.65 4.25 regulation of transcription 52 sperm equatorial segment protein 1 Spesp1 Mm.263615 63.56 14.96 4.25 multicellular organismal development 53 kallikrein 1-related peptidase b24 Klk1b24 --- 63.57 15.04 4.23 proteolysis ubiquitin-conjugating enzyme E2U 54 Ube2u Mm.318133 81.89 19.38 4.23 unkown (putative) hepatoma derived growth 55 Hdgfl1 Mm.7411 309.04 74.42 4.15 unkown factor-like 1 CKLF-like MARVEL 56 transmembrane domain containing Cmtm2a Mm.272746 32.85 7.94 4.14 chemotaxis 2A 57 RIKEN cDNA 1700097N02 gene 1700097N02Rik Mm.372315 194.28 47.13 4.12 unkown 58 RIKEN cDNA 4931428L18 gene 4931428L18Rik Mm.161414 77.07 18.77 4.11 unkown 59 ring finger protein 32 Rnf32 Mm.87352 562.29 140.49 4 biological process cytokine and chemokine 60 interferon inducible GTPase 1 Iigp1 Mm.261140 296.81 75.18 3.95 mediated signaling pathway 61 meiosis expressed gene 1 Meig1 Mm.2688 1788.99 454.31 3.94 meiosis cytochrome c oxidase, subunit 62 Cox8c Mm.660 1217.13 308.73 3.94 unkown VIIIc 63 RIKEN cDNA 1700010I14 gene 1700010I14Rik Mm.67591 160.24 41.13 3.9 unkown hydroxy-delta-5-steroid 64 dehydrogenase, 3 beta- and steroid Hsd3b2 Mm.196405 101.52 26.21 3.87 steroid biosynthesis delta-isomerase 2 65 ropporin 1-like Ropn1l Mm.434609 854.52 233.1 3.67 signal transduction hydroxyacid oxidase (glycolate metabolic process 66 Hao3 Mm.281874 725.56 200.01 3.63 oxidase) 3 oxidation reduction proteasome (prosome, macropain) 67 Psma8 Mm.87277 1324.66 364.71 3.63 proteolysis subunit, alpha type, 8 interferon gamma inducible protein 68 Ifi47 Mm.24769 399.13 111.62 3.58 signal transduction 47 69 synaptogyrin 4 Syngr4 Mm.367349 396.59 113.12 3.51 unkown guanylate nucleotide binding 70 Gbp2 Mm.24038 153.87 44.03 3.49 unkown protein 2 71 RIKEN cDNA 2610020H08 gene 2610020H08Rik Mm.38237 1987.13 569.34 3.49 unkown 72 serine/threonine kinase 33 Stk33 Mm.389950 260.09 74.86 3.47 protein phosphorylation 73 RIKEN cDNA 4930511M11 gene 4930511M11Rik Mm.85064 60.39 17.51 3.45 unkown 74 RIKEN cDNA 4930524B15 gene 4930524B15Rik Mm.78654 206.05 60.62 3.4 unkown 75 predicted gene, EG668339 EG668339 Mm.394985 2433.47 715.8 3.4 unkown general transcription factor II A, regulation of transcription 76 Gtf2a1lf Mm.61330 135.94 40.11 3.39 1-like factor transcription 77 RIKEN cDNA 1700104B16 gene 1700104B16Rik Mm.160107 72.08 21.47 3.36 unkown 78 RIKEN cDNA 1700049M11 gene 1700049M11Rik Mm.142735 664.63 198.46 3.35 unkown Leucine rich repeat containing 6 79 Lrrc6 Mm.244890 50.26 15.01 3.35 biological process (testis) hypothetical gene supported by 80 LOC434089 Mm.101361 163.59 49.34 3.32 unkown AK039686 81 phosphodiesterase 10A Pde10a Mm.87161 27.31 8.24 3.31 signal transduction regulation of transcription 82 tripartite motif protein 30 Trim30 Mm.295578 22.52 6.88 3.27 transcription one-carbon compound 83 carbonic anhydrase 7 Car7 Mm.129265 575.53 176.91 3.25 metabolism cell differentiation metallothionein-like 5, 84 Mtl5 Mm.209941 1087.73 339.63 3.2 multicellular organismal testis-specific (tesmin) development spermatogenesis regulation of transcription, 85 RIKEN cDNA 1700029I01 gene 1700029I01Rik Mm.392861 67.59 21.15 3.2 DNA-dependent 86 Adult male testis cDNA --- Mm.417665 63.63 19.89 3.2 unkown 87 chemokine (C-C motif) receptor 5 Ccr5 Mm.425007 57.47 18.1 3.17 chemotaxis leucine rich repeat containing 6 88 Lrrc6 Mm.244890 146.46 46.91 3.12 unkown (testis) 89 coiled-coil domain containing 89 Ccdc89 Mm.307198 39.89 12.8 3.12 unkown 90 REC8-like 1 (yeast) Rec8L1 Mm.23149 615.51 198.83 3.1 meiosis 91 interferon activated gene 203 Ifi203 Mm.261270 44.34 14.43 3.07 immune response 92 RIKEN cDNA 4932415G12 gene 4932415G12Rik Mm.116284 627.42 204.57 3.07 unkown neural precursor cell expressed, 93 developmentally down-regulted Nedd4 Mm.279923 1424.98 465.88 3.06 protein modification gene 4 splicing factor, arginine/serine-rich 94 Sfrs14 Mm.284505 1739.86 571.45 3.04 mRNA processing 14 regulation of transcription 95 jumonji domain containing 2D Jmjd2d Mm.240457 163.46 53.86 3.04 oxidation reduction transcription regulation of transcription 96 E2F transcription factor 6 E2f6 Mm.23296 129.86 42.81 3.03 cell cycle transcription regulation of transcription, 97 PHD finger protein 7 Phf7 Mm.5348 370.91 123 3.02 DNA-dependent 98 heat shock protein 2 Hspa2 Mm.296181 1484.35 492.46 3.01 protein folding 99 RIKEN cDNA 1700025K23 gene 1700025K23Rik Mm.45187 620.94 208.17 2.98 unkown 100 centrin 1 Cetn1 Mm.195831 79.36 26.69 2.97 cell cycle myosin, heavy polypeptide 1, 101 Myh1 Mm.422801 106.53 36.15 2.95 striated muscle contraction skeletal muscle, adult DnaJ (Hsp40) homolog, subfamily 102 Dnajb6 Mm.290110 422.28 143.45 2.94 protein folding B, member 6 lymphocyte antigen 6 complex, 103 Ly6k Mm.273319 2210.27 752.67 2.94 unkown locus K ubiquitin-dependent protein 104 ubiquitin specific peptidase 18 Usp18 Mm.326911 152.27 52.68 2.89 catabolism 105 leucine rich
Load more

Recommended publications
  • Supplementary Materials For
    www.sciencemag.org/cgi/content/full/science.1230422/DC1 Supplementary Materials for Genomic Diversity and Evolution of the Head Crest in the Rock Pigeon Michael D. Shapiro,* Zev Kronenberg, Cai Li, Eric T. Domyan, Hailin Pan, Michael Campbell, Hao Tan, Chad D. Huff, Haofu Hu, Anna I. Vickrey, Sandra C. A. Nielsen, Sydney A. Stringham, Hao Hu, Eske Willerslev, M. Thomas P. Gilbert, Mark Yandell, Guojie Zhang, Jun Wang* *To whom correspondence should be addressed. E-mail: [email protected] (M.D.S.); [email protected] (J.W.) Published 31 January 2013 on Science Express DOI: 10.1126/science.1230422 This PDF file includes: Materials and Methods Supplementary Text Figs. S1 to S27 Tables S1 to S28 References (26–72) Materials and Methods Genome assembly The DNA sample for sequencing of the reference genome was extracted from blood obtained from a single, male Danish Tumbler, bred by Anders and Hans Ove Christiansen (Danmarks Racedueforeninger, Næstved, Denmark). This breed was chosen because it is an old breed that is believed to have changed little in recent history. Seven paired-end sequencing libraries were constructed, with insert sizes of 170 bp, 500 bp, 800 bp, 2 kb, 5 kb, 10 kb and 20 kb. The libraries were sequenced using Illumina HiSeq2000 platform, yielding a total of 127.17 Gb raw data (Table S1). The raw sequences were filtered for low quality, adapter sequence, paired-end read overlap, and PCR duplicates. We also performed an error correction step on the raw reads before assembling. Filtering and error correction resulted in 81.57 Gb of clean data for genome assembly with the genome with SOAPdenovo (26).
    [Show full text]
  • Epigenetics Page 1
    Epigenetics esiRNA ID Gene Name Gene Description Ensembl ID HU-13237-1 ACTL6A actin-like 6A ENSG00000136518 HU-13925-1 ACTL6B actin-like 6B ENSG00000077080 HU-14457-1 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENSG00000138107 HU-10579-1 ACTR2 ARP2 actin-related protein 2 homolog (yeast) ENSG00000138071 HU-10837-1 ACTR3 ARP3 actin-related protein 3 homolog (yeast) ENSG00000115091 HU-09776-1 ACTR5 ARP5 actin-related protein 5 homolog (yeast) ENSG00000101442 HU-00773-1 ACTR6 ARP6 actin-related protein 6 homolog (yeast) ENSG00000075089 HU-07176-1 ACTR8 ARP8 actin-related protein 8 homolog (yeast) ENSG00000113812 HU-09411-1 AHCTF1 AT hook containing transcription factor 1 ENSG00000153207 HU-15150-1 AIRE autoimmune regulator ENSG00000160224 HU-12332-1 AKAP1 A kinase (PRKA) anchor protein 1 ENSG00000121057 HU-04065-1 ALG13 asparagine-linked glycosylation 13 homolog (S. cerevisiae) ENSG00000101901 HU-13552-1 ALKBH1 alkB, alkylation repair homolog 1 (E. coli) ENSG00000100601 HU-06662-1 ARID1A AT rich interactive domain 1A (SWI-like) ENSG00000117713 HU-12790-1 ARID1B AT rich interactive domain 1B (SWI1-like) ENSG00000049618 HU-09415-1 ARID2 AT rich interactive domain 2 (ARID, RFX-like) ENSG00000189079 HU-03890-1 ARID3A AT rich interactive domain 3A (BRIGHT-like) ENSG00000116017 HU-14677-1 ARID3B AT rich interactive domain 3B (BRIGHT-like) ENSG00000179361 HU-14203-1 ARID3C AT rich interactive domain 3C (BRIGHT-like) ENSG00000205143 HU-09104-1 ARID4A AT rich interactive domain 4A (RBP1-like) ENSG00000032219 HU-12512-1 ARID4B AT rich interactive domain 4B (RBP1-like) ENSG00000054267 HU-12520-1 ARID5A AT rich interactive domain 5A (MRF1-like) ENSG00000196843 HU-06595-1 ARID5B AT rich interactive domain 5B (MRF1-like) ENSG00000150347 HU-00556-1 ASF1A ASF1 anti-silencing function 1 homolog A (S.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Supplementary Materials and Tables a and B
    SUPPLEMENTARY MATERIAL 1 Table A. Main characteristics of the subset of 23 AML patients studied by high-density arrays (subset A) WBC BM blasts MYST3- MLL Age/Gender WHO / FAB subtype Karyotype FLT3-ITD NPM status (x109/L) (%) CREBBP status 1 51 / F M4 NA 21 78 + - G A 2 28 / M M4 t(8;16)(p11;p13) 8 92 + - G G 3 53 / F M4 t(8;16)(p11;p13) 27 96 + NA G NA 4 24 / M PML-RARα / M3 t(15;17) 5 90 - - G G 5 52 / M PML-RARα / M3 t(15;17) 1.5 75 - - G G 6 31 / F PML-RARα / M3 t(15;17) 3.2 89 - - G G 7 23 / M RUNX1-RUNX1T1 / M2 t(8;21) 38 34 - + ND G 8 52 / M RUNX1-RUNX1T1 / M2 t(8;21) 8 68 - - ND G 9 40 / M RUNX1-RUNX1T1 / M2 t(8;21) 5.1 54 - - ND G 10 63 / M CBFβ-MYH11 / M4 inv(16) 297 80 - - ND G 11 63 / M CBFβ-MYH11 / M4 inv(16) 7 74 - - ND G 12 59 / M CBFβ-MYH11 / M0 t(16;16) 108 94 - - ND G 13 41 / F MLLT3-MLL / M5 t(9;11) 51 90 - + G R 14 38 / F M5 46, XX 36 79 - + G G 15 76 / M M4 46 XY, der(10) 21 90 - - G NA 16 59 / M M4 NA 29 59 - - M G 17 26 / M M5 46, XY 295 92 - + G G 18 62 / F M5 NA 67 88 - + M A 19 47 / F M5 del(11q23) 17 78 - + M G 20 50 / F M5 46, XX 61 59 - + M G 21 28 / F M5 46, XX 132 90 - + G G 22 30 / F AML-MD / M5 46, XX 6 79 - + M G 23 64 / M AML-MD / M1 46, XY 17 83 - + M G WBC: white blood cell.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Supplemental Figure 1 Characterization of Lung Tumors In
    Supplemental Figure 1 Characterization of lung tumors in KC mice. (A) Scatter plots of visible spontaneous tumors counted on the lung surfaces at necropsy. Each dot represents a value from a single mouse, and the bars and whiskers show the mean SD for each cohort from a single experiment. P value, two-tailed Student’s t-test. (B) Histologic analysis of spontaneous lung tumors in (A). Results indicate the numbers of lung lesions per histologic subtype per genotype. N, cohort sample sizes. P values, Fisher's exact test. Supplemental Figure 2 Surfactant protein C (SPC) expression in p21-deficient (KC) and –replete (K) tumor cell lines. Immunofluorescence staining with anti-surfactant protein C antibody (green) or normal IgG as a negative control. DAPI, blue. SPC/DAPI and IgG/DAPI are merged images. Scale bar, 20 µm. Supplemental Figure 3 Somatic recombination of latent KrasG12D allele and detection of p21 protein in p21-deficient (KC) and –replete (K) tumor cell lines. (A) PCR analysis of the K-rasLA1 and K-rasWT alleles in genomic DNA. Somatic recombination of the K-rasLA1 allele leads to loss of the PCR product (upper band, arrow). Wild-type K-ras allele detected (250 bp). Tail DNAs from KrasLA1 mice (KrasLA1/+) and wild-type mice (Kras+/+) were used as positive and negative controls, respectively, for the presence of the germline K-rasLA1 allele. (B) Immunoblot analysis of p21 expression. Actin was used as a loading control. Supplemental Figure 4 Growth and metastasis of p21-deficient (KC) tumor cell lines in Cdkn1a-null or –wild-type mice.
    [Show full text]
  • Supporting Information for Proteomics DOI 10.1002/Pmic.200500648
    Supporting Information for Proteomics DOI 10.1002/pmic.200500648 Fiona M. McCarthy, Amanda M. Cooksey, Nan Wang, Susan M. Bridges, G. Todd Pharr and Shane C. Burgess Modeling a whole organ using proteomics: The avian bursa of Fabricius ª 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.proteomics-journal.com Supporting Text: Determining Tissue Expression Patterns for Transcription Factors. We identified 107 transcription factors (TFs) from post-hatch bursas. Since the Transfac database (1) did not contain all of these TFs, we used PubMed literature searches to determine expression patterns for each. For each transcription factor, we searched PubMed for a combination of the protein and gene names, as determined by both NCBI and UniProt records. For example, Pax7 (gi:2576239; UniProt O42349) was searched as both PAX7 and Pax-7. In each case, articles were manually searched to confirm TF expression. We combined the TF names with the following terms to obtain reported tissue expression patterns: 1. Expression in the bursa. AND bursa* OR DT40 eg. (Pax7 OR “Pax-7”) AND (bursa* OR DT40) returned no items. 2. Expression in immune tissue. AND lymphocyte* OR leukocyte* OR “bone marrow” OR spleen OR “embryonic liver” OR hematopoietic eg. (Pax7 OR “Pax-7”) AND (lymphocyte* OR leukocyte* OR “bone marrow” OR spleen OR “embryonic liver” OR hematopoietic) returned 17 articles. 3. Expression during development. AND development OR embryo* eg. (Pax7 OR “Pax-7”) AND (development OR embryo*) returned 135 articles. 4. Expression in nervous tissue. AND neuron* OR nervous OR CNS OR retina* 1 eg. (Pax7 OR “Pax-7”) AND (neuron* OR nervous OR CNS OR retina*) returned 53 articles.
    [Show full text]
  • Eudragit® RL) Nanoparticles by Human THP-1 Cell Line and Its Effects on Hematology and Erythrocyte Damage in Rats
    AVERTISSEMENT Ce document est le fruit d'un long travail approuvé par le jury de soutenance et mis à disposition de l'ensemble de la communauté universitaire élargie. Il est soumis à la propriété intellectuelle de l'auteur. Ceci implique une obligation de citation et de référencement lors de l’utilisation de ce document. D'autre part, toute contrefaçon, plagiat, reproduction illicite encourt une poursuite pénale. Contact : [email protected] LIENS Code de la Propriété Intellectuelle. articles L 122. 4 Code de la Propriété Intellectuelle. articles L 335.2- L 335.10 http://www.cfcopies.com/V2/leg/leg_droi.php http://www.culture.gouv.fr/culture/infos-pratiques/droits/protection.htm Ecole Doctorale BioSE (Biologie-Santé-Environnement) Thèse Présentée et soutenue publiquement pour l’obtention du titre de DOCTEUR DE l’UNIVERSITE DE LORRAINE Mention : « Sciences de la Vie et de la Santé » par Ramia SAFAR Etude toxicologique de nanoparticules polymériques véhicules de S-nitrosoglutathion Le 4 décembre 2015 Membres du jury : Rapporteurs : Mme Armelle BAEZA Professeur, Université Paris Diderot, Paris Mme Françoise PONS Professeur, Université de Strasbourg, Strasbourg Examinateurs : M. Bertrand RIHN Professeur, Université de Lorraine, Nancy Directeur de thèse M. Olivier JOUBERT Maître de conférences, Université de Lorraine, Nancy Co-directeur de thèse Invités : M. Jean-Claude ANDRE Directeur de Recherche Emérite, INSIS CNRS, Paris M. Alain LE FAOU Professeur Emérite, Université de Lorraine, Nancy EA 3452 CITHEFOR, « Cibles Thérapeutiques,
    [Show full text]
  • Hormone Induced Differential Transcriptome Analysis of Sertoli Cells During Postnatal Maturation of Rat Testes
    RESEARCH ARTICLE Hormone induced differential transcriptome analysis of Sertoli cells during postnatal maturation of rat testes Mukesh Gautam1☯¤a, Indrashis Bhattacharya2☯¤b, Umesh Rai1, Subeer S. Majumdar2,3* 1 Department of Zoology, University of Delhi, Delhi, India, 2 Cellular Endocrinology Laboratory, National Institute of Immunology, New Delhi, India, 3 National Institute of Animal Biotechnology, Hyderabad, India ☯ These authors contributed equally to this work. a1111111111 ¤a Current address: The Ken & Ruth Davee Department of Neurology, Northwestern University, Chicago, a1111111111 Illinois, United States of America a1111111111 ¤b Current address: Department of Zoology, Hemvati Nandan Bahuguna Garhwal University, Srinagar, a1111111111 Garhwal, Uttarakhand, India a1111111111 * [email protected] Abstract OPEN ACCESS Sertoli cells (Sc) are unique somatic cells of testis that are the target of both FSH and testos- Citation: Gautam M, Bhattacharya I, Rai U, terone (T) and regulate spermatogenesis. Although Sc of neonatal rat testes are exposed to Majumdar SS (2018) Hormone induced differential high levels of FSH and T, robust differentiation of spermatogonial cells becomes conspicu- transcriptome analysis of Sertoli cells during ous only after 11-days of postnatal age. We have demonstrated earlier that a developmental postnatal maturation of rat testes. PLoS ONE 13(1): e0191201. https://doi.org/10.1371/journal. switch in terms of hormonal responsiveness occurs in rat Sc at around 12 days of postnatal pone.0191201 age during the rapid transition of spermatogonia A to B. Therefore, such ªfunctional matura- Editor: Suresh Yenugu, University of Hyderabad, tionº of Sc, during pubertal development becomes prerequisite for the onset of spermato- INDIA genesis. However, a conspicuous difference in robust hormone (both T and FSH) induced Received: August 20, 2017 gene expression during the different phases of Sc maturation restricts our understanding about molecular events necessary for the spermatogenic onset and maintenance.
    [Show full text]
  • Detection of Tissue-Specific Genes and Computational Analysis of Testis
    Detection of tissue-specific genes and Title computational analysis of testis-specific gene expression regulatory regions Author(s) 山下, 明史 Citation Issue Date Text Version ETD URL http://hdl.handle.net/11094/2599 DOI rights Note Osaka University Knowledge Archive : OUKA https://ir.library.osaka-u.ac.jp/ Osaka University Detection of tissue-specific genes and computational analysis of testis-specific gene expression regulatory regions (組織特異的遺伝子の検出と精巣特異的遺伝子の 発現制御領域のコンピュータを使った解析) by Akifumi Yamashita Department of Genome Informatics, Genome Information Research Center, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871, Japan February, 2009 1/97 Contents LIST of ABBREVIATIONS 5 ABSTRACT 6 1 INTRODUCTION 7 2 METHODS 10 2.1 Detection of tissue-specific genes 10 2.2 Annotation of tissue-specific genes 10 2.3 Extracting the 5′-regulatory regions 11 2.4 Selection of over-represented 8-mers 11 2.5 Comparison of the 8-mer frequency within regulatory regions of 13 testis-specific genes with those of non-testis-specific genes. 3 RESULTS 14 3.1 Detection of tissue-specific genes 14 3.2 Selection of testis-specific genes which can be used for the 14 following analysis 3.3 Classification of the over-represented 8-mers 15 3.4 Conservations of the flanking region of highlighted 8-mers 16 2/97 4 DISCUSSION 18 ACKNOWLEDGEMENTS 23 REFERENCES 24 TABLES 27 Table 1 - Number of tissue-specific genes 27 Table 2 - Classification of 117 representative 8-mers on the basis of their 28 testis association level Table 3 - 8-mers which appeared near by the other 8-mers 31 FIGURES 32 Fig.
    [Show full text]