DOCSLIB.ORG

Inhibition of Sphingolipid Synthesis Improves Outcomes and Survival in GARP Mutant Wobbler Mice, a Model of Motor Neuron Degeneration

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Inhibition of Sphingolipid Synthesis Improves Outcomes and Survival in GARP Mutant Wobbler Mice, a Model of Motor Neuron Degeneration Inhibition of sphingolipid synthesis improves outcomes and survival in GARP mutant wobbler mice, a model of motor neuron degeneration Constance S. Petita,b,1, Jane J. Leea,b,1, Sebastian Bolanda,b, Sharan Swarupb, Romain Christianoa,b, Zon Weng Laia,b, Niklas Mejherta,b, Shane D. Elliotta,b, David McFallc, Sara Haquea,b, Eric J. Huangc, Roderick T. Bronsond, J. Wade Harperb, Robert V. Farese Jra,b,e,2,3, and Tobias C. Walthera,b,e,f,2,3 aDepartment of Molecular Metabolism, Harvard T. H. Chan School of Public Health, Harvard University, Boston, MA 02115; bDepartment of Cell Biology, Harvard Medical School, Boston, MA 02115; cDepartment of Pathology, University of California, San Francisco, CA 94143; dDepartment of Immunology, Harvard Medical School, Boston, MA 02115; eBroad Institute of MIT and Harvard University, Cambridge, MA 02124; and fHoward Hughes Medical Institute, Harvard University, Boston, MA 02115 Edited by Pietro De Camilli, Yale University, New Haven, CT, and approved March 16, 2020 (received for review August 12, 2019) Numerous mutations that impair retrograde membrane trafficking wobbler mice, a partial loss-of-function mutation (L967Q) in the between endosomes and the Golgi apparatus lead to neurode- Vps54-encoded subunit of GARP is responsible for motor neuron generative diseases. For example, mutations in the endosomal loss with features similar to amyotrophic lateral sclerosis (ALS) retromer complex are implicated in Alzheimer’s and Parkinson’s (9–13). diseases, and mutations of the Golgi-associated retrograde protein Previously, we and others showed that mutations of GARP (GARP) complex cause progressive cerebello-cerebral atrophy type complex proteins result in abnormalities in sterol and sphingo- 2 (PCCA2). However, how these mutations cause neurodegenera- lipid metabolism, as well as vacuolar or lysosomal morphology, in tion is unknown. GARP mutations in yeast, including one causing cultured yeast or human HeLa cells (14, 15). In particular, PCCA2, result in sphingolipid abnormalities and impaired cell GARP mutations result in accompanying increases in the growth that are corrected by treatment with myriocin, a sphingo- lipid synthesis inhibitor, suggesting that alterations in sphingoli- sphingoid long-chain bases, sphinganine and sphingosine, that NEUROSCIENCE pid metabolism contribute to cell dysfunction and death. Here we are intermediates in sphingolipid metabolism. The accumulation tested this hypothesis in wobbler mice, a murine model with a of these lipids can lead to cell dysfunction or cell death (16, 17), homozygous partial loss-of-function mutation in Vps54 (GARP pro- and sphingoid base accumulation in GARP mutant cells correlates tein) that causes motor neuron disease. Cytotoxic sphingoid long- with impaired growth (14). Further, treatment of GARP-deficient chain bases accumulated in embryonic fibroblasts and spinal cords from wobbler mice. Remarkably, chronic treatment of wobbler Significance mice with myriocin markedly improved their wellness scores, grip strength, neuropathology, and survival. Proteomic analyses of Neurodegenerative diseases, including Alzheimer’s and Par- wobbler fibroblasts revealed extensive missorting of lysosomal kinson’s diseases, are major public health problems. Analysis of proteins, including sphingolipid catabolism enzymes, to the Golgi gene mutations that cause these diseases points to an impor- compartment, which may contribute to the sphingolipid abnor- tant role of membrane trafficking within cells in disease malities. Our findings establish that altered sphingolipid metabo- development, but how such processes participate in the pa- lism due to GARP mutations contributes to neurodegeneration and thology is unclear. Here, we analyze a murine model of com- suggest that inhibiting sphingolipid synthesis might provide a use- promised membrane trafficking (due to mutation of a protein ful strategy for treating these disorders. complex at the Golgi apparatus) and find metabolites of sphingolipids, molecules enriched particularly in the brain, ac- sphingolipid | neurodegeneration | myriocin | amyotrophic lateral cumulate in cells and tissues of this model. Preventing this sclerosis | wobbler mice buildup pharmacologically improved the symptoms of neuro- degeneration and survival in these mice. Thus, our data provide eurodegenerative diseases are a major health challenge in evidence that modulating sphingolipid metabolism will provide Naging populations (1, 2). Despite intensive investigation, a therapeutic avenue to treat some forms of neurodegenerative effective therapies for these diseases are lacking, in part because disease. the most proximate causes of neurodegeneration are not well understood. Genetic evidence from humans or animal models Author contributions: C.S.P., J.J.L., R.V.F., and T.C.W. designed research; C.S.P., J.J.L., S.B., S.S., R.C., Z.W.L., S.D.E., S.H., and J.W.H. performed research; J.J.L. and S.B. contributed has implicated impaired trafficking and cargo sorting by retro- new reagents/analytic tools; C.S.P., J.J.L., S.B., S.S., R.C., Z.W.L., N.M., D.M., E.J.H., R.T.B., mer or the Golgi-associated retrograde protein (GARP) com- and J.W.H. analyzed data; and C.S.P., J.J.L., R.V.F., and T.C.W. wrote the paper. plex as causes of neurodegenerative disease (3, 4). This The authors declare no competing interest. trafficking pathway involves the retromer complex at endosomes This article is a PNAS Direct Submission. for sorting endocytosed proteins into membrane carriers and the Published under the PNAS license. GARP complex for tethering retrograde carriers at the Golgi Data deposition: The mass spectrometry proteomics data have been deposited to the apparatus to receive those proteins. Defects in endosome-to-Golgi ProteomeXchange Consortium via the PRIDE partner repository with the dataset retrograde trafficking caused by a mutation in the retromer identifier PXD007981. component VPS35 (D620N) have been reported as causes of late- 1C.S.P. and J.J.L. contributed equally to this work. ’ and early-onset Parkinson s disease (5). Reduced expression of 2R.V.F. and T.C.W. contributed equally to this work. ’ retromer proteins has also been linked to Alzheimer sdisease 3To whom correspondence may be addressed. Email: [email protected] or (AD) (6). At the Golgi complex, mutations of GARP proteins [email protected]. (e.g., VPS51 and VPS53) have been identified as causes of severe This article contains supporting information online at https://www.pnas.org/lookup/suppl/ childhood neurological diseases, including progressive cerebello- doi:10.1073/pnas.1913956117/-/DCSupplemental. cerebral atrophy type 2 (PCCA2) in the case of VPS53 (7, 8). In First published April 28, 2020. www.pnas.org/cgi/doi/10.1073/pnas.1913956117 PNAS | May 12, 2020 | vol. 117 | no. 19 | 10565–10574 Downloaded by guest on September 28, 2021 A wild type wild type wobbler wobbler **** ns 20 1 GOLGA2 100 (fold change) Golgi (µm) area covered by Golgi 10 μm 0 lysosome to nearest 0 wild type wobbler **** **** **** 0.20 1.0 1 nm) ) 2 LAMP1 0.10 0.5 (µm lysosomes ( area of lysosome distance between per cell (fold change) 10 μm number of lysosomes 0 0 0 BC 8 8 Neu1 Sptlc2 Smpdl3a Cers2 Neu3* 6 Lamp1 6 Gm2a* Asah2 Smpdl3b Sgpl1 Hexb* Galc* Npc1 Kdsr Asah1* Psap CtsD Smpd2 Psap* Gba* Cers6 Hexa Naga* Hexa* Smpd3 Cers5 Ugcg Sgms1 Smpd1* Golga2 Pdxdc1 4 4 Abca2 (p-value) Degs1 (p-value) 10 10 Sptlc1 B4galt5 Gla* -log -log Smpd4 2 2 Agk B3galnt1 B3galnt1 Gnptg Golgi proteins Golgi proteins Lysosomal proteins Sphk2* SL biosynthesis Golgi proteins (IF,WB) 0 0 Sgms2 SL degradation Lysosomal proteins (IF,WB) Lysosomal proteins -6 -4-20246 -6 -4 -2 0 2 4 6 -log fold change (wobbler / wild type) 2 -log2 fold change (wobbler / wild type) D Golgi fraction NPC1 150 kDa HEXA 50 kDa PSAP 50 kDa 50 kDa Pro-CTSD Prepro-CTSD 37 kDa Ponceau stain Mature CTSD 37 kDa ACTIN wild typewobbler wild typewobbler Fig. 1. The wobbler mutation of the GARP complex leads to missorting of proteins. (A) GOLGA2 staining in MEFs reveals no significant (ns) differences in the size of the Golgi compartment, whereas LAMP1 staining in wild-type and wobbler MEFs, followed by quantification of LAMP1 per cell (n ∼ 250 cells per condition), shows reduced numbers and larger size of lysosomes. Mean, SD ****P < 0.0001 by Mann–Whitney test. (Scale bar, 10 μm.) Analysis also revealed altered distribution of lysosomes depicted as distance from LAMP1 to GOLGA2 and between LAMP1 particles per cell area (n ∼ 20 cells per genotype) Mean, 95% CI ****P < 0.0001 by Mann–Whitney test. (B) TMT-based quantitative proteomics shows the enrichment of lysosomal proteins (orange) (P value = 2.98 × 10−35) and (C) enrichment of sphingolipid metabolism enzymes (P value = 6.85 × 10−11) in the Golgi-enriched fractions from wobbler cells, by Wilcoxon rank sum test. Lysosomal proteins (orange and green) are enriched in wobbler MEFs while Golgi proteins (purple) were relatively unchanged. Proteins labeled for imaging by immunofluorescence (A) or for Western blots (D and SI Appendix, Fig. S1F) are labeled (purple and green). Sphingolipid biosynthetic (blue) and catabolic (red) enzymes in the Golgi-enriched fraction shows many catabolic enzymes normally residing at lysosome (asterisk). (D) Western blot and Ponceau analysis of lysosomal proteins in Golgi-enriched fractions from wild-type and wobbler cells verifies enrichment of lysosomal proteins and reveals defects in CTSD processing. Actin is shown as a loading control in these fractions with enriched,
Load more

Recommended publications
  • Combination of Photodynamic Therapy with Fenretinide and C6
    Wayne State University Wayne State University Theses 1-1-2015 Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis Nithin Bhargava Boppana Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_theses Part of the Medicinal Chemistry and Pharmaceutics Commons Recommended Citation Boppana, Nithin Bhargava, "Combination Of Photodynamic Therapy With Fenretinide And C6-Pyridinium Ceramide Enhances Killing Of Scc17b Human Head And Neck Squamous Cell Carcinoma Cells Via The eD Novo Sphingolipid Biosynthesis And Mitochondrial Apoptosis" (2015). Wayne State University Theses. 431. https://digitalcommons.wayne.edu/oa_theses/431 This Open Access Thesis is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Theses by an authorized administrator of DigitalCommons@WayneState. COMBINATION OF PHOTODYNAMIC THERAPY WITH FENRETINIDE AND C6-PYRIDINIUM CERAMIDE ENHANCES KILLING OF SCC17B HUMAN HEAD AND NECK SQUAMOUS CELL CARCINOMA CELLS VIA THE DE NOVO SPHINGOLIPID BIOSYNTHESIS AND MITOCHONDRIAL APOPTOSIS by NITHIN BHARGAVA BOPPANA THESIS Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE 2015 MAJOR: PHARMACEUTICAL SCIENCES Approved By: ________________________________ Advisor Date © COPYRIGHT BY NITHIN BHARGAVA BOPPANA 2015 All Rights Reserved DEDICATION Dedicated to my mom Rekha Vasireddy for always believing in me and helping me in becoming the person who I am today. ii ACKNOWLEDGEMENTS I am grateful to my advisor, Dr. Duska Separovic for her invaluable mentorship throughout the project.
    [Show full text]
  • Implications in Parkinson's Disease
    Journal of Clinical Medicine Review Lysosomal Ceramide Metabolism Disorders: Implications in Parkinson’s Disease Silvia Paciotti 1,2 , Elisabetta Albi 3 , Lucilla Parnetti 1 and Tommaso Beccari 3,* 1 Laboratory of Clinical Neurochemistry, Department of Medicine, University of Perugia, Sant’Andrea delle Fratte, 06132 Perugia, Italy; [email protected] (S.P.); [email protected] (L.P.) 2 Section of Physiology and Biochemistry, Department of Experimental Medicine, University of Perugia, Sant’Andrea delle Fratte, 06132 Perugia, Italy 3 Department of Pharmaceutical Sciences, University of Perugia, Via Fabretti, 06123 Perugia, Italy; [email protected] * Correspondence: [email protected] Received: 29 January 2020; Accepted: 20 February 2020; Published: 21 February 2020 Abstract: Ceramides are a family of bioactive lipids belonging to the class of sphingolipids. Sphingolipidoses are a group of inherited genetic diseases characterized by the unmetabolized sphingolipids and the consequent reduction of ceramide pool in lysosomes. Sphingolipidoses include several disorders as Sandhoff disease, Fabry disease, Gaucher disease, metachromatic leukodystrophy, Krabbe disease, Niemann Pick disease, Farber disease, and GM2 gangliosidosis. In sphingolipidosis, lysosomal lipid storage occurs in both the central nervous system and visceral tissues, and central nervous system pathology is a common hallmark for all of them. Parkinson’s disease, the most common neurodegenerative movement disorder, is characterized by the accumulation and aggregation of misfolded α-synuclein that seem associated to some lysosomal disorders, in particular Gaucher disease. This review provides evidence into the role of ceramide metabolism in the pathophysiology of lysosomes, highlighting the more recent findings on its involvement in Parkinson’s disease. Keywords: ceramide metabolism; Parkinson’s disease; α-synuclein; GBA; GLA; HEX A-B; GALC; ASAH1; SMPD1; ARSA * Correspondence [email protected] 1.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Expression Profiling of KLF4
    Expression Profiling of KLF4 AJCR0000006 Supplemental Data Figure S1. Snapshot of enriched gene sets identified by GSEA in Klf4-null MEFs. Figure S2. Snapshot of enriched gene sets identified by GSEA in wild type MEFs. 98 Am J Cancer Res 2011;1(1):85-97 Table S1: Functional Annotation Clustering of Genes Up-Regulated in Klf4 -Null MEFs ILLUMINA_ID Gene Symbol Gene Name (Description) P -value Fold-Change Cell Cycle 8.00E-03 ILMN_1217331 Mcm6 MINICHROMOSOME MAINTENANCE DEFICIENT 6 40.36 ILMN_2723931 E2f6 E2F TRANSCRIPTION FACTOR 6 26.8 ILMN_2724570 Mapk12 MITOGEN-ACTIVATED PROTEIN KINASE 12 22.19 ILMN_1218470 Cdk2 CYCLIN-DEPENDENT KINASE 2 9.32 ILMN_1234909 Tipin TIMELESS INTERACTING PROTEIN 5.3 ILMN_1212692 Mapk13 SAPK/ERK/KINASE 4 4.96 ILMN_2666690 Cul7 CULLIN 7 2.23 ILMN_2681776 Mapk6 MITOGEN ACTIVATED PROTEIN KINASE 4 2.11 ILMN_2652909 Ddit3 DNA-DAMAGE INDUCIBLE TRANSCRIPT 3 2.07 ILMN_2742152 Gadd45a GROWTH ARREST AND DNA-DAMAGE-INDUCIBLE 45 ALPHA 1.92 ILMN_1212787 Pttg1 PITUITARY TUMOR-TRANSFORMING 1 1.8 ILMN_1216721 Cdk5 CYCLIN-DEPENDENT KINASE 5 1.78 ILMN_1227009 Gas2l1 GROWTH ARREST-SPECIFIC 2 LIKE 1 1.74 ILMN_2663009 Rassf5 RAS ASSOCIATION (RALGDS/AF-6) DOMAIN FAMILY 5 1.64 ILMN_1220454 Anapc13 ANAPHASE PROMOTING COMPLEX SUBUNIT 13 1.61 ILMN_1216213 Incenp INNER CENTROMERE PROTEIN 1.56 ILMN_1256301 Rcc2 REGULATOR OF CHROMOSOME CONDENSATION 2 1.53 Extracellular Matrix 5.80E-06 ILMN_2735184 Col18a1 PROCOLLAGEN, TYPE XVIII, ALPHA 1 51.5 ILMN_1223997 Crtap CARTILAGE ASSOCIATED PROTEIN 32.74 ILMN_2753809 Mmp3 MATRIX METALLOPEPTIDASE
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Transcriptome Alteration in the Diabetic Heart by Rosiglitazone: Implications for Cardiovascular Mortality
    Transcriptome Alteration in the Diabetic Heart by Rosiglitazone: Implications for Cardiovascular Mortality Kitchener D. Wilson1,3., Zongjin Li1., Roger Wagner2, Patrick Yue2, Phillip Tsao2, Gergana Nestorova4, Mei Huang1, David L. Hirschberg4, Paul G. Yock2,3, Thomas Quertermous2, Joseph C. Wu1,2* 1 Department of Radiology, Stanford University School of Medicine, Stanford, California, United States of America, 2 Department of Medicine, Division of Cardiology, Stanford University School of Medicine, Stanford, California, United States of America, 3 Department of Bioengineering, Stanford University School of Medicine, Stanford, California, United States of America, 4 Human Immune Monitoring Center, Stanford University School of Medicine, Stanford, California, United States of America Abstract Background: Recently, the type 2 diabetes medication, rosiglitazone, has come under scrutiny for possibly increasing the risk of cardiac disease and death. To investigate the effects of rosiglitazone on the diabetic heart, we performed cardiac transcriptional profiling and imaging studies of a murine model of type 2 diabetes, the C57BL/KLS-leprdb/leprdb (db/db) mouse. Methods and Findings: We compared cardiac gene expression profiles from three groups: untreated db/db mice, db/db mice after rosiglitazone treatment, and non-diabetic db/+ mice. Prior to sacrifice, we also performed cardiac magnetic resonance (CMR) and echocardiography. As expected, overall the db/db gene expression signature was markedly different from control, but to our surprise was
    [Show full text]
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
    [Show full text]
  • Supplementary File 2A Revised
    Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]
  • A Selective Inhibitor of Ceramide Synthase 1 Reveals a Novel Role in Fat Metabolism
    ARTICLE DOI: 10.1038/s41467-018-05613-7 OPEN A selective inhibitor of ceramide synthase 1 reveals a novel role in fat metabolism Nigel Turner1, Xin Ying Lim2,3, Hamish D. Toop 4, Brenna Osborne 1, Amanda E. Brandon5, Elysha N. Taylor4, Corrine E. Fiveash1, Hemna Govindaraju1, Jonathan D. Teo3, Holly P. McEwen3, Timothy A. Couttas3, Stephen M. Butler4, Abhirup Das1, Greg M. Kowalski 6, Clinton R. Bruce6, Kyle L. Hoehn 7, Thomas Fath1,10, Carsten Schmitz-Peiffer8, Gregory J. Cooney5, Magdalene K. Montgomery1, Jonathan C. Morris 4 & Anthony S. Don3,9 1234567890():,; Specific forms of the lipid ceramide, synthesized by the ceramide synthase enzyme family, are believed to regulate metabolic physiology. Genetic mouse models have established C16 ceramide as a driver of insulin resistance in liver and adipose tissue. C18 ceramide, syn- thesized by ceramide synthase 1 (CerS1), is abundant in skeletal muscle and suggested to promote insulin resistance in humans. We herein describe the first isoform-specific ceramide synthase inhibitor, P053, which inhibits CerS1 with nanomolar potency. Lipidomic profiling shows that P053 is highly selective for CerS1. Daily P053 administration to mice fed a high- fat diet (HFD) increases fatty acid oxidation in skeletal muscle and impedes increases in muscle triglycerides and adiposity, but does not protect against HFD-induced insulin resis- tance. Our inhibitor therefore allowed us to define a role for CerS1 as an endogenous inhibitor of mitochondrial fatty acid oxidation in muscle and regulator of whole-body adiposity. 1 School of Medical Sciences, UNSW Sydney, Sydney 2052 NSW, Australia. 2 Prince of Wales Clinical School, Faculty of Medicine, UNSW Sydney, Sydney 2052 NSW, Australia.
    [Show full text]