DOCSLIB.ORG

Generate Metabolic Map Poster

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Authors: Pallavi Subhraveti Ron Caspi Quang Ong Peter D Karp An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Ingrid Keseler Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_002025645Cyc: Curtobacterium pusillum AA3 Cellular Overview Connections between pathways are omitted for legibility. Anamika Kothari D-mannitol phosphate phosphate phosphate putrescine glycine betaine glycine betaine ammonium ammonium Fe 2+ D-gluconate ammonium H + spermidine gly gly enterobactin predicted predicted PEP-driven ABC RS16670 RS10785 RS04295 RS03485 RS01160 RS13465 RS13470 AtpD RS14785 RS17505 RS12115 transporter transporter of D-mannitol of phosphate putrescine glycine betaine glycine betaine ammonium ammonium phosphate phosphate Fe 2+ D-gluconate ammonium H + spermidine gly gly enterobactin D-mannitol 1-phosphate phosphate Amino Acid Degradation Cofactor, Prosthetic Group, Electron Carrier, and Vitamin Biosynthesis Degradation/ Macromolecule Modification lipoprotein posttranslational Utilization/ ditrans,octacis- 1-stearoyl- DNA combined 3-oxo-2-(cis- a (7Z,10Z,13Z a [protein]-L- modification L-valine degradation I Assimilation - Other a 3-oxoglutaryl- (S)-1-pyrroline- [2Fe-2S] iron-sulfur cluster biosynthesis L-glutamine O-acetyl-L-serine hydrogen selenide a palmitoyl-[acp] sn-glycerol with exogenous 2'-pentenyl)- a protein H O diphosphate ,16Z,19Z)-3- met menaquinol-9 biosynthesis 1,4-dihydroxy-2- Aminoacyl-tRNA Charging L-methionine degradation L-serine degradation L-arginine degradation X (arginine a tRNA precursor CTP ATP undecaprenyldiphospho- acetyl-CoA 2 dITP ITP [acp] methyl ester 5-carboxylate methionine superpathway of tetrahydrofolate biosynthesis demethylmenaquinol- molybdenum cofactor biosynthesis di-trans,poly-cis-undecaprenyl lipoate biosynthesis a [prolipoprotein]- acrylonitrile peptide- I (to L-homocysteine) degradation I bifunctional o- N-acetyl-(N- 1-acyl-sn-glycerol-3-phosphate DNA to form a cyclopentane-1- ATP-dependent inorganic 3-oxoacyl-ACP oxodocosa- 1-pyrroline-5- bifunctional 9 biosynthesis naphthoate biosynthesis phosphate biosynthesis and incorporation I monooxygenase pathway) acetyl-CoA C- non-canonical purine non-canonical purine L-cysteine degradation I CCA tRNA recombinational hexanoyl-CoA pyrophosphatase: 7,10,13,16,19- carboxylate methionine tRNA charging val acetylhomoserine/o- acetylglucosaminyl) 3-phosphate crossover junction Clp protease reductase FabG: 3-oxoacyl-ACP glutamate N- predicted L-cysteine desulfurase all-trans- demethylmenaquinol-9 nucleotidyltransferase: acyltransferase: NTP pyrophosphatase, NTP pyrophosphatase, (S)-S-oxide chorismate cys (2E,6E)-farnesyl demethylmenaquinol- L-asparagine prolipoprotein ser acetylserine sulfhydrylase: muramoyl-L-alanyl- acyltransferase: junction proteolytic subunit: BUE88_RS12210 BUE88_RS02435 pentaenoyl-[acp] dehydrogenase: acetyltransferase/ ABC GTP 2-carboxy-1,4- demethylmenaquinone met arg gln acrylonitrile endodeoxyribonuclease BUE88_RS08345 RdgB/HAM1 family: rdgB RdgB/HAM1 family: rdgB reductase FabG: nonaprenyl an octanoyl-[acp] biosynthesis III diacylglyceryl BUE88_RS11360 γ BUE88_RS12075 reductase: cysteine naphthoquinol isochorismate ATP diphosphate 8 biosynthesis I branched-chain methionine L-serine CTP synthase: BUE88_RS03525 -D-isoglutaminyl- BUE88_RS04005 RuvC: BUE88_RS01990 BUE88_RS17195 inorganic 3-oxoacyl-ACP BUE88_RS02435 amino-acid met transporter met diphosphate methyltransferase: lipoate-protein arginine-- acetyl-CoA C- NTP NTP msrA 1,4-dihydroxy- synthase: cysteine arg (tRNA-dependent) transferase: ammonia-lyase: BUE88_RS08675 CCA tRNA N-(β-D-asparaginyl)peptidoglycan pyrophosphatase: 1-pyrroline-5- acetyltransferase of L- desulfurase: BUE88_RS05490 tRNA ligase: amino acid adenosyltransferase: O-acetylhomoserine [+ 2 isozymes]1-stearoyl- Holliday junction ATP-dependent Clp reductase: 3-oxoacyl-ACP GTP 2-naphthoate ligase B: 2-carboxy-1,4- BUE88_RS02710 nucleotidyltransferase: di-trans,octa-cis a peptidoglycan acyltransferase: pyrophosphohydrolase: pyrophosphohydrolase: BUE88_RS05875 BUE88_RS05495 desulfurase: GTP di-trans,octa-cis aminotransferase: BUE88_RS02805 2-aminoprop-BUE88_RS10735 [+ 5 isozymes] aminocarboxypropyltransferase/ -L-lysyl-D-alanineglycosyltransferase: protease proteolytic BUE88_RS15140 BUE88_RS14775 carboxylate ArgJ: peptide- methionine cyclohydrolase I: menaquinol-9 a [lipoyl-carrierBUE88_RS03925 naphthoquinol BUE88_RS03190 an L-arginyl- asp 4-guanidinobutyramide 2-palmitoyl- resolution ofresolvase RuvX: 3-oxo-2-(cis-BUE88_RS01125 BUE88_RS11945 BUE88_RS11945 a (3R)-3- a (3R,7Z,10reductase:Z polyprenyltransferase: isochorismate a [prolipoprotein]- acrylamide a tRNA BUE88_RS19420 -undecaprenyl dimer acyl-carrier protein + BUE88_RS05875 -undecaprenyl 6 1,4-dihydroxy- BUE88_RS04210 SAM 2-enoate Glu cysteine synthase: BUE88_RS18770 subunit: clpP phosphate H dehydrogenase: BUE88_RS08755 methionine cysteine BUE88_RS10485 protein] N - [tRNA Arg ] aspartate-- sn-glycerol recombinationalBUE88_RS02905 2'-pentenyl)- hydroxyglutaryl- ,13Z,16Z,19ZBUE88_RS14775)-3- met RS11125 met BUE88_RS05515 diphosphate 2-naphthoate (S-diacylglyceryl) containing a diphosphate (tetrapeptide) dIMP IMP BUE88_RS18480 (S)-S-oxide cysteine Arg 3-methyl-2- BUE88_RS03670 cyclopentane-1- desulfurase: 7,8- demethylmenaquinol-9 2-succinyl-5- GTP 3',8- octanoyl-L-lysine a tRNA tRNA(Asn) ligase: -L-cysteine amidase: amidase: 3-phosphate junction a peptide a peptide [acp] methyl ester hydroxydocosa- N-acetylglutamate desulfurase: a carboxy- undecaprenyl- polyprenyltransferase: 3' CCA end reductase: BUE88_RS03730 dihydroneopterin cyclase MoaA: lipoyl BUE88_RS05585 oxobutanoate BUE88_RS03345 BUE88_RS03345 acetate L-selenocysteine formation of two (3-oxooctanoyl) 7,10,13,16,19- Glu synthase: enolpyruvyl- adenylated diphosphate BUE88_RS05515 an L-aspartyl- msrA 3'-triphosphate BUE88_RS03730 BUE88_RS07215 synthase: intact strands -CoA pentaenoyl-[acp] BUE88_RS12310 6-hydroxy-3- Asn signal a protein-L- an S-sulfanyl-[L- an [L-cysteine [small subunit of (8S)-3',8-cyclo-7,8- phosphatase: demethylmenaquinol-8 [tRNA ] N-acetyl-L- asn RS04310 asn lipA peptidase 2-iminopropanoate 4-guanidinobutanoate acrylate methionine- cysteine desulfurase] cyclohexene- desulfurase]-S- molybdopterin BUE88_RS02280 a [lipoyl-carrier dihydroguanosine Asp-tRNA(Asn) SAH methionine 1-carboxylic- di-trans,octa-cis 6 II: lspA (S)-S-oxide sulfanyl-L-cysteine synthase] 5'-triphosphate protein]-N - cysteine-- -undecaprenyl cys /Glu-tRNA(Gln) isobutanoyl-CoA 7,8- acid synthase: lipoyl-L-lysine tRNA ligase: signal cyclic pyranopterin amidotransferase adenosylhomocysteinase: L-threonine dihydroneopterin menD phosphate BUE88_RS09305 peptidase predicted monophosphate an L-cysteinyl- BUE88_RS04500 degradation II 1-stearoyl- a peptide with 3-oxo-2-(cis- (5E)-3-oxo- a (9Z)-3-oxo- a (5Z)-3- (R)-4-hydroxy- an S-sulfanyl-[cysteine subunit GatC: O-acetyl-L- a 2,3,4-saturated a 2,3,4-saturated 2- (+)-7-epi-jasmonoyl-CoA acetyl-CoA an unsulfurated a 3-oxoicosanoyl- a phosphate ABC efflux 3'-phosphate 2-succinyl-5- [tRNA Cys ] II: lspA 4-aminobutanoate methanethiol a stearoyl-[acp] sn-glycerol an N-terminal 2'-pentenyl)- cys dodec-5- an acetoacetyl-[acp] octadec-9- oxododec- 4-methyl-2- synthase menaquinol-10 biosynthesis BUE88_RS16595 adenosylhomocysteinase: pyruvate acetyl-CoA XTP monoester desulfurase]-[disordered- enolpyruvoyl-6- a thiocarboxylated Cys homoserine fatty acyl-[acp] lysophosphatidate [sulfur carrier] [acp] thiol transporter thiol MoaC: moaC a tRNA O-acetyl-L- 1-acyl-sn-glycerol- acetyl-CoA C- 1-acyl-sn-glycerol-3-phosphate Xaa-L-prolineXaa-Pro cyclopentane- cysteine enoyl-CoA 3-oxoacyl-ACP 3-oxoacyl-ACP enoyl-[acp]3-oxoacyl-ACP 5-enoyl-[acp]3-oxoacyl-ACP alkaline oxoglutarate form scaffold chorismate flavin biosynthesis I (bacteria and plants) [+ 2 isozymes] an (S-diacyl- BUE88_RS08940 thr acetyl-CoA C- acetyl-CoA C- 4-carboxy-4- of a thiol hydroxy-3-cyclohexene- [small subunit of cyclic all-trans- a lipoprotein acyltransferase: 1-butanoyl-CoA non-canonical purine 2-carboxy-1,4- methylacrylyl-CoA L-threonine 3- homoserine 3-phosphate 3-phosphate aminopeptidase: desulfurase: acyltransferase: reductase FabG: reductase FabG: reductase: reductase: phosphatase: hydroxy-2- protein] complex 1-carboxylate molybdopterin pyranopterin an L-asparaginyl- sn-glyceryl) signal peptide acyltransferase: NTP pyrophosphatase, group decaprenyl L-homocysteine sulfhydrolase: acyltransferase: BUE88_RS08345 acyltransferase: BUE88_RS16395 BUE88_RS03730 BUE88_RS02435 BUE88_RS02435 BUE88_RS14775 BUE88_RS14775 BUE88_RS15185 cysteine 7,8- 4-amino-4- naphthoquinol Asn -L-cysteinyl- dehydrogenase: BUE88_RS08345 oxoadipate synthase] phosphate diphosphate [tRNA ] BUE88_RS08345 RdgB/HAM1 family: rdgB desulfurase: dihydroneopterin deoxychorismate 1,4-dihydroxy- BUE88_RS02795 BUE88_RS07265 BUE88_RS04005 acetyl-CoA C- BUE88_RS04005 leucyl cysteine 3-oxoacyl-ACP 3-oxoacyl-ACP 3-oxoacyl-ACP 3-oxoacyl-ACP Peptide RS13020 Peptide GTP [apolipoprotein] L-2-amino-3- acetyl-CoA C- alkaline aldolase/ 2-naphthoate aminoacyl-tRNA L-glutamate acyltransferase: acetyl-CoA C- NTP BUE88_RS05875 synthase: tRNA processing O-acetylhomoserine [+a 22,3,4-saturated isozymes] [+ 21-stearoyl-2-
Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase

    METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase

    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
  • Phosphatidylinositol-3-Kinase in Tomato (Solanum Lycopersicum. L) Fruit and Its Role in Ethylene Signal Transduction and Senescence

    Phosphatidylinositol-3-Kinase in Tomato (Solanum Lycopersicum. L) Fruit and Its Role in Ethylene Signal Transduction and Senescence

    Phosphatidylinositol-3-Kinase in Tomato (Solanum lycopersicum. L) Fruit and Its Role in Ethylene Signal Transduction and Senescence by Mohd Sabri Pak Dek A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Doctor of Philosophy in Plant Agriculture Guelph, Ontario, Canada © Mohd Sabri Pak Dek,June, 2015 ABSTRACT PHOSPHATIDYLINOSITOL-3-KINASE IN TOMATO (SOLANUM LYCOPERSICUM. L) FRUIT AND ITS ROLE IN ETHYLENE SIGNAL TRANSDUCTION AND SENESCENCE Mohd Sabri Pak Dek Co-Advisors: University of Guelph, 2015 Professor G. Paliyath Professor J. Subramanian The ripening process is initiated by ethylene through a signal transduction cascade leads to the expression of ripening-related genes and catabolism of membrane, cell wall, and storage components. One of the minor components in membrane phospholipids is phosphatidylinositol (PI). Phosphatidylinositol-3-kinase (PIK) is an enzyme that phosphorylates PI at the 3-OH position of inositol head group to produce phosphatidylinositol 3-phosphate (PI3P). Phosphorylation of PI may be an early event in the ethylene signal transduction pathway that generates negatively charged domains on the plasma membrane. PI3P domains may potentially serve as a docking site for phospholipase D (PLD) after ethylene stimulation. It is hypothesized that ethylene stimulation may activate PI3K resulting in enhanced level of phosphorylated phosphatidylinositol. However, the properties and function of PI3K is not well understood in plants. In the present study, the effect of PI3K inhibition during tomato fruit ripening was evaluated. This study demonstrated that PI3K activity is required for normal ripening process of the fruit. Inhibition of PI3K activity using wortmannin significantly reduced tomato ripening process.
  • Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of

    Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of

    Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress.
  • Structure-Function Analysis of the Catalytic Domain of the Histidine Kinase Chea

    Structure-Function Analysis of the Catalytic Domain of the Histidine Kinase Chea

    Loyola University Chicago Loyola eCommons Dissertations Theses and Dissertations 1997 Structure-Function Analysis of the Catalytic Domain of the Histidine Kinase Chea Dolph David Ellefson Loyola University Chicago Follow this and additional works at: https://ecommons.luc.edu/luc_diss Part of the Microbiology Commons Recommended Citation Ellefson, Dolph David, "Structure-Function Analysis of the Catalytic Domain of the Histidine Kinase Chea" (1997). Dissertations. 3425. https://ecommons.luc.edu/luc_diss/3425 This Dissertation is brought to you for free and open access by the Theses and Dissertations at Loyola eCommons. It has been accepted for inclusion in Dissertations by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. Copyright © 1997 Dolph David Ellefson LOYOLA UNIVERSITY MEDICAL CENTER LIBRARY LOYOLA UNIVERSITY OF CHICAGO STRUCTURE-FUNCTION ANALYSIS OF THE CATALYTIC DOMAIN OF THE HISTIDINE KINASE CHEA A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL IN CANDIDACY FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MICROBIOLOGY AND IMMUNOLOGY BY DOLPH DAVID ELLEFSON CHICAGO, ILLINOIS MAY, 1997 Copyright by Dolph David Ellefson, 1997 All Rights Reserved ii ACKNOWLEDGEMENTS I would like to thank my director, Dr. Alan J. Wolfe, for his support, advice, and encouragment during the many years in his laboratory. In his laboratory, I was given a rare opportunity to explore a new arena of science and interact with a field of gifted researchers who I would not known otherwise. I would also like to thank the members of my committee, Ors.
  • A Thesis Entitled Phor, Phop and Mshc

    A Thesis Entitled Phor, Phop and Mshc

    A Thesis entitled PhoR, PhoP and MshC: Three essential proteins of Mycobacterium tuberculosis by Erica Loney Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Chemistry __________________________________ Dr. Donald R. Ronning, Committee Chair __________________________________ Dr. John J. Bellizzi, Committee Member __________________________________ Dr. Ronald Viola, Committee Member __________________________________ Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo May 2014 Copyright 2014, Erica Loney This document is copyrighted material. Under copyright law, no parts of this document may be produced without the expressed permission of the author. An Abstract of PhoR, PhoP and MshC: Three essential proteins of Mycobacterium tuberculosis by Erica Loney Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Chemistry The University of Toledo May 2014 The tuberculosis (TB) pandemic is responsible for 1.6 million deaths annually, most of which occur in developing nations. TB is treatable, though patient non- compliance, co-infection with HIV, and the long, 6-9 month treatment regimen have resulted in the emergence of drug-resistant TB. For these reasons, the development of novel anti-tuberculin drugs is essential. Three proteins – PhoR, PhoP, and MshC – of Mycobacterium tuberculosis (M.tb), the causative agent of TB, are the focus of this thesis. The PhoPR two-component system is a phosphorelay system responsible for the virulence of M.tb. The histidine kinase PhoR responds to a yet-unknown environmental stimulus and autophosphorylates a conserved histidine. The phosphate is transferred to an aspartate of the response regulator PhoP, which then forms a head-to-head homodimer and initiates the transcription of 114 virulence genes.
  • Guanylate Kinase (Ec 2.7.4.8)

    Guanylate Kinase (Ec 2.7.4.8)

    Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) PRINCIPLE: Guanylate Kinase GMP + ATP > GDP + ADP Pyruvate Kinase ADP + PEP > ATP + Pyruvate Pyruvate Kinase GDP + PEP > GTP + Pyruvate Lactic Dehydrogenase 2 Pyruvate + 2 ß-NADH > 2 Lactate + 2 ß-NAD Abbreviations used: GMP = Guanosine 5'-Monophosphate ATP = Adenosine 5'-Triphosphate GDP = Guanosine 5'-Diphosphate ADP = Adenosine 5'-Diphosphate PEP = Phospho(enol)phosphate ß-NADH = ß-Nicotinamide Adenine Dinucleotide, Reduced Form ß-NAD = ß-Nicotinamide Adenine Dinucleotide, Oxidized Form CONDITIONS: T = 30°C, pH = 7.5, A340nm, Light path = 1 cm METHOD: Continuous Spectrophotometric Rate Determination REAGENTS: A. 200 mM Tris HCl Buffer, pH 7.5 at 30°C (Prepare 50 ml in deionized water using Trizma Base, Sigma Prod. No. T-1503. Adjust to pH 7.5 at 30°C with 1 M HCl.) B. 1 M Potassium Chloride Solution (KCl) (Prepare 10 ml in deionized water using Potassium Chloride, Sigma Prod. No. P-4504.) C. 60 mM Magnesium Sulfate Solution (MgSO4) (Prepare 20 ml in deionized water using Magnesium Sulfate, Heptahydrate, Sigma Prod. No. M-1880.) D. 40 mM Phospho(enol)pyruvate Solution (PEP) (Prepare 50 ml in deionized water using Phospho(enol)Pyruvate, Trisodium Salt, Hydrate, Sigma Prod. No. P-7002. PREPARE FRESH.) Revised: 03/10/94 Page 1 of 4 Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) REAGENTS: (continued) E. 100 mM Ethylenediaminetetraacetic Acid Solution (EDTA) (Prepare 10 ml in deionized water using Ethylenediaminetetraacetic Acid, Tetrasodium Salt, Hydrate, Sigma Stock No. ED4SS.) F. 3.8 mM ß-Nicotinamide Adenine Dinucleotide, Reduced Form (ß-NADH) (Prepare 2 ml in deionized water using ß-Nicotinamide Adenine Dinucleotide, Reduced Form, Dipotassium Salt, Sigma Prod.
  • WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T

    WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/21 (2006.01) C12N 15/74 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/52 (2006.01) C12P 5/02 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12N 15/63 (2006.01) HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/NZ20 13/000095 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 4 June 2013 (04.06.2013) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 61/654,412 1 June 2012 (01 .06.2012) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (71) Applicant: LANZATECH NEW ZEALAND LIMITED MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, [NZ/NZ]; 24 Balfour Road, Parnell, Auckland, 1052 (NZ).
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al

    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • Expression, Purification and Characterisation of Full-Length

    Expression, Purification and Characterisation of Full-Length

    B doi:10.1016/S0022-2836(02)00424-2 available online at http://www.idealibrary.com on w J. Mol. Biol. (2002) 320, 201–213 Expression, Purification and Characterisation of Full-length Histidine Protein Kinase RegB from Rhodobacter sphaeroides Christopher A. Potter1, Alison Ward1, Cedric Laguri2 Michael P. Williamson2, Peter J.F. Henderson1 and Mary K. Phillips-Jones1* 1Division of Microbiology The global redox switch between aerobic and anaerobic growth in School of Biochemistry and Rhodobacter sphaeroides is controlled by the RegA/RegB two-component Molecular Biology, University system, in which RegB is the integral membrane histidine protein kinase, of Leeds, Leeds LS2 9JT, UK and RegA is the cytosolic response regulator. Despite the global regulatory importance of this system and its many homologues, there have been no 2Department of Molecular reported examples to date of heterologous expression of full-length RegB Biology and Biotechnology or any histidine protein kinases. Here, we report the amplified expression University of Sheffield of full-length functional His-tagged RegB in Escherichia coli, its purifi- Sheffield S10 2TN, UK cation, and characterisation of its properties. Both the membrane-bound and purified solubilised RegB protein demonstrate autophosphorylation activity, and the purified protein autophosphorylates at the same rate under both aerobic and anaerobic conditions confirming that an additional regulator is required to control/inhibit autophosphorylation. The intact protein has similar activity to previously characterised soluble forms, but is dephosphorylated more rapidly than the soluble form (half- life ca 30 minutes) demonstrating that the transmembrane segment present in the full-length RegB may be an important regulator of RegB activity.
  • A Global Analysis of Enzyme Compartmentalization to Glycosomes

    A Global Analysis of Enzyme Compartmentalization to Glycosomes

    pathogens Article A Global Analysis of Enzyme Compartmentalization to Glycosomes Hina Durrani 1, Marshall Hampton 2 , Jon N. Rumbley 3 and Sara L. Zimmer 1,* 1 Department of Biomedical Sciences, University of Minnesota Medical School, Duluth Campus, Duluth, MN 55812, USA; [email protected] 2 Mathematics & Statistics Department, University of Minnesota Duluth, Duluth, MN 55812, USA; [email protected] 3 College of Pharmacy, University of Minnesota, Duluth Campus, Duluth, MN 55812, USA; [email protected] * Correspondence: [email protected] Received: 25 March 2020; Accepted: 9 April 2020; Published: 12 April 2020 Abstract: In kinetoplastids, the first seven steps of glycolysis are compartmentalized into a glycosome along with parts of other metabolic pathways. This organelle shares a common ancestor with the better-understood eukaryotic peroxisome. Much of our understanding of the emergence, evolution, and maintenance of glycosomes is limited to explorations of the dixenous parasites, including the enzymatic contents of the organelle. Our objective was to determine the extent that we could leverage existing studies in model kinetoplastids to determine the composition of glycosomes in species lacking evidence of experimental localization. These include diverse monoxenous species and dixenous species with very different hosts. For many of these, genome or transcriptome sequences are available. Our approach initiated with a meta-analysis of existing studies to generate a subset of enzymes with highest evidence of glycosome localization. From this dataset we extracted the best possible glycosome signal peptide identification scheme for in silico identification of glycosomal proteins from any kinetoplastid species. Validation suggested that a high glycosome localization score from our algorithm would be indicative of a glycosomal protein.
  • Supplementary Information

    Supplementary Information

    Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle.