IN VITRO AND IN VIVO STUDIES OF ANTIOXIDANT AND ANTI-BREAST
CANCER ACTIVITIES OF POMIFERIN
A Thesis
Presented to
The Faculty of Graduate Studies
of
The University of Guelph
By
RAYMOND X. YANG
In partial fulfilment of requirements
for the degree of
Doctor of Philosophy
December, 2008
© Raymond Yang, 2008 Library and Bibliotheque et 1*1 Archives Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition
395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada
Your file Votre reference ISBN: 978-0-494-50154-2 Our file Notre reference ISBN: 978-0-494-50154-2
NOTICE: AVIS: The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation. reproduced without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne Privacy Act some supporting sur la protection de la vie privee, forms may have been removed quelques formulaires secondaires from this thesis. ont ete enleves de cette these.
While these forms may be included Bien que ces formulaires in the document page count, aient inclus dans la pagination, their removal does not represent il n'y aura aucun contenu manquant. any loss of content from the thesis. Canada ABSTRACT
IN VITRO AND IN VIVO STUDIES OF ANTIOXIDANT AND ANTI-BREAST
CANCER ACTIVITIES OF POMIFERIN
Raymond X. Yang Advisor: University of Guelph, 2008 Dr. Kelly Meckling Co-advisor: Dr. Rong Cao
Reactive oxygen species (ROS) are ubiquitous in the human body and play a pivotal role in many chronic diseases, including cancer. The human body has developed a strong antioxidant defense system. Unfortunately, this system cannot be adequately maintained with ageing. The supply of exogenous antioxidants to help the body fight these diseases is a logical approach. Polyphenols, particularly flavonoids, have been found to be strong antioxidants. In this study, the prenylated isoflavone, pomiferin, from
Osage orange, was examined. I found that pomiferin had a much stronger antioxidant activity than soy isoflavones, genistein and daidzein, in three different antioxidant assays including P-CLAMS, FRAP and PCL. By using both estrogen receptor positive (MCF-7) and negative (MDA-MB-435) cancer cell lines, pomiferin showed much lower IC50 values than soy isoflavones in both cell lines (5.2 ± 0.90 vs 5.4 ± 0.72 uM) after 24 hr treatment. The selectivity of pomiferin between cancer cells and MCF-10A
(spontaneously immortalized human breast epithelial cell line) was high. Microarray techniques were used to find the gene expression changes when all three cells were treated with 5.0 uM pomiferin. At p <0.05, 515, 691 and 59 genes were significantly regulated for MCF-7, MDA-MB-435 and MCF-10A, respectively; and at p < 0.01 cut off, 94, 105 and 1 genes, respectively. Many of these genes are associated with antioxidant enzymes, cell cycle regulation and apoptosis. To confirm the results from microarray, RT-qPCR was used to verify some of the gene expression changes. The expression of 20 out of 21 genes was confirmed.
In addition, the xenograft models of MCF-7 and MDA-MB-435 cells were established to find the in vivo anticancer activity of pomiferin. The tumour size was significantly reduced in MCF-7 with 0.2% and MDA-MB-435 with 0.5% of pomiferin in their diet (p < 0.05). Bioavailability of pomiferin was measured and the correlation with tumour sizes was evaluated. Plasma pomiferin level can partially explain the tumour size, but many other factors likely play a role. Further studies are needed to determine the specific mechanism(s) by which pomiferin alters specific gene expression and the differential effects in tumour versus normal cells. ACKNOWLEDGEMENTS
I would like to extend my sincere thanks and appreciation to my supervisors, Drs Rong Cao and Kelly Meckling. Throughout my work and study, you have continuously served as a catalyst for novel scientific thought and supported my scientific pursuits. It is because of your guidance that I decided to pursue a PhD degree, and it is because of your guidance that I have succeeded. I am indebted to you more than words could possibly express.
I would also like to thank my advisor, Dr Brenda Coomber, who has given me invaluable and critical advice through my study. You are always kind, accessible and highly professional. You have impressed me a lot.
I acknowledge the assistance and wonderful friendship from my colleagues and students in both Drs Cao's and Meckling's laboratories. Special thanks to Drs Xinhua Yin, Hai Yu, Joy Liu, Suqin Shao and Cynthia Richard, Ms Honghui Zhu and the last, but not the least, Jane He.
I also greatly acknowledge the friendly and thorough assistance from Jing Zhang at the University Microarray Facility, who spent hours and hours work to help and train me for microarray techniques and data processing.
I also thank Dr Jiping Li and Honghong Li from the Laboratory Service Division to help set up RT-qPCR experiment, Dr. Jun Gu from University NMR Facility in helping run all the samples, and Jackie Rombeek from the Central Animal Facility of University of Guelph to take good care of my mice.
This work would not have been possible without the constant encouragement and support from my wife, Amy, my children, Ray and Ethan, and my extended family. I appreciate their patience and tolerance during the course of my study. TABLE OF CONTENTS
ABSTRACTS
TABLE OF CONTENTS i
LIST OF TABLES iv
LIST OF FIGURES v
ABBREVIATIONS vi
CHAPTERI LITERATURE REVIEW 1.1 Introduction 1 1.2 Sources of ROS 2 1.2.1 Mitochondria 2 1.2.2 NADPH oxidases 4 1.2.3 Xanthine oxidase 5 1.2.4 Cytochrome P-450 5 1.2.5 Microsomes and peroxisomes 6 1.2.6 Transition Metals 6 1.3 ROS and biological macromolecules 8 1.3.1 ROS and lipid peroxidation 8 1.3.2 ROS and protein oxidation 9 1.3.3 ROS and DNA modifications 9 1.4 ROS and processes of carcinogenesis 10 1.5 Antioxidants 12 1.5.1 Enzymatic Antioxidants 13 1.5.1.1 SOD 14 1.5.1.2 GPx 14 1.5.1.3 CAT 16 1.5.2 Non-enzymatic antioxidants 16 1.5.2.1 GSH 17 1.5.2.2 TRX 18 1.5.2.3 NADPH &G6PH 18 1.5.3 Flavonoids 20 1.5.3.1 Inhibition of pro-oxidant enzymes 20 1.5.3.2 Metal Chelating effects 22 1.5.3.3 Enhancement and protection of antioxidant enzymes 23 1.5.3.4 Strong antioxidants 23 1.5.3.5 Direct binding 24 1.5.3.6 Phytoestrogens & anti-aromatase activity 24 1.5.3.7 Cell cycle regulation 25 1.5.3.8 Anti-Angiogenesis and Anti-Metastasis activity 26
1 1.5.3.9 Apoptosis 26 1.6 Epidemiological study of flavonoids and cancer 27 1.7 Hypothesis 28
CHAPTER II CHEMISTRY AND ANTIOXIDANT ACTIVITY OF PRENYLATED ISOFLAVONES FROM OSAGE ORANGE 2.1 Introduction 30 2.2 Materials and Methods 32 2.2.1 Chemicals and Solvents 33 2.2.2 Extraction and Purification of Isoflavones 35 2.2.3 Structure Identification with MS and NMR 36 2.2.4 Quantification of Osajin and Pomiferin 36 2.2.5 Antioxidant assays 37 2.2.5.1 Ferric Reducing/Antioxidant Power Assay 37 2.2.5.2 P-Carotene-Linoleic Acid Model System 38 2.2.5.3 Photochemiluminescent Assay 38 2.2.6 Statistics 39 2.3 Results 39 2.3.1 Structural confirmation 3 9 2.3.2 Yield and purity of pomiferin and osajin 44 2.3.3 Antioxidant activity 44 2.4 Discussion 49
CHAPTER III ANTIPROLIFERATIVE EFFECTS OF POMIFERIN IN MCF-7 AND MDA-MB-435 BREAST CANCER CELL 3.1 Introduction 53 3.2 Materials and Methods 55 3.2.1 Cell cultures and Proliferation assays 5 5 3.2.1.1 Cell Culture 55 3.2.1.2 Proliferation assays 56
3.2.1.3 Sulforhodamine B (SRB) dye-binding assay 56 3.2.1.4 Calculations of IC50 values 57 3.2.2 RNA extraction 57 3.2.3 Microarray 59 3.2.3.1 Preparation of array slides 59 3.2.3.2 Scanning and Data Processing 60 3.2.4 RT-qPCR 61 3.3 Results 64 3.3.1 Antiproliferative Activity of Pomiferin 64 3.3.2 Quality and Quantity of RNA 66 3.3.3 Microarray Anaysis 69 3.3.4 RT-qPCR study 73 3.3.5 Selected pathways associated with MCF-7 genes 76 3.3.5.1 TGF-p Signaling Pathway 76 3.3.5.2 Cell cycle regulation 79
11 3.3.6 The functions of the genes in MCF-7 confirmed by RT-qPCR 83 3.3.6.1 MnSOD 83 3.3.6.2 GPX3 84 3.3.6.3 TXNRD1 85 3.3.6.4 FTL 86 3.3.6.5 HSPA1A 87 3.3.6.6 HMGB1 87 3.3.6.7 TOP2A 88 3.3.6.8 PSMA5 89
3.3.6.9 CANXand 5G4P57 90 3.3.6.10 C/Z5P 91 3.3.6.11 ffi^FJ 92 3.3.7 Biological functions and pathways associated with MDA-MB-435 genes 92 3.3.8 The functions of the MDA-MB-435 genes confirmed by RT-qPCR 93 3.3.8.1 DICER1 93 3.3.8.2 ABCE1 94 3.3.8.3 TFE3 94 3.3.8.4 MFN2 95 3.3.S.5S100P 96 3.3.9 Pomiferin and Melanoma 97 3.4 Discussion 97 CHAPTER IV ANTITUMOUR ACTIVITY OF POMIFERIN IN XENOGRAFT MODLES OF HUMAN BREAST CANCERS 4.1 Introduction 101 4.2 Materials and Methods 102 4.2.1 Chemicals and materials 102 4.2.2 Cell Culture 102 4.2.3 Xenografts 102 4.2.4 Tumour and body weight Monitoring 103 4.2.5 HPLC analysis of plasma samples 104 4.2.6 Statistics 104 4.3 Results 105 4.4 Discussion 113 CHAPTER IV GENERAL DISCUSSIONS 117 REFERENCES 124 APENDIX la The 80 up-regulated genes (P<0.01) in MCF-7 cells after treatment with pomiferin (5 uM) for 24 hr 154 APENDIX lb The 14 down-regulated genes (P<0.01) in MCF-7 cells after treatment with pomiferin (5 uM) for 24 hr 157 APENDIX Ha The 101 up-regulated genes (P<0.01) in MDA-MB-435 cells after treatment with pomiferin (5 uM) for 24 hr 158 APENDIX lib The four down-regulated genes (P<0.01) in MDA-MB-
lii 435 cells after treatment with pomiferin (5 uM) for 24 hr 162 APENDIX Ilia The Dissociation Curves of PCR Products from MCF-7 Cells 163 APENDIX nib The Dissociation Curves of PCR Products from MDA- MB-435 Cells 165 APENDIX IVa Gel electrophoresis of RT-qPCR products from MCF-7 171
APENDIX IVb Gel electrophoresis of RT-qPCR products from MDA- MB-435 172
APPENDIX V The biological functions and their pathway information of the regulated genes in MCF-7 cells (p<0.05) 173 APENDIX VI The biological functions and their pathway information of the regulated genes in MDA-MB-435 cells (p<0.05) 178
IV LIST OF TABLES
Table 2-1 Isoflavones in other Genera and families (Leguminosae is not included) 31
Table 2-2 1H and 13C NMR data of Pomiferin and Osajin 42 Table 2-3 Antioxidant activity of isoflavones calculated using different endpoints in the (3-CLAMS assay 48 Table 3 -1 a Primers of MCF-7 genes used for RT-qPCR 62 Table 3-lb Primers of MDA-MB-435 genes used for RT-qPCR 63 Table 3-2 The number of genes regulated by pomiferin in the three breast epithelial cell lines 70 Table 3-3 The significantly regulated antioxidant genes and other cancer related genes in MCF-7 cells after treatment with pomiferin (5 uM) for 24 hr (p<0.01) 71 Table 3-4 The significantly regulated metal chelating genes and other cancer related genes in MDA-MB-435 cells after treatment with pomiferin (5 uM) for 24 hr (p<0.01) 72 Table 3-5 The comparison of fold changes of selected genes between microarray and RT-qPCR techniques (MCF-7) 74 Table 3-6 The comparison of fold changes of selected genes between microarray and RT-qPCR techniques (MDA-MB-435) 75
v LIST OF FIGURES
Figure 1-1 Generation of reactive oxygen species and the defense mechanisms against damage by active oxygen 3 Figure 1-2 Reaction of guanine with hydroxyl radical 10 Figure 1-3 Proposed catalytic cycle of seleno glutathione peroxidises 15 Figure 1-4 Structures of reduced (GSH) and oxidised (GSSG) glutathione 17 Figure 1-5 The basic structures of flavonoids and the six major subclasses 21 Figure 2-1 Osage orange fruit 32 Figure 2-2 The structural comparisons of selected isoflavones 34 Figure 2-3 The mass spectroscopy of osajin and pomiferin obtained from the HPLC-ESI-MS experiment 40 Figure 2-4 The UV spectra of FA (dot line) and FB (solid line) 41 Figure 2-5 HPLC chromatograms (wavelength at 274 nm) of the ethyl acetate extract of the Osage orange fruit (top panel), pomiferin (middle panel) and osajin (bottom panel). See more details in HPLC method section 43 Figure 2-6 Antioxidant activities of isoflavones and L-ascorbic acid measured by the FRAP assay 46 Figure 2-7 Antioxidant activities of isoflavones and L-ascorbic acid measured by the (3-CLAMS assay 47 Figure 2-8 Antioxidant activities of isoflavones and L-ascorbic acid measured by the PCL assay 50 Figure 3-1 Total RNA purification process 58 Figure 3 -2 The percentage of cells viable of MCF-7, MD A-MB-43 5 and MCF-10A after treatment with pomiferin for 24 hr at the concentrations of 0.625, 1.25, 2.5, 5.0, 10.0 and 20.0 uM 65 Figure 3-3 Digital image under UV light of RNA purified from MDA-MB -435, MCF-7 and MCF-10A 67 Figure 3-4 Chromatograms of microcapillary electrophoresis from twelve RNA samples 68 Figure 3-5 Part of the TGF-P signalling pathway 77 Figure 3-6 The cycle cell regulation pathway 80 Figure 4-1 The average body weight (g, M ± SD) of MCF-7 xenografted mice is shown over six weeks of treatment 106 Figure 4-2 The average tumour size (mm3, M ±SD) are shown at each week in MCF-7 xenografted mice over the six week treatment period 107 Figure 4-3 Correlation between the plasma pomiferin concentration (nM) and tumour volume (mm3) in MCF-7 xenografted mice 108 Figure 4-4 The average body weight (g, M ± SD) of mice bearing MDA- MB-435 xenografts over the three week treatment period 110 Figure 4-5 The average tumour size (mm3, M ± SD) of MD A-MB-43 5 xenografts over three weeks 111 Figure 4-6 Correlation of plasma pomiferin concentration (nM) and tumour volume (mm3) in MD A-MB-43 5 xenografts 112
VI ABBREVIATIONS
8-OH-G 8-hydroxyl-2' -deoxyguanosine
AAE ascorbic acid equivalent
AIN93G American Institute of Nutrition 93 growth diet a-MEM a-modified Eagle's medium
AOA antioxidant activity
AP-1 activator protein-1
ASK-1 apoptosis signal regulating kinase-1 p-CLAM P-carotene linoleic acid model system
CAT catalase
CDK cyclin-dependent kinase cDNA complementary DNA
CHO Chinese hamster ovary
COSY H-H correlation spectroscopy
COX cyclooxygenase
Cu/ZnSOD copper/zinc superoxide dismutase
Cy3 Cyanine 3
Cy5 Cyanine 5
DAD photodiode array detector
DAVID Database for Annotation, Visualization and Integrated Discovery
DMEM Dulbecco's Modified Eagle's Medium
DNA deoxyribonucleic acid Drp-1 dihydropyrimidinase related protein-1
ECM extracelluar matrix
EDTA ethylenediaminetetraacetate
EGCG epigallocatechin gallate
EGF epithelial growth factor
DMSO dimethyl sulfoxide
ER estrogen receptor
ERE estrogen-responsive element
ESI electrospray ionization
FAD flavin adenine dinucleotide
FBS fetal bovine serum
FMN flavin mononucleotide
FRAP ferric reducing/antioxidant power
G6P glucose-6-phosphate
G6PD glucose-6-phosphate dehydrogenase
GPx glutathione peroxidase
GSH reduced glutathione
GSSG glutathione, oxidized form
GST glutathione- S-transferase
HER-2 also called HER2/neu or human epidermal growth factor receptor 2
HLH helix-loop-helix
HMPS hexose monophosphate shunt
HNE 4-hydroxy-2-nonenal HPLC high-pressure liquid chromatography
HSQC heteronuclear single quantum coherence
IL-8 interleukin-8
JNK The c-Jun N-terminal kinases
KDa Kilodalton
LC-MS liquid chromatography-mass spectroscopy
LDL low-density lipoprotein
MAPK mitogen activated protein kinase
MDA malondialdehyde
MHC major histocompatibility complex miRNA microRNA
MMP matrix metalloproteinase
MnSOD Manganese superoxide dismutase
NAC no amplification control
NADP+ nicotinamide-adenine dinucleotide phosphate, oxidized form
NADPH nicotinamide-adenine dinucleotide phosphate, reduced
NF-kB nuclear factor-kB
NKG2D natural-killer group 2, member D
NMR nuclear magnetic resonance
Noxl nicotinamide-adenine dinucleotide phosphate oxidase 1
NTC no template control
PAI-1 plasminogen activator inhibitor-1
PBS phosphate buffered saline PCL photochemiluminescent
PCR polymerase chain reaction
PKC protein kinase C
PPAR peroxisome proliferator-activated receptor
PR progesterone receptor
RAGE the receptor for advanced glycation end product
RIN RNA Integrity Number
RNA ribonucleic acid
ROS reactive oxygen species
RT-PCR reverse transcription polymerase chain reaction
RT-qPCR real time reverse transcription polymerase chain reaction
SAR structure-activity relationship
SD standard deviation
SDS sodium dodecyl sulphate
SOD "superoxide dismutase
SRB Sulforhodamine B
SSC sodium chloride and sodium citrate
TAP transporter associated with antigen processing
TBE Tris/Borate/EDTA
TEAC Trolox equivalent antioxidant capacity
TNF tumour necrosis factor
TNFR-1 tumour necrosis factor receptor 1
TPTZ 2,4,6-tripyridyl-5-triazine TRAIL tumour necrosis (TNF)-related apoptosis-inducing ligand
TRX thioredoxin
Txnip TRX-interacting protein
UV ultraviolet
VEGF vacular endothelial growth factor
XO xanthine oxidase
XI CHAPTER I
LITERATURE REVIEW
1.1 Introduction
Reactive oxygen species (ROS) are ubiquitous in the human body. They are generated by normal physiological processes including aerobic metabolism and inflammatory responses to eliminate invading pathogenic microorganisms, and are also derived from exogenous sources, e.g. environmental insults. ROS play a key role in the development of age-dependent diseases such as cancer, arteriosclerosis, arthritis, diabetes, neurodegenerative disorders and other conditions (Finkel and Holbrook, 2000).
ROS stimulate proliferation and enhance survival in a wide variety of cell types
(Burdon et al, 1990; Burdon, 1995; Burdon et al, 1996; Valko et al, 2006) when they are in low concentrations. When they are present at high and/or sustained levels, however,
ROS can act both in non-specific and destructive manners and in activation of specific signalling pathways. ROS can damage DNA, for example, inducing genetic alterations, which play a role in the initiation of carcinogenesis (Guyton and Kensler, 1993; Cerda and Weitzman, 1997). ROS can also specifically activate certain transcription factors such as NF-KB via tumour necrosis factor (TNF) and interleukin-1 (Baud and Karin,
2001; Hughes et al, 2005; Storz, 2005) and the AP-1 family through JNK and p38 MAP kinase cascades (Lo and Cruz, 1995; Lee et al, 1996; Chung et al, 2002; Storz, 2005).
The combination of genetic modifications and signalling alterations by ROS plays an important role in carcinogenesis, cell cycle regulation and apoptosis (Lin et al, 1998;
Shami et al, 1998; Simon et al, 2000; Storz, 2005).
1 A number of defence systems have evolved to combat the accumulation of ROS.
These include enzymatic scavengers of ROS (e.g., superoxide dismutases, catalase, and glutathione peroxidase) as well as various non-enzymatic molecules (e.g., glutathione and thioredoxin). Unfortunately, these defence mechanisms cannot keep pace with ROS accumulation during the life cycle, resulting in what is termed a state of oxidative stress.
Thus exogenous antioxidants are needed to counteract oxidative damage, in turn, lighting age-related chronic diseases such as cancer.
ROS is a collective term that includes not only the oxygen free radicals but also some non-radical derivatives of O2. Free radicals contain one or more unpaired electrons and these include superoxide (02*~), hydroxyl- (»OH), alkoxyl- (RO«), and peroxyl-
(ROO») radicals. Non-radical ROS include hydrogen peroxide (H2O2) and organic hydroperoxides (ROOH) (Storz, 2005). Although the latter are not free radicals, they can be converted easily into radicals (Halliwell and Gutteridge, 1989). Major ROS include hydroxyl radicals (#OH), superoxide anions (02°), ROO* and hydrogen peroxide (H2O2).
1.2 Sources of ROS
Molecular oxygen (O2) is the primary biological electron acceptor that serves vital roles in fundamental cellular functions. However, along with the beneficial properties of O2 comes the inadvertent formation of ROS.
1.2.1 Mitochondria
Superoxide, the most common radical in biological systems, is formed mostly within the mitochondria (Figure 1-1). The mitochondria are responsible for energy production and cellular respiration. To accomplish this task, electrons are passed between different molecules, with each pass producing useful chemical energy. Even under ideal conditions,
2 ENDOPLASMIC RETICULUM
H20
HL0
•Ca*1"
Figure 1-1 Generation of reactive oxygen species and the defense mechanisms against damage by active oxygen. Normally, superoxide generated in the mitochondria may be degraded by Mn-SOD or, if it reaches the cytosol, by Cu/Zn-SOD. In the endoplasmic reticulum, NADPH-cytochrome P450 reductase can leak electrons onto O2 generating
Qj~. FADH2 and cytochrome b5 can also contribute to this system. Within peroxisomes, there are enzymes localized that produce H2O2 directly. H2O2 is able to react with Fe2+ or
Cu+ to form hydroxyl radicals via Fenton reaction. All the abbreviations are explained in the text (Mates et al, 1999).
3 some electrons "leak" from the electron transport chain (Hanukoglu et al, 1993;
Salvador et al, 2001). These leaked electrons interact with oxygen to produce superoxide radicals, so that under physiological conditions, about 1-3% of the oxygen molecules in the mitochondria are converted into superoxide (Benzi et al, 1992; Kinnula et al, 1995;
Brookes et al, 2002).
Many other enzymatic and non-enzymatic processes are also involved in the generation of ROS in mammalian cells. Among the most important sources are the reactions catalyzed by the enzymes nicotinamide adenine dinucleotide phosphate
(NADPH) oxidase, xanthine oxidase (XO), Cytochrome P-450, microsomes and peroxisomes, and transition metals such as Fe2+ and Cu+ (Figure 1-1).
1.2.2 NADPH oxidases
The NADPH oxidases are a group of plasma membrane associated enzymes found in a variety of cells of mesodermal origin. The leukocyte NADPH oxidase is inactive under resting conditions. Several different stimuli, such as lipopolysaccharide or various proinflammatory mediators, activate the oxidase in leukocytes (Valko et al,
2006). As a result, leukocytes including activated macrophages undergo a series of reactions called the respiratory burst—events of increased uptake of oxygen that leads to the release of free radicals (Thannickal and Fanburg, 2000). The respiratory burst enables the cell to provide oxidizing agents for the destruction of the target cells. When NADPH oxidase is activated, it takes NADPH from the cytoplasm and passes electrons to O2 producing superoxide within the plasma membrane or on its outer surface (Van
Heerebeek et al, 2002; Vignais, 2002). Increased production of oxidants via NADPH oxidase (particularly NADPH oxidase 1) activity has been demonstrated in many cancer
4 cell lines, and transfection with NADPH oxidase 1 (Noxl) has been shown to transform certain non-malignant cells into cancer cells (Arnold et al, 2001; Dong et al, 2004;
Mitsushita et al, 2004; Lim et al, 2005). It has been estimated that chronic infection and associated inflammation contribute to about one in four of all cancer cases worldwide
(Gutteridge and Halliwell, 2000).
1.2.3 Xanthine oxidase
Xanthine oxidase (XO) is a highly versatile enzyme that is widely distributed among species (from bacteria to man) and within the various tissues of mammals
(Moriwaki et al, 1999). XO is an important source of ROS. It is a member of a group of enzymes known as molybdenum iron-sulphur flavin hydroxylases and catalyses the hydroxylation of purines (Borges et al, 2002; Harrison, 2002). In particular, XO catalyzes the conversion of hypoxanthine to xanthine and xanthine to uric acid. In both steps, molecular oxygen is reduced, forming the superoxide anion in the first step and hydrogen peroxide in the second (Carr et al, 2000; Valko et al, 2004).
1.2.4 Cytochrome P-450
The phase I cytochrome P-450 is the terminal component of the monoxygenase system found within the endoplasmatic reticulum of most mammalian cells (Butler and
Hoey, 1993). The main role of cytochrome P-450 is to detoxify foreign compounds into less toxic products. In order to perform this detoxification function, this enzyme uses oxygen to oxidize the foreign compounds. During these oxidation reactions electrons may be 'leaked' onto oxygen molecules, forming superoxide radicals (Butler and Hoey,
1993). In addition, FADH2 oxidase and cytochrome b5 also contribute to the generation of superoxide (Schenkman and Jansson, 2003; Valko et al, 2006).
5 1.2.5 Microsomes and peroxisomes
Microsomes and peroxisomes produce H2O2 under physiological conditions (Fahl et al, 1984). Although the liver is the primary organ where peroxisomal contribution to the overall H2O2 production is significant, other organs that contain peroxisomes also have these H202-generating systems. Peroxisomal oxidation of fatty acids has recently been recognized as a potentially important source of H2O2 production with prolonged starvation (Valko et al, 2004).
1.2.6 Transition Metals
The redox state of the cell is also largely linked to iron and copper redox couples and is maintained within strict physiological limits. Iron and copper ions are normally carefully sequestered in the body, into proteins such as ferritin, transferrin, metallothionein and ceruloplasmin (Swain and Gutteridge, 1995; Soobrattee et al, 2006).
However, under stress conditions, an excess of superoxide releases "free iron", for example, from iron-containing molecules (Valko et al, 2006). The released Fe(II) can participate in the Fenton reaction, generating the highly reactive hydroxyl radical
[Formula (1)] (Stohs and Bagchi, 1995; Pekarkova et al, 2001; Liochev and Fridovich,
2002; Leonard et al, 2004). Then Fe(III) is reduced by superoxide to Fe(II) and oxygen
[Formula (2)] (Leonard et al, 2004). The Haber-Weiss reaction is formed by combining a Fenton reaction and the reduction of Fe(III) by superoxide [Formula (3)] (Valko et al,
2006).
Fe(II) + H202 -»• Fe(III) + OH + OH (1)
Fe(III) + Or ~* Fe(II) + 02 (2)
02" + H202 -• 02 + OH + OH" (3)
6 The most detrimental product is the hydroxyl radical. Hydroxyl radicals react with almost every molecule found in living cells, including DNA, membrane lipids, and proteins (Bayir, 2005). Hydroxyl radicals induced by high concentrations of free iron and/or copper can participate in carcinogenesis. For example, injection of ferric nitrilotriacetate into rats or mice causes increased lipid peroxidation, oxidative DNA damage and, eventually, renal cancer (Toyokuni, 1996). Similarly, intramuscular injections of an iron-dextran complex, frequently used for the treatment of anaemia in humans, caused spindle cell sarcoma or pleomorphic sarcoma in rats at the site of injection (Bhasin et al, 2002). Although iron is considerably more abundant in biological systems, copper is an important metal ion present in chromatin and is closely associated with DNA bases, particularly guanine (Kagawa et al, 1991; Wolfe et al, 1994). Copper can participate in the Fenton reaction, generating site-specific hydroxyl radicals, causing
DNA breakage (Wolfe et al, 1994; Hadi et al, 2007).
Although toxic in high levels, low levels of ROS are essential in many biochemical processes. These include intracellular messaging during cell differentiation and cell cycle progression; growth arrest, apoptosis (Ghosh and Myers, 1998), and immune cell activation (Yin et al, 1995; Bae et al, 1997). Generally speaking, transient fluctuations in ROS serve important regulatory functions, but when present at high and/or sustained levels, whether from endogenous or exogenous sources such as redox chemicals, physical agents (e.g. ultraviolet, X-ray, g-ray, etc.), and viral/bacterial infection (Scandalios, 2005), ROS can cause severe damage to DNA, protein, and lipids
(Marnett, 2000; Stadtman and Levine, 2000).
7 1.3 ROS and biological macromolecules
ROS can react with nearly any cellular macromolecule due to their high reactivity and low chemical specificity. The reactivities of ROS are, however, quite varied.
Superoxide radical itself has limited reactivity; it does not react directly with polypeptides, sugars, or nucleic acids, and its ability to peroxidize lipids is controversial
(Valko et ah, 2006). As was stated above, hydrogen peroxide is not a free radical, but it can diffuse through membrane freely. Its product—hydrogen superoxide via the Fenton and the Haber-Weiss reactions [formulae (1) and (3)], is the main source of the cellular damage (Storz, 2005).
1.3.1 ROS and lipid peroxidation
The fluidity of the cell membrane is largely determined by the presence of polyunsaturated fatty acid side chains in membrane phospholipids. Polyunsaturated fatty acids are very susceptible to free radical attack. Once lipid radicals are produced, they combine with oxygen dissolved in the membranes and form peroxyl radical, which can attack membrane proteins and adjacent polyunsaturated fatty acids, propagating membrane lipid peroxidation (Bayir, 2005). The major products of the peroxidation process are malondialdehyde (MDA) and 4-hydroxy-2-nonenal (HNE) (Marnett, 1999).
MDA is mutagenic in mammalian cells and carcinogenic in rats (Marnett, 1999). HNE is weakly mutagenic but appears to have powerful effects on signal transduction pathways, which in turn have a major effect on the phenotypic characteristics of cells (Valko et al,
2006). MDA and HNE have also been shown to directly bind to, and damage, DNA
(Eder et al, 2006). Lipid peroxidation products can also cause DNA damage and directly
8 inhibit membrane transporters such as Na /K ATPases and the glutamate transporter
(Hurst et al, 1997; da Silva et al, 1998; Patterson and Leake, 1998).
1.3.2 ROS and protein oxidation
The reactions of proteins with hydroxyl radicals lead to abstraction of a hydrogen atom from the protein polypeptide backbone to form a carbon-centred radical, which under aerobic conditions reacts readily with O2 to form peroxyl radicals (Stadtman, 1992).
The side chains of all amino acid residues of proteins are even more susceptible to oxidation (Stadtman, 2004). The common inter- and intra-protein cross-linkages induced by ROS include the oxidation of sulphydryl groups of cysteine residues and tyrosine residues to form -S-S- and -tyr-tyr- cross-links, respectively (Valko et al, 2006). As a result, it leads to inhibition of enzyme activities, altered signal transduction and aberrant post-translational modifications. For example, ROS decrease mitochondrial aconitase activity (Yan et al, 1997) resulting in a decrease in life-span, decreased glutamine synthetase activity (Carney et al, 1991) causing loss in temporal and spatial memory during aging, and decreased fibrinogen activity inhibiting thrombin-catalyzed clot formation (Shacter et al, 1995). In addition, ROS can also activate a number of intracellular signalling pathways, most notably those that depend on the transcription factors NF-KB and AP-1 (Bayir, 2005).
1.3.3 ROS and DNA modifications
The hydroxyl radical is known to react with all components of the DNA molecule, damaging both purine and pyrimidine bases and also the deoxyribose backbone
(Dizdaroglu et al, 2002). ROS-induced DNA damage involves single- or double- stranded DNA breaks, purine, pyrimidine, or deoxyribose modifications, and DNA cross-
9 links (Valko et al, 2006). DNA damage can result in arrest or activation of transcription, alterations in signal transduction pathways, replication errors and genomic instability, all of which are associated with carcinogenesis (Marnett, 2000; Cooke et al, 2003). One of the dominant modifications of DNA appears to be the 8-hydroxylation of guanine (Figure
1-2) (Grollman and Moriya, 1993; Dizdaroglu, 1994). It is estimated that the 8-hydroxyl-
2'-deoxyguanosine (8-OH-G) modification occurs in approximately one in 10 guanidine residues in a normal human cell (Grollman and Moriya, 1993). Many lines of evidence indicate a direct correlation between 8-OH-G generation and carcinogenesis in vivo (Feig e/a/., 1994).
-OH
guanine (Q) es-OH-aciduet radical 8-hydrexypuanlne of guanine (frOH-G)
Figure 1-2. Reaction of guanine with hydroxyl radical.
In addition to the nuclear DNA damage, the mitochondrial DNA is even more susceptible to oxidation for three major reasons (Inoue et al, 2003). First, it exists in a high ROS environment; second, mitochondrial DNA repair capacity is limited, since they lack the feature of nucleotide excision repair; and third, mitochondrial DNA is not protected by histones.
1.4 ROS and processes of carcinogenesis
Despite the complex and variable nature of cancer, this disease generally follows a common mode of development. The three broadly defined stages of cancer
10 development are initiation, promotion and progression. The stages are characterized as follows: Irreversible alterations are induced in the genome of the cell during initiation; promotion involves the inheritance of a mutation and induction of preneoplastic lesion formation; additional heritable changes to this preneoplastic lesion progresses and results in malignant neoplastic growth (Barrett, 1993).
ROS can stimulate carcinogenesis by acting at all three stages (Salim, 1993;
Dreher and Junod, 1996; Nakamura et al, 1997; Ahmed et al, 1999; Hussain et al,
2003). ROS induce genetic alterations, such as mutations and chromosomal rearrangements, which play a role in the initiation of carcinogenesis (Cerda and
Weitzman, 1997; Valko et al, 2004). A direct correlation between 8-OH-G generation and carcinogenesis in vivo has been found in many cancers (Review in Trueba et al,
2004). Several studies on benign tumours revealed an interesting correlation between the size of tumour and the amount of 8-OH-G adduct formation; and the level of 8-OH-G may also be used to determine the transformation from a benign to a malignant tumour
(Loft and Poulsen, 1996; Okada et al, 2006).
The process of initiation further proceeds through oxidative stress-induced Ca2+ changes leading to an increase in intracellular free calcium as a result of its release from intracellular Ca2+ stores, and through the influx of extracellular Ca2+ (Dreher and Junod,
'St
1996; Orr and Wang, 2001). The activation of Ca -dependent protein kinases (PKC) and other protein kinases leads to phosphorylation and the activation of other kinases, which regulate the activity of transcription factors (Chung et al, 2002; Storz, 2005). Oxidative stress induced by ROS has been linked to tumour promotion in mouse skin and other tissues (Cerutti, 1985; Konturek et al, 2003; Nishigori et al, 2004). Many tumour
11 promoters generate ROS, and the involvement of ROS - particularly hydrogen peroxide
- in tumour promotion is supported by both in vivo and in vitro studies (Upham et al,
1997; Trosko and Chang, 2000).
Progression is distinguished by accelerated cell growth, escape from immune surveillance, tissue invasion and metastasis (Toyokuni, 1996). The increased levels of modified DNA bases by ROS may contribute to the genetic instability and metastatic potential of tumour cells in fully developed cancer (Schmielau and Finn, 2001). Also,
ROS are key regulators of matrix metalloproteinase (MMP) production, which are important in disease pathology (Nelson and Melendez, 2004; Nelson et al, 2006). The sustained production of hydrogen peroxide increases invasion and migration in HT1080 human fibrosarcoma cells (Yoon et al, 2002). ROS can increase the production of the angiogenetic factors IL-8 (Interleukin-8) and VEGF (Vascular Endothelial Growth Factor)
(Ushio-Fukai and Alexander, 2004). Additionally, ROS promote the secretion of the matrix metalloprotease by tumour cells, which promotes vessel growth within the tumour microenvironment (Cook-Mills, 2006).
1.5 Antioxidants
Nevertheless, nature has provided cells with very strong endogenous biological antioxidant defence mechanisms. These include a variety of enzymatic and non- enzymatic molecules with enormous capabilities to mitigate the deleterious and potentially harmful effects of ROS and other free radicals. However, these endogenous defence systems may not successfully combat the oxidative stress; exogenous antioxidants can work as antioxidants independently and/or enhance the endogenous mechanisms.
12 Traditionally, an antioxidant is defined as any substance that when present at low concentrations compared with those of an oxidizable substrate, significantly delays or prevents oxidation of that substrate (Halliwell and Gutteridge, 1989; Halliwell and
Gutteridge, 1999; Frankel and Meyer, 2000). Although the definition has been used for many years, it does not take into account chaperones, repair systems or inhibitors of ROS generation. Thus, a new version of the definition has evolved. An antioxidant is now defined as any substance that delays, prevents or removes oxidative damage to a target molecule (Halliwell and Gutteridge, 2007). Antioxidants can be categorized into two groups: endogenous and exogenous. Endogenous antioxidants include antioxidant enzymes (superoxide dismutase [SOD], glutathione peroxidase [GPx] and catalase
[CAT]), and non-enzymic components (mainly thiols). Exogenous antioxidants include flavonoids, carotenoids, vitamins C & E, and many others. However, the boundary between these two groups is not absolutely clear, since thiols can be generated in our body and supplied by food, and exogenous antioxidants can protect and enhance the activities of antioxidant enzymes (Govindarajan et ah, 2007; Sudheer et ah, 2007).
1.5.1 Enzymatic Antioxidants
Since mitochondria are the major site of free radical generation, they are highly enriched with antioxidants including SOD and GPx, which are present on both sides of the membrane to minimize oxidative stress in the organelle (Cadenas and Davies, 2000).
The third antioxidant enzyme, CAT, is mainly present in the peroxisome to combat H2O2 production.
13 1.5.1.1 SOD
SOD exists in several isoforms, differing in the nature of the active metal centre and amino acid composition, as well as the number of subunits and cofactors. There are three human forms of SOD: cytosolic Cu/Zn-SOD, mitochondrial Mn-SOD, and extracellular SOD (Landis and Tower, 2005). Superoxide may be degraded in the mitochondria by Mn-SOD or, if it reaches the cytosol, by Cu/Zn-SOD.
Removal of excess O2" by SOD is the first step and an important defence mechanism in aerobic organisms. SOD convert O2" into H2O2 [Formula (4)] leading to the first step of detoxification of free radicals. The second step is the transformation of
H2O2 to H2O via hydroperoxidases such as GPx or CAT. Although H2O2 is a poorly reactive oxidizing agent, H2O2 crosses cell membranes easily and may act as a metabolic signal under certain circumstances, possibly by oxidizing specific protein thiol groups
(Valkoefa/,,2006).
+ SQB 202 + 2H —*fl202 + 02 (4)
1.5.1.2 GPx
GPx is only able to act in the presence of sufficient reduced glutathione (GSH)
(Figure 1-3). Thus, GSH metabolism is one of the most essential antioxidative defence mechanisms [Formula (5)] (Desideri and Falconi, 2003; Klaunig and Kamendulis, 2004).
Two forms of GPx exist, selenium (Se)-dependent GPx and Se-independent GPx
(glutathione-S-transferase, GST) (Mates et al, 1999). Although their expression is ubiquitous, the levels of each isoform vary depending on the tissue type. These two enzymes differ in the number of subunits, the bonding nature of the selenium at the active
14 site and their catalytic mechanisms. There are four different Se-dependent glutathione peroxidases in human beings (Mates et al, 1999). All GPx enzymes are known to add two electrons to reduce peroxides by forming selenoles (Se-OH). The main function of
GPx is to reduce toxic lipid peroxides to corresponding less toxic hydroxyl fatty acids utilizing GSH as a cofactor [Formula (6)] (Rahman et al., 1999).
ROOH ROH
GSSG GSH
mo Figure 1-3. Proposed catalytic cycle of seleno glutathione peroxidases (Flohe 1989).
GPx-Se or GPx, which reduces lipid peroxide (ROOH) to ROH, becomes oxidized form
(GPx-SeOH). Two GSHs are needed to regenerate the activity of GPx-Se. Thus, GSH metabolism is critical for GPx function.
GPx 2GSH + H202 -^> GSSG + H20 (5)
GPx 2GSH + ROOH »GSSG + ROH + H20 (6)
Se-independent GPx, GST, on the other hand, is one of the major detoxification pathways for the conjugation of xenobiotics with GSH resulting in the formation of soluble complexes that are generally more hydrophilic and less cytotoxic (Mannervik and
Danielson, 1988).
15 1.5.1.3 CAT
CAT is the second enzyme that reacts very efficiently with H2O2 to form water and molecular oxygen [Formula (7)]. CAT is present largely in the peroxisome fraction whereas GPx is found not only in the cytoplasm, but also in the matrix of mitochondria.
GPx detoxifies H2O2 by interacting with GSH producing water and GSSG which is recycled to GSH by glutathione reductase (Figure 1-3). CAT is unique among H2O2 degrading enzymes in that it degrades H2O2 without consuming cellular reducing equivalents. Hence, CAT provides the cell with a very energy efficient mechanism to remove hydrogen peroxide (Scandalios, 2005).
CAT 2H202 •2H2O+O2 (7)
Many cancers and transformed cell lines have been found to express lower CAT activity than their normal tissues of origin (Bostwick et al, 2000; Kwei et al, 2004; Tas et al, 2005; Finch et al, 2006). Boosting CAT activity in low-CAT cancer cell lines by transfecting in the CAT gene, or adding catalase to cell cultures, has been shown to suppress proliferation and decrease survival potential of these cells (Policastro et al.,
2004; Finches al, 2006).
1.5.2 Non-enzymatic antioxidants
SOD, GPx, and CAT exist within cells to remove superoxide and peroxides before they react with metals to form more reactive species. In addition, non-enzymatic antioxidants help terminate the reactive species that escaped enzymatic degradation.
These antioxidants include thiol antioxidants (mainly glutathione and thioredoxin),
NADPH, flavonoids, and other compounds (McCall and Frei, 1999).
16 1.5.2.1 GSH
Glutathione (GSH) is a cysteine-containing peptide that exists in either a reduced
(GSH) or oxidized (GSSG) form (Figure 1-4). Glutathione reductase is responsible for
• WV H O o 0/SHf glutamate cysteine glycine •o^\/s^f/Y ^O'
NH3+ H 0 GSH GSSG
Figure 1-4 Structures of reduced (GSH) and oxidised (GSSG) glutathione.
regeneration of GSSG to GSH, using NADPH as its cofactor (Powis et al, 1995). GSH is the most prevalent non-protein intracellular thiol, which presents in high concentrations
(0.5 to 10 mM) in almost all living cells (Meister, 1988). The reduced glutathione/oxidized glutathione (GSH/GSSG) complex is the major buffer in the cell
(Meister, 1988). Under normal physiological conditions, the intracellular environment is highly reduced due to a high GSH/GSSG ratio of 30:1 to 100:1 (Rahman et al, 1999).
The main protective roles of GSH in oxidative stress are: (i) GSH is a cofactor in several detoxifying enzymes such as GPx and GST; (ii) GSH participates in amino acid transport through the plasma membrane; (iii) GSH scavenges hydroxyl radical and singlet oxygen directly; and (iv) GSH is able to regenerate the most important antioxidants, vitamins C and E, back to their active forms (Masella et al, 2005).
17 1.5.2.2 TRX
Thioredoxin (TRX) is a small multifunctional, disulphide-containing redox protein possessing two redox-active cysteines within a conserved active site (Cys-Gly-
Pro-Cys) (Nakamura et ah, 1997). Like glutathione, TRX undergoes oxidation and reduction and provides reducing equivalents to other proteins (Gilbert, 1990). TRX contains two adjacent -SH groups in its reduced form that are converted to a disulphide unit in oxidized TRX. TRX is present in only micromolar concentration (Holmgren and
Luthman, 1978). The reduction of the disulphide back to the dithiol form is catalyzed by
TRX reductase (TrxR) with a co-factor, NADPH (Valko et ah, 2006). The low concentration of TRX predetermines the need for NADPH to speed the regeneration of reduced TRX. The relative participation of the TRX and GSH systems in providing reducing bioactivity is specific to the cell type and related to hexose monophosphate shunt (Biaglow et ah, 2000). By comparing different cancer cell lines and G6PD"
(glucose-6-phosphate dehydrogenase knock out) CHO cells, Biaglow et al (2000) evaluated the relative importance of TRX and GSH systems and dependence on the
G6PD activity in those cells. They found that in human lung carcinoma each of GSH and
TRX accounts for half of the activity; in rat hepatoma cells, on the other hand, 93% of the activity is explained by GSH. In G6PD" CHO cells, the activities of both TRX and
GSH systems decreased.
1.5.2.3 NADPH &G6PH
Although NADPH does not directly react with ROS, it is an antioxidant based on the new definition (Halliwell & Gutteridge, 2007). In contrast to directly operating antioxidants, it contributes to the antioxidative potential of the cell by regenerating the
18 oxidized antioxidant. NADPH is vital to many other antioxidants. For instance, GPx and
TRX activities depend on a continuous flow of reducing equivalents provided by additional enzymes and co-factors (Loeb et al, 1988). The main source of NADPH is from the hexose monophosphate shunt (HMPS), which is also known as the pentose phosphate pathway. In the HMPS, glucose-6-phosphate (G6P) is metabolized by the enzyme glucose-6-phosphate dehydrogenase (G6PD), the first and the rate limiting enzyme of the HMPS, regulated by the level of NADP+ (Kletzien et al, 1994). This enzyme is activated when the level of NADP+ is high and level of NADPH is low. The flow of G6P into either the glycolytic or HMPS pathway depends on the cellular needs for NADPH (for reductive biosynthesis), ribose-5-phosphate (for synthesis of nucleotides) and ATP (for energy) (Biaglow and Miller, 2005). Besides being used as an electron source for reduction of proteins, glutathione disulfide, and thioredoxin disulfide, and in the detoxification of reactive oxygen species (i.e., hydroxyl radical, peroxide and superoxide radical) and other toxins (GSH transferases), NADPH is also used in reductive biosynthesis, which produces ribose-5-phosphate used in the synthesis of RNA,
DNA and nucleotide coenzymes (Ayene et al, 2002).
The other structurally related compounds are flavins, which include FAD and
FMN. They are most commonly encountered as prosthetic groups, permanently attached to enzymes such as GSH reductase and TrxR associated redox reactions, where they function as temporary carriers of reducing equivalents as part of the catalytic mechanism
(Bjornstedt et al, 1997; Dym and Eisenberg, 2001). Thus they are not considered as antioxidants.
19 1.5.3 Flavonoids
Flavonoids are a large group of natural products (more than 6,500) that are widespread in higher plants (Harborne and Williams, 2000). Flavonoids are secondary metabolites in plants that act as antioxidants, antimicrobials, antifeedants, antistressors, insect repellents and/or attractive agents. Flavonoids have a common structure of diphenylpropanes (C6-C3-C6), consisting of two aromatic rings linked through three carbons (Figure 1-5). Flavonoids can be further subdivided into six major subclasses, based upon variations in the heterocyclic C-ring including flavanones, flavones, flavonols, catechins, anthocyanidins, and isoflavones (Rice-Evans et al, 1995). In addition to their antioxidant activity, flavonoids have many other functions including inhibition of prooxidant enzymes, promoting antioxidant en2ymes, anti-estrogen and anti-aromatase activities, regulation of the cell cycle, and enhancement of apoptosis.
1.5.3.1 Inhibition ofpro-oxidant enzymes
The xanthine oxidase inhibitory effect of flavonoids is important biologically for the inhibition of free radical production. Many flavonoids including tea flavonoids can inhibit the activity of xanthine oxidase (Aucamp et al, 1997; Lin et al, 2000; An et al,
2005). A structural and activity relationship study showed that the functional groups on the A-ring of flavonoids seems to be essential for good inhibitory activity. More specifically, the substituents on the A ring (C5, C7) and the carbonyl region are crucial for this activity, and the modifications on the B ring do not affect its activity (Cotelle,
2001).
Lipid peroxidation not only disrupts membrane integrity, but its oxidative products can also modify protein function and DNA expression patterns. Many studies
20 .OH
HO. .0. Flavanone Catechin
OH O
.OH
HO. ,0. Anthocyanin Flavone
OH O
,0H
HO. Isoflavone Flavonol OH OH O
Figure 1-5 The basic structures of flavonoids and the six major subclasses
21 have shown that tea flavonoids inhibit cyclooxygenase (COX)-2 and 5-, 12-, and 15- lipoxygenase activities in human colon mucosa cells and human colon cancer cells (Metz et al, 2000; Hong et al, 2001). Many in vivo studies have found that quercetin (Molina et al, 2003; Coskun et al, 2005; Ramana et al, 2006) and many other flavonoids such as luteolin, hesperidin, silymarin and isoliquiritigenin (Soto et al, 2003; Manju et al, 2005;
Tirkey et al, 2005; Zhan and Yang, 2006) also decrease lipopreoxidation. Flavonoids also modulate lipid peroxidation kinetics by altering the lipid packing order and decreasing fluidity of the membrane (Arora et al, 2000). These changes could sterically hinder diffusion of free radicals and restrict peroxidative reactions (Blokhina et al, 2003).
1.5.3.2 Metal Chelating effects
The transition metals, particularly iron and copper, are essential cofactors for several enzymes involved in oxygen metabolism and are usually bound to proteins, such as lactoferrin and ferritin for iron and ceruloplasmin for copper (Swain and Gutteridge,
1995; Soobrattee et al, 2006). However, when these transition metals are present in their free state in biological systems, they can catalyze free radical reactions. Flavonoids chelate metal ions (iron, copper) and terminate the Fenton reaction (Rice-Evans et al,
1997). In chemical models, there are three possible metal-complexing sites within a flavonoid containing hydroxyls at C3, C5, C3' and C4'. These are located between the C3 hydroxyl and the carbonyl, the C5 hydroxyl and the carbonyl and between the orthohydroxyls on the B-ring (Bors et al, 2001; Cotelle, 2001). Although the metal chelating effect of flavonoids in vivo has not been demonstrated, many lines of evidence from in vitro and ex vivo studies have shown that flavonoids chelate both Fe2+ and Cu +
22 and reduce oxidative damage (Zou et al, 2004; Farombi and Nwaokeafor, 2005; Sen et al, 2008).
1.5.3.3 Enhancement and protection of antioxidant enzymes
Flavonoids can protect and regenerate both enzymatic and non-enzymatic antioxidants. Quercetin and other flavonoids have been shown to increase the concentration and activity of GSH, GPx, SOD and CAT in both in vitro and in vivo studies (Lee et al, 2002; Molina et al, 2003; Soto et al, 2003; Coskun et al, 2005; Fki et al, 2005; Manju et al, 2005; Tirkey et al, 2005; Ramana et al, 2006; Zhan and Yang,
2006; Govindarajan et al, 2007; Mukherjee et al, 2007; Sudheer et al, 2007; Wang et al, 2007). Also, some flavonoids, such as ellagic acid, can increase the serum concentrations of vitamins A, E and C (Sudheer et al, 2007), although the mechanism for this effect is not clear.
1.5.3.4 Strong antioxidants
Flavonoids have been shown to be more effective antioxidants in vitro than vitamins E and C (Tsao et al, 2003; Manach and Donovan, 2004; Valachovicova et al,
2004). Flavonoids possess ideal structural chemistry for free radical scavenging activity.
Antioxidative properties of flavonoids arise from their high reactivity as hydrogen or electron donors, and from the ability of the flavonoid-derived radical to stabilize and delocalize the unpaired electron (chain-breaking function). These phenoxy radical intermediates are relatively stable so they do not initiate (propagate) further radical reactions. Thus, flavonoids acting as antioxidants may function as terminators of free radical chains (Blokhina et al, 2003). The structural requirements for antioxidant activity
23 are similar to those for metal chelating activity, but seem to be different from those responsible for xanthine oxidase inhibition (Florian et ah, 2006).
1.5.3.5 Direct binding
Flavonoids can bind to DNA through hydrogen bonds at the site that would normally react with the active metabolites of carcinogen during carcinogen-DNA binding, a crucial step for initiation of carcinogenesis (Dixit and Gold, 1986;
Bhattacharya and Firozi, 1988). Alternatively, when a flavonoid binds to DNA, its atomic arrangement could position it in a way that can effectively scavenge reactive intermediates that approach the critical sites on DNA. Finally, flavonoids may directly interact with the ultimate reactive metabolites of carcinogens by donating their electrons
(Wood et ah, 1982) and rendering them inactive. As well as acting directly at the potential sites of DNA damage, flavonoids (e.g. flavopiridol) can also directly bind to cell cycle regulators, such as CDK-2 and CDK-4, inducing Gl arrest in human breast cancer cells (Carlson et ah, 1996).
1.5.3.6 Phytoestrogens & anti-aromatase activity
Dietary phytoestrogens are defined as natural chemicals present in our diet that can mimic or modulate the action of endogenous estrogens, usually by binding to estrogen receptors (Cos et ah, 2003; Ososki and Kennelly, 2003). Phytoestrogens include isoflavones, isocoumarin acid, coumarone and lignans. Many phytoestrogens bind to ERp with higher affinity than ERa, and ER|3 in many instances opposes the actions of ERa
(Matthews and Gustafsson, 2003). This selectivity has been correlated with their anti proliferative capacity in tumour cells (Ranelletti et ah, 1992; Shao et ah, 1998a).
24 Flavonoids not only bind to estrogen receptors, but can affect circulating or tissue concentrations of estrogen by inhibiting key enzymes in estrogen biosynthesis (Kellis and
Vickery, 1984). Aromatase, one of these enzymes, converts testosterone to estradiol (Zhu and Conney, 1998). Increased expression of aromatase has been observed in several breast cancers (Miller et ah, 1990; Zhou et ah, 1996; Chetrite et ah, 2000) and flavonoids can inhibit this activity (Seralini and Moslemi, 2001; Brueggemeier et ah, 2005;
Monteiro et ah, 2006). The structure-activity relationships suggested that hydroxylation at position 3' and/or 4' are the optimal pattern of B ring substitution to enhance the anti- aromatase activity of flavonoids (Pouget et ah, 2002). Prenylated flavonoids from hops have been shown to strongly inhibit aromatase activity in various cancer cells and could block carcinogenesis (Monteiro et ah, 2006; Monteiro et ah, 2007).
1.5.3.7 Cell cycle regulation
Recent studies have shown that flavonoids can inhibit different stages of the cell cycle: Gl, S, G2 and M (Gusman et ah, 2001) depending on the type of flavonoid.
Epigallocatechin gallate (EGCG) from tea extract has been shown to directly inhibit
CDKs (Liang et ah, 1999), induce the expression of p21 and p27 genes, or inhibit the expression of cyclin Dl and Rb phosphorylation (Liang et ah, 1999; Semczuk and
Jakowicki, 2004). Resveratrol, from red wine and grapes, was shown to arrest HL-60 cells at the S/G2-phase transition and subsequently increase the cell number in the Gl/S phases (Suh et ah, 1995). Genistein, the major isoflavone from soy bean, induces a G2/M cell-cycle arrest in prostate cancer cells (Davis et ah, 1998), non-small-cell lung cancer cells (Lian et ah, 1998), and breast cancer cells (Upadhyay et ah, 2001).
1.5.3.8 Anti-Angiogenesis and Anti-Metastasis activity
25 Many flavonoids have been found to counteract the effects of R.OS in the context of angiogenesis. Genistein was found to effectively decrease VEGF protein (Shao et al,
1998; Buchler et al, 2004; Guo et al, 2007) and IL-8 expression (Handayani et al,
2006). Tea flavonoids inhibit IL-8 expression (Tang and Meydani, 2001; Rodriguez et al,
2006). Flavonoids can also decrease the levels of MMPs, which degrade essentially all of the protein components of the extracellular matrix (Miller et al, 2002; Lee et al, 2003).
Genistein down-regulates MMP-9 and up-regulates the tissue inhibitor of MMP-1 both in vitro and in vivo (Shao et al, 1998b). EGCG elicited a dose-dependant decrease in
MMP-2 and MMP-9 activity in human fibrosarcoma (Garbisa et al, 2001) and quercetin inhibited MMP-2 activity in human microvascular endothelial cells (Tan et al, 2003).
1.5.3.9 Apoptosis
Two mechanisms of apoptosis have been extensively characterized: the intrinsic or mitochondrial-mediated mechanism and the extrinsic or death-receptor-mediated mechanism. Both cascades converge in a common executor mechanism involving activated proteases (caspases) and DNA endonucleases, which cleave regulatory and structural molecules and lead to cellular death (Johnson, 2002; MacFarlane and Williams,
2004). Flavonoids can trigger apoptosis through the modulation of a number of key elements in cellular signal transduction pathways linked to apoptosis (caspases and bcl-2 genes) (Watson et al, 2000; Yang et al, 2001; Manson, 2003), release of cytochrome c with subsequent activation of caspase-9 and caspase-3 (Wang et al, 1999; Masuda et al,
2001; Spencer et al, 2003; Ong et al, 2004; Michels et al, 2005; Shimizu et al, 2005;
Selvendiran et al, 2006), increase levels of caspase-8 and t-Bid (Michels et al, 2005;
Selvendiran et al, 2006), down-regulate of Bcl-2 and BC1-XL expression and enhance
26 expression of Bax and Bak (Lee et ah, 2001; Masuda et ah, 2001; Park and Seol, 2002;
Lee et ah, 2005b; Selvendiran et ah, 2006). It is a great advantage that flavonoids exert the apoptotic effects in a selective manner. EGCG, for instance, induced a pronounced and specific growth-inhibitory effect on cancer cells, but not on their normal counterparts
(Chen et ah, 1998; Brusselmans et ah, 2003; Chung et ah, 2003; Kawai et ah, 2005).
1.6 Epidemiological study of flavonoids and cancer
Many epidemiological studies have found that intake of flavonoids was inversely associated with the incidence of breast (Fink et ah, 2007), ovarian (Rossi et ah, 2008), colorectal (Theodoratou et ah, 2007), lung (Cutler et ah, 2008), and pancreatic
(Nothlings et ah, 2007) cancers. But others reported that high intakes of flavonoids could not reduce colorectal (Lin et ah, 2006; Rossi et ah, 2006), ovarian (Gates et ah, 2007), pancreatic (Bobe et ah, 2008), and prostate (Bosetti et ah, 2006) cancers. The chemoprevention activity of flavonoids is also related to smoking status. Most of the studies have found that the effect of flavonoids are more pronounced in smokers
(Nothlings et ah, 2007; Bobe et ah, 2008; Cui et ah, 2008; Cutler et ah, 2008) compared to non-smokers. This may be due to smoking-induced increases in ROS in the human body (Chung-man Ho et ah, 2001; Uneri et ah, 2006; Kaushik et ah, 2008).
Since the structures of flavonoids are quite different, the effects displayed tend to be cell specific. For example, isoflavones, flavanones and catechins are more effective than other flavonoids in reducing lung cancer incidence (Cutler et ah, 2008). An inverse relation was found between ovarian cancer and flavonols (Gates et ah, 2007; Rossi et ah,
2008) as well as isoflavones (Rossi et ah, 2008). Flavonols and catechins were more effective than other flavonoids in colorectal cancer (Theodoratou et ah, 2007). Flavones,
27 flavonols and isoflavones were found more active in reducing breast cancer incidence
(Bosetti et al, 2005; Fink et al, 2007). Since many confounding variables are associated with epidemiological studies and dietary intake estimates suffer from imprecision, the biological study of the chemoprevention and anticancer activity of flavonoids needs to be performed.
In this study, a prenylated isoflavone from Osage orange fruits was chosen to test its antioxidant and anticancer activities. Because many lines of evidence indicated that isoflavones as a group showed both antioxidant and anticancer activities (He et al, 2002;
Rufer and Kulling, 2006; Shim et al, 2007), and also the prenylated group in general makes it greater activity than its counterparts (Tsao et al, 2003; Epifano et al, 2007;
Monteiro et al, 2007). In addition, the source material can be obtained from many parts of the world including the southeast of Canada. The ultimate objective of this study is to support the use of this inedible fruits as a chemopreventive and/or chemotherapeutic agent.
1.7 Hypothesis
The hypothesis to be tested is that the specific isoflavone, pomiferin, from Osage orange fruits shows greater antioxidant and anticancer activities compared to other common isoflavones. The specific objectives that were employed to test the hypothesis were as follows:
1. To quantify the antioxidant activities of pomiferin by using various antioxidant
assays and compare to the activities of other common isoflavones.
28 2. To test its antiproliferative activity and selectivity on breast cancer MCF-7 and
MDA-MB-435 cell lines; and MCF-10A spontaneously immortalized human
breast epithelial cells.
3. To identify the gene expression changes regulated by pomiferin by using cDNA
microarray.
4. To confirm the gene expression changes by using use real time reverse
transcription polymerase chain reaction (RT-qPCR).
5. To determine pomiferin's in vivo anticancer activity by using both MCF-7 and
MDA-MB-435 xenograft models.
6. To determine if there is a correlation between the effectiveness of pomiferin as an
antitumour agent and its plasma concentration.
29 CHAPTER II
CHEMISTRY AND ANTIOXIDANT ACTIVITY OF PRENYLATED
ISOFLAVONES FROM OSAGE ORANGE
2.1 Introduction
Isoflavones represent a special group of flavonoids. First, the B-ring of the flavonoids isomerize from the 2-phenyl side chain to the 3-position (Figure 1-5); and second, when compared to other flavonoids, they have a very limited distribution in the plant kingdom and are almost exclusively restricted to the subfamily Papilionoideae of the Leguminosae, such as soy beans, red clover, kudzu and alfalfa. More than 200 isoflavones have been found and the number is still growing (Donnelly and Boland,
1995). The chemical structures of isoflavones are quite diverse. In addition to oxygenation and glycosidation patterns, structural complexity also arises from incorporation of prenyl substituents into the ring system. Furthermore, subsequent cyclization of a prenyl group onto a neighbouring phenol function results in the formation of pyrano or furano ring systems (Donnelly and Boland, 1995).
In addition to leguminous plants, some complex isoflavones have been found in some other plants/trees (Table 2-1) (Tahara and Ibrahim, 1995). When exploring those sources, it was found that one of those plants, Osage orange (Figure 2-1), belonging to
Madura pomifera (Raf.) Schneid, contained high concentration of isoflavones. Osage orange is a tree that is native to a small region in the United States that was also known
30 Table 2-1 Isoflavones in other Genera and families (Leguminosae is not included) Family Genus Isoflavonoid class Celastraceae Eunomyces furanoisoflavone Compositae Wyethia prenylisoflavones Euphorbiaceae Macaranga dihydrofuranorotenoid Gymnosperma Pinus thunbergii pyrano-pterocarpan Moraceae Cudrania & Madura dihydrofuranoisoflavone & prenylpyranoisoflavones Scrophulariaceae Sopubia and Verbascum prenylisoflavone aglycone, glycoside & dihydrofuranorotenoid Zingiberaceae Costus dihydrofurano- & pyrano- pterocarpans (Tahara and Ibrahim, 1995)
31 Figure 2-1. Osage orange fruit.
32 as the home of the Osage Indians, hence the common name of Osage orange.
Osage orang was widely planted as hedge trees throughout the Midwest of the United
States and Ontario, Canada, therefore, also has the name hedge apple, and it played an important role in converting the prairies into productive agricultural land communities
(Peattie, 1953; Smith and Perino, 1981; Barnett and Burton, 1997). Other than its uses as a hedge tree and hardwood, some indigenous people collect and place the fruits in their basement and garage to ward off insect pests such as spiders and cockroaches (Peattie,
1953; Peterson and Coats, 2001). Also, some Native Americans have used Osage orange for cancer treatment (Mahmoud, 1981).
Among the phytochemicals in the fruit of the Osage orange, isoflavones are the predominant group and are perhaps the most studied. Osajin, pomiferin and their isomers, auriculasin and scandenone (Figure 2-2), were discovered and their structures were identified (Wolfrom et al, 1946; Delle Monache et al, 1994).
In this study, isoflavones were extracted from Osage orange fruits with organic solvents and purified by using column chromatographic methods. The chemical structures of major isoflavones were verified with UV, LC-MS and NMR spectra. In addition, the antioxidant activity of these compounds were evaluated and compared to major known soy isoflavones.
2.2 Materials and Methods
2.2.1 Chemicals and Solvents
L-Ascorbic acid, ^-carotene, daidzein, genistein, 2,4,6-tripyridyl-5-triazine
(TPTZ), and Tween 40 were purchased from Sigma Chemical Co. (Oakville, ON); ferric chloride (FeCl3), ferrous sulphate heptahydrate (FeS04-7H20), linoleic acid, and sodium
33 Daidzein: R=H Genistein: ROH
O
Osajin: R=H Pomiferin: R=OH
Scandenone: R=H Auriculasin: R=OH
Figure 2-2. The structural comparisons of selected isoflavones
34 acetate were from Aldrich Chemical Co. (Milwaukee, WI); and all HPLC grade solvents including acetic acid, acetonitrile, dichloromethane, ethyl acetate, hexanes and methanol, and anhydrous sodium sulphate were from Caledon Laboratory Chemicals (Georgetown,
ON).
2.2.2 Extraction and Purification of Isoflavones
The Osage orange fruits were collected locally (Guelph, ON) in late October,
2004 and stored at -20 °C before being processed. Seven kilograms of fruit was semi- thawed, sliced into 1 cm x 2 cm x 2 cm slices and soaked in a 1:4 w/v mixture of ethyl acetate for 48 hr. The mixture was filtered through a Whatman No. 1 filter paper, and the remaining fruit was rinsed and soaked (repeating the above process) three more times.
The combined extract was then concentrated to aqueous in vacuo at < 40 °C. The concentrated extract was partitioned with an equal volume of ethyl acetate, and excess anhydrous sodium sulphate was added to dry the ethyl acetate phase. Then the ethyl acetate phase was filtered with Whatman No. 1 filter paper and the filtrate was dried in vacuo at < 40 °C. The dried residue was re-dissolved in hexane and ethyl acetate mixture
(3 L, 1:1, v/v) to load the silica gel.
Large scale silica gel (mesh size: 70-230, Sigma Chemicals Co) columns
(5.0X68cm) were packed with the solvent mixture of hexane and ethyl acetate (1:1, v/v); then an aliquot of the sample solution (-300 mL) was loaded onto the column. The above solvents were used for running the column isocratically with a preparative pump
(LabAlliance, PA) at 9 mL/min. Fractions (50 mL) were collected manually and checked with TLC (thin layer chromatography). The TLC plates were also developed in the above solvent mixture and viewed under a short wavelength UV light (254 nm). The first
35 fraction was named as fraction A (FA) and the second one as fraction B (FB). These two fractions were concentrated to dryness in vacuo at < 40 °C. FA and the FB were washed with food grade ethanol and dried in vacuo and further dried in an oven overnight at 40
°C. Twenty-four grams of FA and 33 g of FB were obtained through this process. The purity of FA and FB was confirmed by HPLC analysis with a photodiode array detector
(DAD).
2.2.3 Structure Identification with MS and NMR
The identities of FA and FB were verified by using HPLC coupled to a DAD
(Finnigan MAT Spectra System UV6000LP, San Jose, CA) and a Finnigan LCQ Deca electrospray ionization mass spectrometer (HPLC-ESI-MS) operated in the negative ion mode. Then H and C NMR spectra of the above two compounds (30 mg/mL) were recorded in DMSO-d Milton, ON). Also, H-H correlation spectroscopy (COSY) and heteronuclear single quantum coherence (HSQC) were also recorded. 2.2.4 Quantification of Osajin and Pom iferin An HPLC system (1100 series, Agilent Technologies, Palo Alto, CA) equipped with a quaternary pump, a degasser, a thermostatic autosampler, and a DAD was used for sample analysis and quantification. The analytical data were evaluated using the 3D Chemstation software. Separation of isoflavones was carried out in a Phenomenex® 5 um ODS-2 C18 RP (150 x 4.6 mm i.d.) column (Torrance, CA) with a C18 guard column. The mobile phase was composed of 2% acetic acid in water (solvent A) and acetonitrile (solvent B), pumped at a flow rate of 1 mL/min. The linear gradient elution conditions were as follows: 50% B to 100% B in 15 min, 100% B back to 50%) B in 2 min. The 36 injection volume for all samples was 10 \iL. The analytes were monitored at 274 nm. UV spectra were recorded from 200 to 600 nm. 2.2.5 Antioxidant assays The antioxidant activity of isoflavones were evaluated in Ferric Reducing/Antioxidant Power (FRAP) Assay (for redox potential), (3-Carotene-Linoleic Acid Model System (P-CLAMS) for measuring free radical-chain reactions and photochemiluminescent (PCL) assay for measuring the scavenging capacity of superoxide radicals. 2.2.5.1 Ferric Reducing/Antioxidant Power (FRAP) Assay The FRAP assay was first introduced by Benzie and Strain (1996) for measuring the total antioxidant activity. The assay is based on the reducing power of a compound (antioxidant). A potential antioxidant will reduce the ferric ion (Fe3+) to the ferrous ion (Fe2+); the latter forms a blue complex (Fe2+/TPTZ), which increases the absorption at 593 nm. In this study, the above method was modified for the 96 well microplate reader. Briefly, the FRAP reagent was prepared by mixing acetate buffer (300 mM, pH 3.6), 10 mM TPTZ in 40 mM HC1, and 20 mM FeCl3 at 10:1:1 (v/v/v). All standards and samples were prepared at 500 uM in water or methanol. The 300 uL reagent and the 10 uL standard (FeSO^HbO) or sample solutions were added to the well and mixed well. The absorbance readings were taken at 593 nm immediately after and 4 min after using a visible-UV microplate kinetics reader (EL 340, Bio-Tek Instruments, Inc., Winooski, VT). The plate was incubated at 37 °C for the duration of the reaction. All standards and samples were run in triplicate. The FRAP value of the samples was calculated on the 2+ basis of 500 uM Fe (FeS04-7H20) as follows: 37 FRAP Value (uM) = (0-4 min AA593 nm test sample)/(0-4 min AA593 „„, standard) x 500 (uM) 2.2.5.2 j3-Carotene-Linoleic Acid Model System (fi-CLAMS) The p-CLAMS (Miller, 1971; Taga et al, 1984) method is based on the decoloration of P-carotene by the peroxides generated during the oxidation of linoleic acid (a free radical chain reaction) at elevated temperature (45 °C). In this study, the p- CLAMS was modified for the 96 well microplate reader. In brief, P-carotene (0.5 mg) was dissolved in 2 mL of CH2CI2 in a 200 mL round-bottom flask, to which 25 uL of linoleic acid and 200 mg of Tween 40 were added. CH2CI2 was removed in vacuo at <40 °C. Oxygenated HPLC grade water (100 mL) was added, and the flask was shaken vigorously until all material dissolved. The oxygenated water was obtained by bubbling the Nanopure® water with compressed oxygen gas for at least 2 hr at ambient temperature. This test mixture was prepared fresh and used immediately. To each well 250 (J.L of the test mixture and 35 uL of sample solution or solvent blank were added. The plate was incubated at 45 °C. Readings were taken at 490 nm immediately after and every 15 min for 300 min using the same microplate kinetics reader as stated above. All antioxidant standards and samples were run in triplicate. 2.2.5.3 Photochemiluminescent (PCL) Assay The principle of PCL was based on an approximate 1000-fold acceleration of the oxidative reaction in vitro compared to normal conditions. This effect was achieved by optical excitation of a suitable photosensitizer, which exclusively results in the generation of the superoxide radical (O2'"). The radicals were visualized with a chemiluminescent 38 detection reagent. A synthetic fluorescent compound, luminol, was used in this assay. This compound plays a dual role, acting as both the photosensitizer and the radical reaction agent (Popov and Lewin, 1999). A commercial PCL instrument, the Photochem® (Berlin, Germany) system was used in this study. This system is very flexible and can be used for both hydrophilic and lipophilic antioxidative substances. The company supplied the complete kits for both. For hydrophilic substances, the assay mixture contained 1 mL of reagent 1 (sample solvent), 1.5 mL of reagent 2 (reaction buffer), 25 uL of diluted reagent 3 (luminol), and 10 uL of reagent 4 (ascorbic acid) for the calibration curve or 10 uL of sample solution for the antioxidant activity. The evaluation of the activity was based on the lag phase in seconds (Popov and Lewin, 1999). When necessary, samples were diluted so that the PCL curves fell within the linear range of the standard, ascorbic acid (0.05-0.3 mM). All results were expressed as ascorbic acid equivalent (AAE, mM). All samples were prepared and run in triplicate. 2.2.6 Statistics For the comparisons of the antioxidant activity among all the tested isoflavones, one-way ANOVA using SPSS 15.0 for Windows followed by Fisher's least significant difference (LSD) test were used for statistical analysis (p < 0.05). 2.3 Results 2.3.1 Structural confirmation The mass spectra were obtained with electrospray ionization (ESI). Based on the MS spectra, the peak of 403 as an [M - H]" peak of FA and was confirmed by the presence of peaks at 807 [2M - H]", 1211 [3M - H]", and 1615 [4M - H]", which are corresponding to its dimer, trimer and tetramer, respectively (top panel of Figure 2-3). Thus, FA was either 39 ,„.„™™>« 403 [M-H] 1 807 [2!M-H] - FA [MW 404] \ \ 808 i 404 1211 [3M-H]- 1615 [4M-H]- ;i -.,•* II,.I.I,I,I , - **r.„-*,,wr*4~V+*'1*W ,~l .-.l> *. >•» ! 419 [M-H]- 839 [2M-H] FB [MW 420] 1259 [3M-H]- 875 901 1261 455 1679 [4M-H]- b02 it,' itijftHi |ii Figure 2-3. The mass spectroscopy of osajin and pomiferin obtained from the HPLC-ESI- MS experiment. The mass spectrometer was operated in a negative ion mode. X-axis— mass charge ratio (m/z); and Y-axis—relative abundance of each ion. 40 osajin or scandenone. Similarly, the m/z of 419 ([M - H]~) is a molecular ion of FB, since its dimer, trimer and tetramer have been identified as 839 [2M - H]", 1259 [3M - H]", and 1679 [4M - H]", respectively (bottom panel of Figure 2-3). FB was identified as pomiferin or auriculasin. The UV spectra of FA and FB showed distinctive maximum absorption at 274 nm with a shoulder at 356 ran for both compounds (Figure 2-4). Thus, these two isoflavones, osajin and pomiferin, can be distinguished from their corresponding isomers, scandenone and auriculasin, which have the maximum UV absorption at 286-290 nm, and had no absorption near 356 nm (Delle Monache et ah, 1994). 274 nm 365 nm 200 300 400 500 nrW Figure 2-4. The UV spectra of FA (dot line) and FB (solid line). X-axis—wavelength from 200 to 600 nm; and Y-axis—arbitory units of absorbance. l 13 The H and C NMR spectra of FA and FB were obtained in DMSO-d6. A comparison of the NMR data of FA and FB facilitated the structural identification of these pairs of compounds (Table 2-2). All NMR assignments were also confirmed by 2D 41 Table 2-2 lH and 13C NMR data of Pomiferin and Osajin Pomiferin Osajin Positions JH*/OH isc tH/OH isc 2 8.351(5) 154.360 8.351(5) 153.923 3 122.507 122.323 4 180.642 180.578 5 13.438 158.396 13.379 158.370 6 111.571 111.576 7 156.332 156.338 8 100.391 100.382 9 149.798 149.807 10 104.866 104.836 l' 121.541 121.095 2 6.993(4 1.6) 116.606 7.366(^4 2.0,7.8) 130.179 3' 9.059 144.914 6.814(<*4 2.0,7.8) 115.060 4' 9.059 145.617 9.600 157.472 5' 6.770(4 10.4) 115.401 6.814(J4 2.0, 7.8) 115.060 6' 6.782(4 10.4) 120.012 7.366(^4 2.0, 7.8) 130.179 2" 6.657(4 9.6) 127.857 6.632(4 9.6) 114.214 3" 5.765(4 9.6) 114.250 5.738(4 9.6) 127.830 4" 77.909 77.891 Me2 1.415(5) 27.561 1.402(5) 25.492 2" 3.222(4 7.8) 20.831 3.203(4 7.2) 20.813 3'" 5.126(m) 121.687 5.122(m) 121.668 4'" 130.914 130.875 Z-Me 1.616(5) 17.756 1.605(5) 17.729 £-Me 1.736(5) 25.514 1.724(5) 23.002 Chemical shift in ppm; splitting patterns and the coupling constant J values (Hz) are in parentheses. The main differences between these two compounds are in bold. DA01 E, Sig=274,8 Ref=off (OSAGBCJ3FEB053.D ) Norm. : -93 8 350- 300 ^ - 9.90 1 250- 200^ 150^ 100- 50- I I i Vi ! i i I , | . I ' .J' I v_i I ' ' ' I ' ' ' I 0 2 4 6 DAD1 E, Sig=274,8 Ref=off (OSAGE\03FEB05H.D) Drm. -; o> 350- 300^ 250^ 200- 150^ 100^ 50- 0- /I \l 10 12 14 16 mir Figure 2-5. HPLC chromatograms (wavelength at 274 nm) of the ethyl acetate extract of the Osage orange fruit (top panel), pomiferin (middle panel) and osajin (bottom panel). See more details in HPLC method section. 43 NMR spectroscopy. These results are consistent with other studies (Delle Monache et al, 1994; Peterson et al, 2000). Based on the above spectral data, these two compounds were unambiguously identified as osajin and pomiferin. It is interesting that the isoflavones in our Osage orange are almost exclusively osajin and pomiferin (Figure 2-5 top panel). In Europe (i.e. Italy), the two isomers, auriculasin and scandenone, represented approx 13% and 15% of the concentration of pomiferin and osajin, respectively (Delle Monache et al, 1994). However, the fruits harvested form the Middle East (i.e. Turkey) mainly contain auriculasin and scandenone (Kupeli etal, 2006). 2.3.2 Yield and purity of pomiferin and osajin From 7 kg of Osajin orange fruits, 33 g and 24 g of pomiferin and osajin were obtained with a purity of 97% and 95%, respectively (Figure 2-5 middle and bottom panels). The concentration of total isoflavones (8.1 g/kg) in this fresh fruit is greater than those in the soybean (1-4 g/kg, on a dry weight basis) (Wiseman et al, 2002) or any other major or minor crops containing isoflavones (Frankel, 1993). 2.3.3 Antioxidant activity Many in vitro antioxidant assays have been developed (Huang et al, 2005). The choice of the assay depends on its chemical mechanism, simplicity and cost. In this study, the FRAP, |3-CLAMS and PCL assays covering a broad range of activities were used. The FRAP is used for evaluating the redox activity. The P-CLAMS assay can be viewed as mimicking the free radical chain reactions in the cell membrane. The purpose of the PCL is to test the quenching activity of superoxide anions (O2'), the source of many other free radicals (see Chapter I). 44 In the FRAP assay, all antioxidants were prepared and tested at the same concentration of 500 uM, after the generation of the standard curve of Fe2+. On the basis of the standard (Fe ), the FRAP value of pomiferin was 866 uM (Figure 2-6). Although not as high as that of vitamin C (L-ascorbic acid), pomiferin showed strongest antioxidant activity among all the tested isoflavones. Osajin, with one hydroxyl group less than pomiferin, showed dramatically decreased activity. This indicates that the ortho hydroxyl group on B-ring is critical for its antioxidant activity. When comparing the antioxidant activity between osajin and genistein, and between genistein and daidzein, it was found the 5-hydroxyl group on the A-ring plays a certain role in their antioxidant activity, but not as great as the ortho hydroxyl groups on B-ring. Overall, the redox potential of soy isoflavones are relatively low, which is consistent with the findings of Mitchell et al. (1998). In the P-CLAMS assay of quenching free radicals, pomiferin showed, once again, a very strong antioxidant activity (Figure 2-7 and Table 2-3). For this assay, different endpoints have been used for evaluating the antioxidant activity in P-CLAMS. An average absorbance value over the assay period was used by Birch et al. (2001); the slope for the initial linear portion of the plot was used by Fukumoto and Mazza (2000), and the degradation rate was also used by Emmons et al. (1999). Actually, all three calculations produced consistent results (Table 2-3). In this study, we used the initial 90 min absorbance values of the tested compounds and calculated the antioxidant activity according to all three methods. Pomiferin consistently showed a good antioxidant activity. Osajin, genistein and daidzein showed only slight antioxidant activity in the p-CLAMS assay. Contrary to the fact that vitamin C is a good antioxidant in the FRAP assay, it had 45 Figure 2-6. Antioxidant activities of isoflavones and L-ascorbic acid measured by the FRAP assay. By using one way ANOVA and followed by Fisher's least significant difference (LSD) test, L-ascorbic acid displayed the greatest antioxidant activity (p <0.001) of all the tested samples. Pomiferin showed the highest activity among all the isoflavones (p < 0.001), and there is no difference between osajin, genistein and daidzein and the blank control (p = 0.815 & 0.672). 46 100.00% 90.00% 80.00% 70.00% t 60.00% 4- Blank L-Ascorbic acid Daidzein Genistein Osajin "8 40,00% Pomiferin 0.00% Figure 2-7. Antioxidant activities of isoflavones and L-ascorbic acid measured by the P- CLAMS assay. In this assay, the linoleic acid peroxidation was much slower in pomiferin added samples. L-ascorbic acid increased linoleic acid peroxidation. All compounds were tested in the same molar concentrations (0.9 mM). By using one way ANOVA and followed by Fisher's least significant difference (LSD) test, all the isoflavones except for osajin showed significant antioxidant activity when comparing to the control (p < 0.001) and L-ascorbic acid displayed a significant prooxidant activity (p O.001). There is no difference between osajin and the blank control (p = 0.063). 47 Table 2-3. Antioxidant activity of isoflavones calculated using different endpoints in the p-CLAMS assay. AOAa Average Absorbance b Slopec (Mean ± SD) (Mean ± SD) L-Ascorbic acid -71.10 ±8.43 0.20 ± 0.01 _ d Daidzein 27.08 ± 7.55 0.39 ± 0.04 -0.0059 Genistein 27.51 ± 10.61 0.39 ±0.02 -0.0058 Osajin 8.32±7.11 0.35 ± 0.03 -0.0068 Pomiferin 80.35 ± 0.42 0.74 ± 0.01 -0.002 Blank e 0.34 ±0.01 -0.0073 a Antioxidant activity calculated using the 90 min data points according to Emmons et al (1999). 6 Antioxidant activity calculated by averaging the absorbance values taken from 0-300 min at 15 min intervals (Birch et al, 2001). Antioxidant activity measured by the slope of the initial linear portion (before 90 min) of the absorbance values according to Fukumoto and Mazza (2000). d Non-linear. e Data for blank control were used for calculating the antioxidant activity of others. 48 no antioxidant activity in the p-CLAMS assay. Furthermore, the negative antioxidant activity (AOA) value of L-ascorbic acid indicated that it might be a pro-antioxidant at the concentration used in this study. The antioxidant activity of pomiferin was persistent up to 300 min, when the activity of other isoflavones has reduced to the baseline (Figure 2- 7). In the PCL assay, of all the tested isoflavones, only pomiferin showed substantial activity in quenching peroxide radicals (Figure 2-8), and its activity was much stronger than L-ascorbic acid. Other tested isoflavones showed no activity. This reinforces the idea that the ortho hydroxyl group of pomiferin is critical for its antioxidant activity, as shown by comparing it to its partner, osajin. 2.4 Discussion The antioxidant activity found in the in vitro experiments is only suggestive of a similar role in vivo. Nonetheless, these methods remain important as the first step in screening phytochemical antioxidants. In this study, the two soybean isoflavones, genistein and daidzein, were not good antioxidants in the FRAP, P-CLAMS and PCL assays. The completely different antioxidant activities between osajin and pomiferin indicated that the structure, particularly whether a hydroxyl group is attached on the 3'- position, may play an important role in the antioxidant activity of the Osage orange isoflavones (Figure 2-2). The hydroxyl group on the 5-position of A-ring may affect the antioxidant activity slightly, as there was different antioxidant activities for genistein and daidzein. 49 Ascorbic Acid Pomiferin Osajin Genistein Daidzein 0 0.5 1 1.5 2.5 AAE (mM) Figure 2-8. Antioxidant activities of isofiavones and L-ascorbic acid measured by the PCL assay. By using one way ANOVA and followed by Fisher's least significant difference (LSD) test, pomiferin showed a much greater activity of than L-ascorbic acid (p < 0.001), and other isofiavones did not show any activity compared to the black control. 50 The structure-activity relationship (SAR) studies of other flavonoids have shown similar results (Aherne and O'Brien, 2002; Rasulev et al, 2005). The antioxidant activity of flavonoids depends on the number and position of hydroxyl groups. Flavonoids with an ortho-hydroxyl structure on the B ring show great antioxidant activity. Some studies indicate that the presence of ortho hydroxyl groups on the B-ring is capable of readily donating hydrogen (electron) to stabilise a radical species (Rice-Evans et al, 1996; Bors and Michel, 1999; Bors et al, 2001) and confers a higher degree of stability on the flavonoid phenoxyl radicals by participating in electron derealization (Rasulev et al, 2005). All these effects may be responsible for their antioxidant activity. The validation of these assays can be evaluated by comparing with other studies. By using the FRAP assay, soy isoflavones have been reported to have much less activity than L-ascorbic acid (Mitchell et al, 1998; Rimbach et al, 2003), which is consistent with our findings. Pomiferin had much stronger activity than osajin (Vesela et al, 2004) and soy isoflavones (Burda and Oleszek, 2001; Lee et al, 2005a). To the best of our knowledge, our study was the first to use the PCL assay to evaluate the antioxidant activity of isoflavones. Other in vitro methods have been used in the determination of antioxidant capacity of isoflavones. Using low-density lipoprotein (LDL) oxidation, genistein and daidzein were good antioxidants (Jha et al, 1985; Rufer and Kulling, 2006), but others reported they were not (Lee et al, 2005a). By using the Trolox equivalent antioxidant capacity (TEAC) assay, high activities of genistein and daidzein were found by Mitchell et al. (1998), but not by others (Rimbach et al, 2003). By using the superoxide radical generated in the xanthine/xanthine oxidase system, some studies found the inhibition of 51 the production of the O2" by soy isoflavones (Wei et al, 1995), but others showed low activity (Rimbach et al, 2003). The inconsistency may be due to the assay method and conditions. Overall, of the soy isoflavones, genistein has been shown to have stronger antioxidant activity than daidzein, again consistent with our findings. So far most of the in vitro antioxidant assays have been designed to measure a sample's capacity to react with one oxidant (either organic radical or redox active compounds), and it is problematic to use one-dimensional methods to evaluate multifunctional food and biological antioxidants (Frankel and Meyer, 2000). Thus, multiple antioxidant assays with different mechanisms are needed for evaluating the antioxidant activity of tested compounds. If a compound shows strong activities in various assays, such as the case of pomiferin, it is more likely to have such functions in real biological systems. 52 CHAPTER III ANTIPROLIFERATIVE EFFECTS OF POMIFERIN IN MCF-7 AND MDA-MB-435 BREAST CANCER CELLS 3.1 Introduction Among all the cancers, breast cancer is the most common cancer among women worldwide (Bosetti et ah, 2008; Hery et ah, 2008). In Canada, breast cancer continues to lead in incidence among Canadian women, with an estimated 22,400 new cases in 2008 (Statistics Canada, 2008); approximately 1 in 106 women will develop breast cancer annually; over a lifetime the risk of developing breast cancer climbs to 1 in 9 (Health Canada, 2008). Although there is improvement in detection and treatment, therapeutic options for many cancers are still not developed completely, with low specificity of the treatment procedure and severe side effects in the patients (Wiseman and Adkins, 1998; Baum et ah, 2002). Breast cancer is a heterogeneous disease and traditionally it can be categorized into estrogen receptor positive (ER+) and estrogen receptor negative (ER-) depending on the presence or absence of estrogen receptors on the tumour cells. The estrogen receptor (ER) is probably the most powerful predictive marker in determining prognosis and predicting response to hormone therapies (McGuire, 1978; Pritchard, 2000; Ali and Coombes, 2002). ER has two isoforms (ERa and ER|3), which are mainly localized at the nuclear membrane. The most widely acknowledged mechanism of estrogen carcinogenicity is its binding to ERa and acting as a potent stimulus for breast cell proliferation through its direct and/or indirect actions on the enhanced production of 53 growth factors (Russo et al, 1999; Russo and Russo, 2005). Estradiol causes these ERa positive (ER+) cells to proliferate, which increases the pool of cells that could develop somatic mutations that may lead to neoplasia (Khan et al, 1994; Lawson et al, 1999; Lawson et al, 2002; Murphy and Watson, 2002). Activation of ER0 by its ligands tends to inhibit transcription and act in opposition to ERa (Leygue et al, 1998; Hall and McDonnell, 1999; Weihua et al, 2000; Roger et al, 2001; Peng et al, 2003). ER+ tumours possess estrogen-dependent growth and represent 70% of cases of primary breast cancers (Levine, 2001; Murphy et al, 2003). Common endocrine therapy including the ERa antagonist, tamoxifen, inhibits estrogen-dependent mitogenic effects on tumour cells. A proportion of breast cancer cells do not express ERa (ER-) and are typically seen in later stages, are more aggressive, and do not respond to endocrine therapy (Clarke et al, 1994; Bauer et al, 2007). They are typically treated with non specific cytotoxic chemotherapy. This therapy is less target-specific and more likely to result in adverse events. The relatively new predictive marker, HER-2, has also become a routine prognostic and predictive factor in breast cancer. Besides its important role in tumour induction, growth and progression, HER-2 is also a target for new therapeutic approaches such as Herceptin™ (trastuzumab), a recombinant antibody designed to block signalling through the HER-2 receptor (Hussain et al, 2007; Nanda, 2007; Shepard et al, 2008). Although effective therapies have been developed for patients with ER+ and HER2+ diseases, the treatment of chemotherapy of breast cancers lacking the expression of these markers (particularly triple-negative cancers [ER-, PR- and HER-2-]) needs further exploration, since these patients have poorer survival rates than those with 54 receptor positive breast cancers (Bauer et ah, 2007). Thus, there is a continual drive to identify markers that will aid in predicting prognosis and response to therapy. Genome-wide monitoring of gene expression using DNA microarrays is an option that allows the simultaneous assessment of the transcription of tens of thousands of genes and of their relative expression between normal cells and diseased cells or before and after exposure to various treatments. In this study, the microarray technique was used to monitor the transcriptional changes of genes from both ER+ and ER- cell lines before and after the cells were treated with pomiferin. Real time reverse transcript polymerase chain reaction (RT-qPCR) was used to confirm the changes in representative target genes. The potential activities of the confirmed genes in cancer cell biology are briefly summarized, as well as their possible roles in regulating/modulating critical signalling pathways. 3.2 Materials and Methods 3.2.1 Cell cultures and Proliferation assays 3.2.1.1 Cell Culture ER+ (MCF-7), ER- (MDA-MB-435) human breast cancer cell lines, and the spontaneously immortalized human breast epithelial cell line (MCF-10A) were obtained from ATCC (American Tissue Type Culture Collection, Bethesda, USA). The MCF-7 and MDA-MB-435 breast cancer cells were cultured in a-modified Eagle's medium (a-MEM) supplemented with 10% fetal bovine serum (FBS), 1 mM sodium pyruvate, 100 U/mL penicillin, 100 ng/mL streptomycin, and lOug/mL insulin. The MCF-10A spontaneously immortalized cells were cultured in 50:50 DMEM: HAMS's F12 nutrient mixture supplemented with 5% horse serum, 10 |xg/mL insulin, 0.5 55 ug/mL hydrocortisone, 20 ng/mL EGF, 100 ng/mL cholera toxin, 100 U/mL penicillin, and 100 ng/mL streptomycin. All cells were grown in a humidified atmosphere at 37 °C, with 5% CO2 in air. The division and morphology of the cells were monitored periodically. Cells were passaged every 2-3 days in 75 cm2 flasks, and maintained at subconfluent densities during all experimental procedures. 3.2.1.2 Proliferation assays For cell proliferation assays, 5 X 103 cells (in 200 uL growth media) were loaded in each well of a 96-well round-bottom plate, followed by addition of various concentrations of pomiferin. All wells had the same final concentration of solvent vehicle (DMSO). After 24 hr incubation at 37 °C, proliferation was estimated using the Sulforhodamine B (SRB) dye-binding assay as we have previously described (Atkinson and Meckling-Gill, 1995). All experiments were run at least in four replicates. 3.2.1.3 Sulforhodamine B (SRB) aye-binding assay The SRB dye-binding assay is a colorimetric assay used to measure cell protein, in which the amount of protein-bound dye (SRB binds to basic amino acids) as measured by absorbance and is proportional to the number of cells in each sample. Briefly, 50 uL of cold 50% trichloroacetic acid was added to precipitate cellular macromolecules. Plates were kept at 4° C for 1 hr, washed 5X with distilled water, and dried overnight at room temperature. Then 50 uL of 0.4% SRB sodium salt in 1% acetic acid was added to each well and left at room temperature for 30 min. Plates were washed 5X with 1% acetic acid to remove excess dye and left to dry overnight. Bound dye was solubilized with 100 (il of 10 mM unbuffered Tris base (~pH 10.5) and vigorous shaking on a rotary shaker. Absorbances were read on a V-max microplate reader at 570 nm. 56 3.2.1.4 Calculations oflCso values Cell number was estimated as a percentage of control, and calculated by dividing absorbance values of the mean of treated cells by the control value of cells with media containing vehicle (DMSO), and multiplied by 100%. Fifty percent inhibitory concentration (IC50) values were calculated using an approximated sigmoidal curve with variable slope, and was the concentration of pomiferin that produced a half-maximal inhibitory effect. 3.2.2 RNA extraction MCF-7, MDA-MB-435 and MCF-10A cells grown in 175 cm2 tissue culture flasks (175 cm2) (Sarstedt Inc, QC) were used for RNA preparation. When cultures reached 70% confluence, they were treated with pomiferin (5 uM) or vehicle for 24 hr. Cells were then released by brief exposure to trypsin/EDTA, and the RNeasy Mini Kit (Qiagen, Mississauga, ON) was used for RNA isolation according to the manufacturer's instructions. Briefly, the samples were disrupted in a highly denaturing cell-lysis buffer containing guanidine isothiocyanate (Buffer RLT) to stabilize the RNA. An equal volume of ethanol was added and the extract was loaded onto an RNeasy spin column. Contaminants including residual proteins, metabolites (e.g., polysaccharides), and low- molecular-weight impurities were removed by washing the spin column with medium- salt buffers RW1 and RPE. RNA was then eluted with RNase free water (Figure 3-1) and stored at -80 °C. Aliquots of the RNA were thawed on ice. The integrity of the total RNA was initially evaluated by running samples on 1.5% agarose gels containing ethidium bromide (lOuL of 1.5% ethidium bromide in 30 mL of gel) with 1 X TBE (Tris/Borate/EDTA) 57 Cells I lyse and homogenize I Add efhanol t Bind total RNA Total RNA era Wash 3x cp Elute Total RNA Figure 3-1. Total RNA purification process. Source: Qiagen's RNeasy® Mini Handbook, fourth edition, 2006 58 running buffer and visualization under UV light. The concentration of RNA was measured using a NanoDrop® ND-1000 Spectrophotometer (Wilmington, DE) at 280 and 260 nm, and the quality was further confirmed with the RNA 6000 Pico LabChip® Kit on an Agilent 2100 Bioanalyser (Agilent technologies, Palo Alto, CA) according to the manufacturer's instructions. 3.2.3 Microarray 3.2.3.1 Preparation of array slides For our study, the human 19K Combo Array kits containing more than 19,000 human clones were purchased from the University Health Network (Toronto, ON). Superscript™ Plus Indirect cDNA labelling System (Invitrogen Inc, Mississauga, ON) was used to prepare the hybridization slides. In brief, 20 \ig of total RNA from control and treated cells were used for the first strand cDNA synthesis. Sixteen |JL total RNA and 2 uL anchored oligo(dT)20 primer (2.5 \igj uL) were incubated at 70 °C for 5 min in 18 uL volume and chilled on ice for 1 min. Six microliters first strand synthesis buffer was then added (1.5 u.L 0.1 M DTT, 1.5 uL lOmM dNTP mixture, 1 uL RNaseOUT™ and 2 uL Superscript™ III RT) to each tube, and the tube was incubated at 46 °C for 3 hr. Next, 15 uL of 1.0 M NaOH was used to degrade the original RNA and 15 uL of 1.0 M HC1 to neutralize. Next, the PureLink PCR Purification System (Invitrogen, ON) with spin columns was used to purify the cDNA, the cDNA was then coupled with fluorescent dye with Superscript Plus Indirect cDNA labelling System (Invitrogen Inc, ON), the labelled cDNA was purified with the PCR purification kit (Qiagen Inc, Mississauga, ON). Hybridization of Cy3 and Cy5 labelled cDNA probes to the arrays was carried out at 42 °C overnight (18 hr). And finally, washes were carried out at high stringency by soaking 59 the slides in a series of solutions containing sodium chloride and sodium citrate (SSC), and sodium dodecyl sulphate (SDS), followed by drying before scanning. All cDNA concentrations and the dye incorporation efficiency were determined with the NanoDrop® ND-1000 Spectrophotometer. The experiments were run three times in duplicate. Thus, for each cell line, a total of 6 slides were prepared including dye swap experiments. 3.2.3.2 Scanning and Data Processing Hybridized and washed arrays were scanned on an Axon 4000B dual laser scanner (555 nm/647 nm wavelengths). The voltage across the photo-multiplier tubes was adjusted until the intensity ratio of the red and green acquisition histograms was between 0.9 and 1.1. The fluorescence intensities for each spot on the array were determined using the GenePix Pro program (version 3.0) from Axon Instruments and the data obtained from the GenePix were further analyzed by loading in to GeneSpring version 7.0 software (Agilent Technologies, Palo Alto, CA). Array-specific data normalization was then done using the locally-weighted regression and smoothing scatter plots (LOWESS) procedure. All fluorescent signals above 100 units were included in the analysis. The fold changes of the samples over the reference of these genes were calculated. The P values of 0.05 and 0.01 were used to identify significant gene expression differences. To conduct functional annotation, only the significantly regulated genes were submitted to the Database for Annotation, Visualization and Integrated Discovery [DAVID] (http://david.abcc.ncifcrf.gov/). 60 3.2.4 RT-qPCR After the gene(s) with significant changes were identified and grouped, some genes of interest (antioxidant- and/or antiproliferation-related genes) were confirmed by RT-qPCR. Total RNA from control and pomiferin treated cells was used for carrying out one step RT-qPCR in 96-well plates using the ABI prism 7000 system (Applied Biosystems Ltd, ON). The primers for RT-qPCR were chosen from the literature (Table 3-1 a & Table 3-lb) and synthesized with the ABI DNA synthesizer 3900 (Applied Biosystems Ltd, ON). The Power SYBR® Green RT-PCR Reagents Kit containing the Power SYBR® Green RT-PCR Master Mix and TagMan® Reverse Transcription Reagents (Applied Biosystems Ltd, ON) were used following the manufacturer's protocol. In brief, the reaction mixture (total volume, 50 uL) containing 25 uL of master mix, 2 uL of template, 0.25 uL of reverse transcription reagents, 1.0 uL of RNase inhibitor, 1.5 uL of forward and reverse primers, respectively, and 18.75 uL of RNase free water. A no template control (NTC) and no amplification control (NAC) were run in parallel to assess the overall specificity of the reaction. In the NTC, RNA was replaced with RNase free water; and in the NAC, the primers were substituted with RNase free water. Then the plate was sealed and centrifuged briefly. The real-time cycler conditions were as follows: reverse transcription for 30 min at 48 °C followed by PCR initial activation step at 95 °C for 10 min, 40 cycles each of melting at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. Data were collected using an ABI Prism 7000 SDS analytical thermal cycler (Applied Biosystems Ltd, ON). A dissociation curve was generated for each sample to 61 Table 3-la. Primers* of MCF-7 genes used for RT-qPCR Gene Symbol Forward Primers Reverse Primers Size of products SOD (Cu/Zn) AGGGCATCATCAATTTCGAG TGCCTCTCTTCATCCTTTGG 196 SOD (Mn) GGAAGCCATCAAACGTGACT CTGATTTGGACAAGCAGCAA 202 HSPA1A GCCGAGAAGGACGAGTTTGA TCCGCTGATGATGGGGTTAC 69 FTL GCGTCTCCTGAAGATGCAAA AGGAAGTGAGTCTCCAGGAAGT 213 GPX3 TTGATGGGGAGGAGTACATCC AGACCGAATGGTGCAAGCTC 139 ULBP2 GTGGTGGACATACTTACAGAGC CTGCCCATCGAAACTGAACTG 150 CANX GCATCATGCCATCTCTGCTA GATACCCGTTTTGGGGTTTT 271 T0P2A AGTCATTCCACGAATAACCA TTCACACCATCTTCTTGAG 108 ID2 TGCAGCACCTCATCGACTACA TCTGGTGATGCAGGCTGACA 81 MCM7 GGAAATATCCCTCGTAGTATCAC CTGAGAGTAAACCCTGTACC 144 HMGB1 CGGGAGGAGCATAAGAAGAAGCACC CAATGGACAGGCCAGGATGTTCTCC 273 H2AFJ GGCAAAGTGACCATCGCTCA GTCAGGGTCATTTGCTCTTC 101 TXNRD1 CTTTTTCATTCCTGCTACTCTACC CTCTCTCCTTTTCCCTTTTCC 200 PSMA5 GCCCAGCAGCATTGAGAAAAT CTTGGGTCACACTCTCCACTG 164 BCAP31 GATGCCGTGCGCGAAATTC AAGCCAGCAATGTAGAGATTCC 131 18s rRNA AATTGACGGAAGGGCACCAC CGGACATCTAAGGGCATCACAG 305 * The primers of SODs were from Suzuki et al, (2002); HSPA1A from Ishida et al, (2002); FTL from Feng et al, (2005); GPX3, PSMA5 and BCAP31 from the Primer Bank provided by The-Massachusetts-General-Hospital (http://pga.mgh.harvard.edu/primerbank/index.html); CANX from York et al, (2005); TOP2A and MCM7 from Steinau et al, (2007); ID2 from Husson et al, (2002); HMGB2 from Corcoran et al, (2007); HMGB1 from Yoshihara et al, (2006); H2AFJ from Yao et al, (2006); TXNRD1 from Reichard et al, (2007); and 18s rRNA from Hammamieh et al, (2007). 62 Table 3-lb. Primers* of MDA-MB-435 genes used for RT-qPCR Gene Symbol Forward Primers Reverse Primers Size of products DICER1 TTCCTCACCAATGGGTCCTTT GCTTCAAGCAGTTCAACCTGAT 102 ABCE1 ACGAGAATTGCTATTGTCAACCA GCTCTGGGGTGTAACCTCTAT 120 CDC42SE2 TTCTGGTTGTGTTTCAACTGCT CCTTGGACTGCATTTGGTTCTG 181 TFE3 GGCCCTTTTGAAGGAACGG TGTCGTTAATGTTGAATCGCCT 77 MFN2 CTCTCGATGCAACTCTATCGTC CTTGGCAGTGACAAAGTGCTT 94 SI OOP ATGACGGAACTAGAGACAGCC AGGAAGCCTGGTAGCTCCTT 134 18s rRNA AATTGACGGAAGGGCACCAC CGGACATCTAAGGGCATCACAG 305 * All the primers are from the Primer Bank provided by The-Massachusetts-General-Hospital (http://pga.mgh.harvard.edu/primerbank/index.html), except for 18s rRNA from Hammamieh et al, (2007). 63 evaluate the specificity of the PCR product. The products were evaluated by using 1.5% agarose gels containing ethidium bromide (lOuL of 1.5% ethidium bromide in 30 mL of gel) with 1 X TBE running buffer to verify the product sizes. The experiments were run for three independent biological samples. For each experimental sample, the relative gene expression was determined using the comparative threshold cycle method, which consists of normalising the number of target gene copies to an endogenous reference gene (18S rRNA). The 2"AACT method was used for calculation of fold changes (Livak and Schmittgen, 2001; Pfaffl, 2001). 3.3 Results 3.3.1 Antiproliferative Activity of Pomiferin By using the SRB dye binding assay, it was found that the IC50 values for pomiferin in MCF-7 and MDA-MB-435 cells were 5.2 ± 0.90 and 5.4 ± 0.72 uM, respectively (Figure 3-2). For MCF-10A cells, the IC50 was greater than 20 uM. No higher concentration of pomiferin was tested. Thus, pomiferin had similar toxicity against the ER+ and ER- breast cancer cell lines, and was selectively toxic against cancer cells compared to the immortalized human breast epithelial cell. In addition to breast cancer, the antiproliferative activity and selectivity of pomiferin had also been shown in many other cancer types including six common human tumour cell lines (colon, breast, prostate, lung, melanoma, cholangiocarcinoma and kidney) with IC50 values between 1.32 and 5.14 uM, and with an IC50 of 123 uM in human primary cells (e.g. hepatocytes) (Svasti et al, 2005; Son et al, 2007). When compared to other isoflavones such as genistein, pomiferin shows greater activity. Assays with genistein have shown that the IC50 values for MCF-7 and MDA- 64 -4—MCF-7 -•---MDA-MB-435 -*--MCF-10A 5 10 15 20 Pomiferin (pM) Figure 3-2. The percentage of cell viability of MCF-7, MDA-MB-435 and MCF-10A after treated with pomiferin for 24 hr at the concentrations of 0.625, 1.25, 2.5, 5.0, 10.0 and 20.0 uM. 65 MB-231 cells (also ER-) are 10.2-32.5 uM (Fioravanti et al, 1998; He et al, 2002; Shim et al, 2007) and 12.2- 46.8 uM (Fioravanti et al, 1998; He et al, 2002), respectively. Genistein displays similar selectivity towards breast cancer cells (Shao et al, 1998a; Caetano et al, 2006). 3.3.2 Quality and Quantity ofRNA The most common technique for checking the quality and quantity of RNA is agarose gel electrophoresis (Figure 3-3) and UV spectrophotometry, respectively. However, these techniques may not be sensitive enough and are easily influenced by contaminants in the sample. The RNA 6000 Nano LabChip® kit (Agilent Technologies, Palo Alto, CA, USA) was used to evaluate the integrity of the RNA (Figure 3-4). Traditionally, the electropherogram can be evaluated with visual inspection. The quality of RNA is considered good if the electropherogram shows two distinct peaks, one for 28S and one for 18S, and with a flat baseline. However, methods that rely on visual inspection are subjective and have a tendency to vary over time. A more recent approach is to use the RNA Integrity Number (RIN) method, which is a standardization of RNA quality control. It is a software algorithm that has been developed to extract information about RNA sample integrity from Bioanalyzer electrophoretic trace, where ' 1' represents the most degraded RNA and '7-10' represents intact RNA (Schroeder et al, 2006; Strand et al, 2007). In our study, the RIN is 10 (Figure 3-4), which warrants the quality data generated from the downstream work. 66 Well Figure 3-3. Digital image under UV light of RNA purified from MDA-MB-435, MCF-7 and MCF-10A. Gel electrophoresis was run on a 1.5% of agarose (w/v) and stained with ethidium bromide. 67 nt '^^ ^^*^ mniA ^^^^ ^^^„ ^^^ ^^^— ^^^^^ -4JD» 2,000 - -2>0OO 1,000 — •*•* - U»0 -500 200 - — -200 25 - —»• -25 L 12 3 4 5 6 7 9 10 11 12 MDA-MB-435 MCF-7 Wi JU w. » » 35 « « SO 55 » J » 5 S « 50 55 S STs] Figure 3-4. Chromatograms of microcapillary electrophoresis from twelve RNA samples (four replicates from MDA-MB-435, MCF-7 and MCF-10A, respectively). All samples show clear bands of 28S and 18S (top panel). Three typical electropherograms of RNA from each cell line show a clearly visible 28S:18S rRNA peak ratio of 2.0 (bottom panel). 68 3.3.3 Microarray Analysis After the low expression level genes (<100) were deleted and normalized with the LOWESS method, it was found that 515 genes in MCF-7, 691 genes in MDA-MB-435, and 59 genes in MCF-10A cell lines were significantly regulated (P<0.05) after treatment with 5 uM pomiferin for 24 hr (Table 3-2). Since false positive results are common in cDNA microarrays, the more stringent method was applied (P<0.01). Using this new cut off, the number of affected genes was reduced to 94 in MCF-7, 80 up- and 14 down- regulated genes (gene symbols, names and fold changes are in Appendices la & lb); for MDA-MB-435, 105 genes including 101 up- and 4 down-regulated (gene symbols, names and fold changes are in Appendices Ila & lib); and for MCF-10A, only one gene (FTL) was up-regulated. Based on DAVID (http://david.abcc.ncifcrf.gov/home.jsp) Functional Annotation, many up-regulated genes in MCF-7 cells are antioxidant related (Table 3-3), including ACOX1, BLVRB, DHRS7, FADS3, FTL, GAPDH, GPX3, ME1, PAM, PHGDH, PRDX6, SEPX1, SOD1 and TXNRD1. Among them, FADS3, FTL, ME1, PAM, SEPX1 and SOD1 also have metal chelating activity. Other metal chelating genes are: DPP3, MBNL2, NPLOC4, SPIRE], WDFY2 and ZUBR1. Cell-cycle regulated genes including CAMK2G, DST, GADD45A, MAPRE3, YWHAC, YWHAG, PAM and UBB were up-regulated. In apoptosis related genes, BCAP31, HSPA1A, and STK17A were up-regulated; and BCL2L11, HMGB1, HMGB2 and TOP2A were down-regulated. Other genes related to angiogenesis and metastasis including CTSL, DST, MCFD2, and PHGDH were up- regulated. And last the proteasome related genes: ADRM1, PSMA5, PSMB4 and PSMD4 were up-regulated. 69 Table 3-2 The number of genes regulated by pomiferin in the three breast epithelial cell lines P<0.05 P<0.01 Up- Down- Up- Down- _ Regulated Regulated Total Regulated Regulated Total MCF-7 362 153 515 80 14 94 MDA-MB- 470 221 691 101 4 105 435 MCF-10A 49 10 59 1 0 1 70 Table 3-3. The significantly regulated antio xidant genes and other cancer related genes in MCF-7 cells after treatment with pomiferin (5uM)for24hr(p<0.01) Functions Genes Antioxidants ACOX1, BLVRB, DHRS7, FADS3, FTL, GAPDH, GPX3, ME1, PAM, PHGDH, PRDX6, SEPX1, SOD1 and TXNRD1 Metal chelating DPP3, MBNL2, NPLOC4, SPIRE1, WDFY2 and ZUBR1 Cell cycle CAMK2G, DST, GADD45A, MAPRE3, YWHAC, YWHAG, PAM and UBB Apoptosis BCAP31, HSPA1A, and STK17A; BCL2L11, HMGB1, HMGB2 and TOP2A ECM ~ CTSL, DST, MCFD2, and PHGDH Proteasome ADRM1, PSMA5, PSMB4 and PSMD4 71 Table 3-4. The significantly regulated met; chelating genes and other cancer related genes in MDA-MB-435 cells after treatment ith pomiferin (5 uM) for 24 hr (p<0.01) Functions Genes Metal chelating MTR, ZNF217, SPG7, ZNF228, MBNL2, ZNF714, GALNT12, OSBPL1A, POLR2K, ZNF117mdABCEl Cell cycle BCAT1, MFN2, SSSCA1 and ZAK Apoptosis ADORA2A, AGT, CDH13, and TNFAIP3 ECM CASK, DICER1, DPT, POSTN, ROB03, SNIP, SPG7 and SYK Proto-oncogene MAF and TFE3 Ras protein signal transduction CDH13, MFN2, RAPGEF6 and TBC1D2B post-translational modification CASK, DZIP3, FBXL6, and MTM1 72 For MDA-MB-435 cells, no antioxidant genes were found to be regulated significantly (P<0.01) (Table 3-4). A different set of metal chelating genes was up- regulated, which include MTR, ZNF217, SPG7, ZNF228, MBNL2, ZNF714, GALNT12, OSBPL1A, POLR2K, ZNFU7 and ABCE1. Cell cycle regulated genes, which include BCAT1, MFN2, SSSCA1 and ZAK, were up-regulated. All apoptosis associated genes were up- regulated including ADORA2A, AGT, CDH13, TNFAIP3 and ZAK. The genes related to angiogenesis and metastasis including CASK, DICER1, DPT, POSTN, ROB03, SNIP, SPG7 and SYK were up-regulated. Two proto-oncogenes, MAF and TFE3, were up-regulated. Genes involved in Ras protein signal transduction including CDH13, MFN2, RAPGEF6 and TBC1D2B were up-regulated. And last, the post-translational protein modification genes including DZIP3, FBXL6 and MTM1 were up-regulated. 3.3.4 RT-qPCR study Since false positive results are common in cDNA microarrays, some of the highly regulated genes that are related to the antioxidant and/or antiproliferative activities of pomiferin in MCF-7 and MDA-MB-435 cells were selected to confirm their expression changes via RT-qPCR assays using the same RNA samples that were used in the cDNA microarrays. Out of the fourteen genes tested in the MCF-7 cells, a good correlation was found for all the genes between the two techniques (Table 3-5). For MDA-MB-435 cells, five out of the six genes were confirmed (Table 3-6). A dissociation curve was generated for each gene to check the specificity of the product (see Appendices Ilia and Illb) for MCF-7 and MDA-MB-435, respectively. Also the size of each gene product is shown in Appendices IVa and IVb. 73 Table 3-5. The comparison of fold changes of selected genes between microarray and RT-qPCR techniques (MCF-7) Gene Symbol Gene Description Microarray RT-qPCR MnSOD Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) 1.56±0.43 2.0910.48 HSPA1A Heat shock 70kDa protein 1A 2.2911.19 2.3910.63 FTL Ferritin, light polypeptide 2.49±0.62 2.2010.90 GPX3 Glutathione peroxidase 3 (plasma) 3.65±1.11 4.5810.86 ULBP2 UL16 binding protein 2 2.95±1.07 3.4110.48 CANX Calnexin 1.72±0.64 1.8710.22 TXNRD1 Thioredoxin reductase 1 2.21+1.01 2.9610.46 PSMA5 Proteasome (prosome, macropain) subunit, alpha type, 5 2.03+0.78 1.7510.36 BCAP31 B-cell receptor-associated protein 31 1.98±0.48 2.4910.25 TOP2A Topoisomerase (DNA) II alpha 170kDa 0.5510.16 0.6610.05 ID2 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 0.5910.11 0.5510.06 MCM7 Minichromosome maintenance complex component 7 0.6310.21 0.4810.04 HMGB1 High-mobility group box 1 0.6410.26 0.59+0.08 H2AFJ H2A histone family, member J 0.6210.21 0.7110.11 74 Table 3-6. The comparison of fold changes of selected genes between microarray and RT-qPCR techniques (MDA-MB-435) Gene Symbol Gene Description Microarray RT-qPCR DICER1 Dicerl,Dcr-l homolog (Drosophila) 1.57±0.67 1.56±0.09 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 1.61+0.48 1.79±0.31 CDC42SE2 CDC42 small effector 2 1.69±0.79 1.24±0.09 TFE3 Transcription factor binding to IGHM enhancer 3 1.56+0.47 1.58+0.17 MFN2 Mitofusin2 1.69±0.73 1.64±0.66 SI OOP SI 00 calcium binding protein P 0.69±0.12 0.65±0.31 75 3.3.5 Selected pathways associated with MCF- 7 genes The pathway information was run with GeneSpring version 7.0 software. In MCF-7 cells, many signalling pathways appear to be regulated by pomiferin treatment, including cell cycle regulators, ECM-receptor-interaction, the MAPK signalling pathway, the PPAR signalling pathway, the TGF-P signalling pathway, the VEGF signalling pathway, and many others (Details in Appendix V). Two of the major pathways, cell cycle regulation and TGF-p signalling pathway, are discussed here. 3.3.5.1 TGF-P Signalling Pathway From the microarray data, pomiferin down-regulates the expressions of BMP-7, ID2 and THBS1 in the TGF-p signalling pathway (Figure 3-5). These genes are involved in regulation of cell cycle, proliferation and differentiation. TGF-P predominantly transmits signals through serine/threonine receptor kinases and cytoplasmic proteins called Smads. The TGF-P signalling pathway is divided into the TGF-P and the BMP branches, based on their downstream R-Smad pathways (Miyazawa et ah, 2002). TGF-P phosphorylates and activates Smad2 and Smad3, whereas the downstream Smads of BMP are Smadl, Smad5, and Smad8. The activated Smad proteins from both pathways translocate into the nucleus where they bind to DNA and directly regulate gene expression. These pathways are responsible for cell proliferation, apoptosis and/or differentiation (Ten Dijke et al, 2002; Siegel and Massague, 2003). The BMP7 gene is frequently found to be overexpressed in breast cancer cell lines and tumour samples and is associated with a high histologic grade of tumours (Alarmo et al, 2006). The ablation of the type II BMP receptors in breast cancer cells, on the other hand, leads to growth inhibition (Pouliot et al, 2003). The direct targets of BMP protein 76 QsteoJjfcat differentia toi, nsarogeMSis, vtatral mesoderm spec lficaftc Angugeseas, «rt ace Bute rostra JMQ£6fl£Si&, imiminosupiiiMaon, apoplosis lMncuon ( Apoptrais J Gl arrest f ceUCjele J Figure 3-5. Part of the TGF-P signalling pathway (http://www.genome.ad.jp/kegg/pathway/hsa/hsa04350.html). BMP, ID and THBS1 are downregulated (•); and BMP and ID change at pO.Ol (#). 77 are limited (for example, Id, Vent-2 and Smad6), and Id proteins are one of the most crucial targets of BMPs that are responsible for exhibition of the biological activities of BMPs (Miyazono and Miyazawa, 2002). In contrast, a large number of target genes are activated by TGF-P including c-myc and genes encoding plasminogen activator inhibitor- 1 (PAI-1), type I collagen, cell cycle regulators pi5 and p21, the junB transcription factor, and Smad7 (Miyazono and Miyazawa, 2002). The protein encoded by ID2 belongs to the inhibitor of DNA binding (ID) family. Id proteins act as negative regulators of cell differentiation and positive regulators of cell proliferation (Norton et al, 1998; Yokota and Mori, 2002; Ruzinova and Benezra, 2003), and play critical roles in animal development and cancer (Yokota and Mori, 2002; Ruzinova and Benezra, 2003; Sikder et al, 2003). Overexpression of Id2 stimulates cell proliferation in breast cancer cells (Itahana et al., 2003) and lack of Id2 leads to a proliferation defect in the early stage of pregnancy in mice (Mori et al., 2000). Specifically, Id2 is found to play a crucial role in mammary gland development (de Candia et al, 2004). In this study, we found that Id2 was down-regulated in microarray and confirmed by RT-qPCR. Id proteins have a helix-loop-helix (HLH) dimerization domain, which binds to ubiquitously expressed transcription factors containing the basic HLH (bHLH) domain. The bHLH transcription factors interact with tissue-specific bHLH transcription factors, and these complexes activate the transcription of genes containing an E-box in their promoter regions, which positively regulates differentiation. In contrast to bHLH transcription factors, Id proteins lack the basic region responsible for binding to DNA— dominant negative antagonists (Miyazawa et al, 2002). Id proteins inhibit the 78 transcriptional activity of E-proteins such as the products of the E2A gene, El 2 and E47, which positively regulate the cell cycle regulatory genes p\5Ink4b, pl6M4a, and p2\Cipl. Down-regulation of Id2 can block the cell cycle by relief of E-protein activity and down- regulation of BMP7 decreases Id2 expression and thus would provide a synergistic effect on E-protein activity (Kowanetz et al, 2004). The role of THBS1 in tumour progression remains controversial. THBS1 protein has been considered an inhibitor of tumour progression in some cancers (Grossfeld et al, 1997; Fontanini et al, 1999). In contrast, it has also been considered a stimulator in other cancers (Tuszynski and Nicosia, 1994; Yamashita et al, 1998). The slight down- regulation of THBS1 may activate TGF-P pathway and be indirectly involved in Gl arrest (Figure 3-5). TGF-p induces transcription of CDK inhibitors such as p21 and pl5Ink4B (Ten Dijke et al, 2002) and down-regulates c-MYC (Alexandrow and Moses, 1995). Thus, activation of TGF-P by THBS1 may block cell cycle progression at the early Gl phase. In addition, c-MYC also binds to E-box motifs in the ID2 promoter and supports ID2 expression (Lasorella et al., 2000). Thus, the downregulation of c-MYC by TGF-P may lead to 1D2 inhibition (Siegel and Massague, 2003). The activation of BMP, on the other hand, results in suppression of the nuclear accumulation of Smad3 by TGF-P stimulation (Wang and Hirschberg, 2004). Thus, TGF-P and BMP branches work co- ordinately to regulate cell proliferation and differentiation. 3.3.5.2 Cell cycle regulation Pomiferin upregulates GADD45a and YWHAG and downregulates MCM6, MCM7, PCNA and CCNA2. These genes are involved in G0/G1, Gl/S and/or G2/M phases (Figure 3-6). 79 CELLCYCLE Growth factor Growth factor DNA damage checkpoint withdrawal / \ I I 1 / V [~ Smcl | Cohesin B«M B«J>3 Espl Mp;l ^\__+! Apoptosis J OTTO MAPK ' - signaling Bt*Rl •«4 pathway H*dl Hal? APCJC Cd«20 | 14-3-3 | Utrifljiitin mediated proteolysis i R-point ._ i (START)' "~ mm l ' l Cdhl ORC MCM '-P +p/ DNA eta I DW4 But.2 | 11 MEN I I ORC (Origin MCM (Mini-Chromosome i DNAO DNA biosynthesiis j Recognition Complex) Maintenance) complex S-phase proteins G2 04U0hsa 12KEI02 Gl M 80 Figure 3-6. The cycle cell regulation pathway (http://www.genome.ad.jp/kegg/pathway/hsa/hsa04110.html). A number of genes are either downregulated (MCM7, MCM7, PCNA and CCNA2) or upregulated (GADD45a and YWHAG); and expression changes of MCM7, MCM7, GADD45a and YWHAG are atpO.Ol (*). 81 MCM6 and MCM7 encode the highly conserved mini-chromosome maintenance proteins (MCM). The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre-RC) and is often called a licensing system. For dividing cells, once cells exit from metaphase, the replication licensing system becomes activated, and remains active throughout most of Gl but is inactivated as cells approach S phase. Generally, MCM proteins are not expressed in differentiated somatic cells that have withdrawn from the cell cycle (GO), but are highly expressed in malignant human cancers cells and pre-cancerous cells undergoing malignant transformation (Williams et al, 1998; Stoeber et al, 1999; Tan et al, 2001; Lei, 2005). The down- regulation of MCM6 and MCM7 may play a significant role in curtailing mitotic initiation. Anti-MCM small molecules that selectively induce cancer cell-specific apoptosis (Shreeram et al, 2002; Shreeram and Blow, 2003) have been under clinical investigation. Also, G2/M phase related genes, GADD45a and YWHAG, are also upregulated by pomiferin treatment. Both Gadd45 and 14-3-3cr {YWHAG encoded protein) simultaneously inhibit Cdc2 (Figure 3-6). The mechanisms of this inhibition, however, are different. The protein 14-3-3c7 can bind to Cdc2/cyclin Bl and Cdc25 and sequester it in the cytoplasm (Taylor and Stark, 2001). The effect of Gadd45 on the G2/M transition may be due to its ability to dissociate complexes of Cdc2 and cyclin Bl (Zhan et al, 1999; Jin et al, 2000; Taylor and Stark, 2001). Both Gadd45 and 14-3-3CT may play additive or synergistic roles in G2 arrest. In addition, the mRNA level of CCNA2 (cyclin A2), which promotes cell cycle progression, is slightly downregulated. All these effects may contribute the G2/M inhibition. The down-regulation of PCNA, however, shuts off 82 the signal from Gadd45. Thus, Gadd45 may not be involved in Gl/S transition. The Gl/S phase inhibition by pomiferin may be through TGF-P pathway as it was stated in Section 3.3.5.1. Normally, p53 regulates Gadd45 and 14-3-3cr activity (Taylor and Stark, 2001). However, the mutation of p53 is common in all cancers including breast cancer (Lai et al, 2002; Borresen-Dale, 2003), and its mutation is associated with poor prognosis (Pharoah et al, 1999; Andersson et al, 2005; Royds and Iacopetta, 2006) and resistance to common chemotherapy drugs (Linn et al, 1997; Kandioler-Eckersberger et al, 2000; Geisler et al, 2001). Pomiferin may substitute the function of p53 in regulating Gadd45 and 14-3-3G activity, which has promising implications in breast cancer treatment. Overall, pomiferin regulates many cell cycle related genes, including MCM6 and MCM7 associating with cell cycle initiation (G0/G1), TGF-p* pathway genes regulating Gl/S transition, and Gadd45 and 14-3-3a associating with G2/M phase inhibition. 3.3.6 The functions of the genes in MCF-7 confirmed by RT-qPCR Besides the ID2 and MCM7 genes that were discussed in the previous sections, the major functions of 12 other genes and their related proteins will be briefly summarized. 3.3.6.1 MnSOD In our study, by using two sets of specific primers for Cu/ZnSOD and MnSOD (Appendix V), it was found that only MnSOD gene was significantly up-regulated. MnSOD has a pivotal role in neutralizing superoxide radicals, and more importantly, MnSOD is one of the most effective antioxidant enzymes that has anti-tumour activity (Valko et al, 2006). Up-regulation of MnSOD can lead to changes in the 83 superoxide/hydrogen peroxide balance and this would alter the redox state that then affects signal transduction pathways modulating cell proliferation. Many lines of evidence have demonstrated a role for MnSOD in inhibition of cancer cells including MCF-7 cells (Li et at, 1995; Chuang et at, 2007). Many cancer cells express low levels of MnSOD activity (Oberley and Oberley, 1994; Hitchler et at, 2006) and re-expression of MnSOD by cDNA transfection can lead to inhibition of cell transformation (St Clair et at, 1992; Hitchler et at, 2006). In MCF-7 cells, Li et at (1998) found that up-regulation of MnSOD led to tumour suppression via modulation of AP-1 and NF-kB. 3.3.6.2 GPX3 The GPX3 gene product belongs to the glutathione peroxidase (GPX) family, which functions in the detoxification of hydrogen peroxide, lipid peroxides and organic hydroperoxide. At least five isoforms of GPX have been found. GPX3 is our focus and GPX1 is the most studied. In general, GPX play a dual role in controlling cell growth and apoptosis. An increase in GPX1 activity in normal cells may have antioxidant and anti-inflammatory activities. However, when cells are transformed into a precancerous state, increased GPX1 activity could prevent hydrogen peroxide-mediated apoptosis and become procarcinogenic (Lei et at, 2007). From this point of view, GPX1 and MnSOD have opposite effects. Many other studies, however, support the promoting role in apoptosis. GPX1 expression was found to be repressed in MCF-7 cells (Esworthy et at, 1995; Policastro et at, 2004) and overexpresssion of GPX 1 inhibits NF-KB activation in MCF- 7 cells (Li et at, 2001; Li and Engelhardt, 2006). Also, the effect of GPX1 in apoptosis is dependent on the balance of ROS and RNS pathways. If the ROS pathway is dominant, 84 the activity of GPX1 tends to protect the cell from apoptosis, whereas if GPX1 mediates mainly through the RNS pathway, apoptosis occurs (Lei et al, 2007). The role of GPX3 mRNA and its protein, on the other hand, seems to exclusively promote apoptosis. In Barrett's esophageal mucosa and colorectal adenomas (Mork et al, 2000; Mork et al, 2003), the GPX3 mRNA level is decreased when compared to normal cells and inactivation increases significantly with progression toward neoplasia (Lee et al, 2005c). Also, the down-regulation of GPX3 expression in prostate cancer was associated with higher rate of post-prostatectomy metastasis and forced expression of GPX3 suppressed tumour growth and metastasis both in vitro and in vivo (Yu et al, 2007). Thus, the proapoptotic effect of GPX3 is beyond its detoxification of hydrogen peroxide. 3.3.6.3 TXNRD1 TXNRD1 encodes a member of the family of oxidoreductases. This protein reduces thioredoxins as well as other substrates, and plays a role in selenium metabolism and protection against oxidative stress. Most of the functions of TXNRD1 are from its reduced product, thioredoxin (TRX). TRX functions as more than simply an antioxidant. It regulates cell growth by binding to signalling molecules such as apoptosis signal- regulating kinase-1 (ASK-1) and TRX-interacting protein (Txnip). The molecular interplay between TRX, ASK-1, and Txnip potentially influences cell growth and survival. Specifically, TRX can bind to the amino-terminal portion of ASK-1, inhibiting the kinase activity of ASK-1 and ultimately protecting cells from apoptosis (Yoshioka et al, 2006). 85 It has also been found that TRX has a different role in regulating NF-KB (Hirota et ah, 1999). TRX was found to inhibit NF-KB activity in cytoplasm and upregulate the ability of NF-KB to bind to DNA in the nucleus. TRX is able to translocate from the cytosol to the nucleus in response to further oxidative stress to regulate gene expression through Ref-1 (Valko et ah, 2006). Overall, up-regulated TXNRD1 not only protects against oxidative injury, but also regulates cell survival signals through various signal transduction pathways such as NF-KB and ASK-1. 3.3.6.4 FTL FTL is the only gene that was significantly up-regulated both in MCF-7 and MCF-10A cells. FTL encodes the light polypeptide chain of ferritin. The critical role of ferritin in cells and organisms is to maintain iron homeostasis, since free iron is highly toxic when present in excess. The free iron (Fe ) is ready to participate in the generation of ROS through the Fenton reaction. In cells in which the transport of ferritin to the nucleus was blocked with wheat germ agglutinin, protection of DNA against oxidant damage was abolished (Thompson et ah, 2002). Ferritin levels in tumour tissue vary and are disease-specific. For example, the ferritin level increases in colon cancer (Vaughn et ah, 1987), testicular seminoma (Cohen et ah, 1984), and breast cancer (Weinstein et ah, 1989; Guner et ah, 1992), but decreases in liver cancer (Zhou et ah, 1987), and carcinoma of the urothelium (Vet et ah, 1997). Thus, the increase in ferritin may aid its ability to sequester free iron but the potential role in cancer related effects is not clear. 86 3.3.6.5 HSPA1A HSPA1A encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. Hsp70 has dual effects on cancer cells. It promotes cancer development by suppression of various anticancer mechanisms, such as apoptosis and by facilitating expression of metastatic genes; and facilitates tumour rejection by the immune system. Elevation of Hsp70 has been shown to enhance survival of cells and prevent apoptosis in a wide spectrum of human cancers (Creagh et at, 2000; Jolly and Morimoto, 2000; Nylandsted et at, 2000; Ciocca and Calderwood, 2005; Calderwood et at, 2006). Several laboratories have provided evidence indicating that Hsp70 can inhibit JNK activity and thereby inhibit JNK-mediated apoptosis (Gabai et at, 1997; Gabai et at, 2000; Park et at, 2001). However, the plasma membrane-bound Hsp70 has been found as a tumour-specific recognition structure for pre-activated natural killer (NK) cells. For example, after incubation with the Hsp70-peptide analogue and proinflammatory cytokines, NK cells acquire migratory capacity and efficiently kill Hsp70 membrane- positive tumour cells (Sherman and Multhoff, 2007). Thus the up-regulated HSPA1A gene by pomiferin may inhibit apoptosis in MCF-7 cells on one hand and enhance the immunity on the other hand. 3.3.6.6 HMGB1 HMGB1 encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. Increased HMGB1 expression was found in primary human breast carcinomas compared with normal tissues, and also HMGB1 mRNA levels were inversely correlated with apoptotic activity (Brezniceanu et 87 at, 2003). Co-expression of RAGE (the receptor for advanced glycation end product) and HMGB1 is correlated with metastasis and poor survival prognosis for patients with prostate and colorectal cancers (Kuniyasu et at, 2003a; Kuniyasu et at, 2003b). Blockage of HMGB1 and RAGE signalling led to diminished tumour growth (Taguchi et at, 2000) and the reduced expression of HMGB1 is in favour of TRAIL-, Casp-8-, and Bax-induced apoptosis (Brezniceanu et at, 2003). It is also interesting to notice that breast cancer response to endocrine therapy does not always correlate with the quantity of expressed steroid hormone receptor (Flohr et at, 2001). This lack of correlation may be due to mediation of estrogen receptor-binding to EREs (estrogen-responsive elements) of target genes by HMGB1 (Flohr et at, 2001). 3.3.6.7 TOP2A TOP2A encodes a DNA topoisomerase a (TopoIIa), an enzyme that controls and alters the topologic states of DNA during transcription. TopoIIa. carries out vital biological functions during the segregation and condensation of the replicated chromosomes and its expression is cell cycle-dependent (peaking at the G2/M phase of the cell cycle and declining to a minimum at the end of mitosis) (Li and Liu, 2001). TopoIIa is of particular interest with respect to cancer therapeutics, because it is not only vital in the segregation of newly replicated chromosome pairs, in chromosome condensation, in forming chromosome scaffolds, and in altering DNA superhelicity (Champoux, 2001; Li and Liu, 2001), but even more importantly, it is the molecular target for a large group of clinically relevant anti-cancer drugs termed topoll-inhibitors, e.g. the anthracyclines, actinomycin and many others (Li and Liu, 2001; Ju et at, 2006). 88 TOP2A, not TOP2B, is located adjacent to the HER-2 oncogene at the chromosome location 17ql2-q21 (Jarvinen and Liu, 2006; Arriola et ah, 2008). Its amplification has been reported to be present in around 50% of HER-2 over-expressing tumours, when comparing to HER-2 normal tumours with less than 5% (Di Leo et ah, 2002; Mano et ah, 2007). Overexpression of HER-2 by breast cancer cells results in greater cell survival, proliferation, and resistance to apoptosis (Valabrega et ah, 2007), and patients with HER-2-positive disease have shorter survival times and have a higher risk for disease recurrence or progression (Dahabreh et ah, 2008). The administration of HER-2 inhibitor, Herceptin™, has been shown to greatly increase survival time and inhibit disease progression. However, Herceptin has many the side effects that include advanced congestive heart failure and early central neverous system metastasis (Bria et ah, 2008; Dahabreh et ah, 2008). Also, not all HER-2 overexpressing tumours are sensitive to Herceptin™ (Harkins and Geyer, 2007; Ali et ah, 2008). In vitro study has shown that co-administration of Herceptin™ and a TopoIIa inhibitor, such as anthracyclines, has synergistic effects on breast cancer cell lines (Jarvinen et ah, 2000; Jarvinen and Liu, 2006). Thus, co-administration of Herceptin™ with pomiferin might have a better outcome, particularly in HER-2 overexpressing tumours. 3.3.6.8 PSMA5 PSMA5 encodes the proteasome 5a, which is part of the multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The proteasome is a massive multicatalytic protease complex that is responsible for degrading most of the cellular proteins. Like Hsp, proteasome has dual roles in prevention of apoptosis and promoting immune response. On one hand, the ubiquitin/proteasome-dependent 89 degradation pathway plays an essential role in up-regulation of cell proliferation and down-regulation of cell death (Lopes et al, 1997; An et al, 1998). On the other hand, hydrolysis of proteins by proteasomes is the key step in the generation of most antigenic peptides (Kloetzel, 2004). A fraction of the peptides produced by proteasomes escape destruction in the cytosol and are transported by the transporter associated with antigen processing (TAP) into the endoplasmic reticulum, where these peptides can bind to major histocompatibility complex (MHC) class I molecules (Rock et al, 2004) and then are delivered to the cell surface for presentation to cytotoxic CD8+ T cells (Garbi et al, 2005; Tao efa/., 2008). 3.3.6.9 CANX and BCAP31 Considering the close functional relationship between calnexin and Bap31 proteins, CANX and BCAP31 genes are discussed together. CANX encodes a member of the calnexin family of molecular chaperones and BCAP31 encodes B-cell receptor- associated protein 31 (Bap31). Calnexin has been reported to participate in the mediation of apoptotic processes triggered by prolonged endoplasmic reticulum stresses either through its caspase-mediated cleavage (Takizawa et al, 2004) or through its association with the endoplasmic reticulum resident caspase-8 substrate, Bap31 (Muzio et al, 1997; Zuppini et al, 2002; Delom et al, 2007). The cytoplasmic domain of the endoplasmic reticulum chaperone calnexin, as a scaffolding protein, promotes Bap31 cytosolic domain cleavage by caspase-8 and generates the proapoptotic p20 (Delom et al, 2007). P20 can cause severe endoplasmic reticulum stress by inducing Ca2+ release and result in the activation of Drpl-dependent mitochondrial fission (Breckenridge et al, 2003). 90 Zuppini et al (2002) have found that calnexin-deficient cells are resistant to endoplasmic reticulum stress-induced apoptosis in leukemic a T-cell line. In this study, the depletion of calnexin had no effect on caspase 8 cleavage, cytochrome c release or Ca2+ level, but Bap31 was significantly inhibited. Immunoprecipitation experiments have revealed that Bap31 forms complexes with calnexin (Zuppini et al, 2002). It has been proposed that calnexin, Bap31, procaspase 8 and other factors form a complex in apoptosis signal transduction (Ng et al, 1997) just like the plasma membrane apoptotic receptors Fas and TNFR-1 (Nagata, 1997). In MCF-7 cells, it has also been found that calnexin regulates endoplasmic reticulum stress-mediated apoptosis dependent on the binding to Bap31 (Delom et al, 2007). Thus, the simultaneously up-regulated CANXand BCAP31 may play a major role in this apoptosis pathway. 3.3.6.10 ULBP The ULBP gene family consists of 10 members, six of which, including ULBP2, encode potentially functional glycoproteins, ULBPs. ULBPs as ligands of NKG2D are a novel family of MHC class I-related molecules that bind to, and activate, human NK cells for cytotoxicity and cytokine production. Normally, the expressions of ULBPs are low or absent but can be induced by carcinogens and genotoxic stress. ULBP expression is also a marker of transformed cells for destruction by immune effector cells (Vivier et al, 2002). ULBPs are frequently expressed by tumour cells (Friese et al, 2003; Bacon et al, 2004; Cao and He, 2004; Conejo-Garcia et al, 2004; Poggi et al, 2004; Raffaghello et al, 2004; Sutherland et al, 2006). The expression of ULBPs appears to stimulate anti- tumour immune responses mediated by CD8+ T cells and NK cells (Bacon et al, 2004; Cao and He, 2004; Sutherland et al, 2006). Up-regulation of ULBP ligands is also 91 associated with induction of cell differentiation (Rohner et al., 2007) and correlates with improved survival in cancer patients (Conejo-Garcia et al, 2004; Poggi et al, 2004; Cao et al, 2007). 3.3.6.11 H2AFJ The H2AFJ gene encodes a member of the histone H2A super family. The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The over- expression of H2AFJ has been associated with cancer progression both in breast cancer (Yao et al, 2006) and melanoma (de Wit et al, 2005). Thus, the down-regulation of H2AFJ might inhibit or even reverse malignancy. 3.3.7 Biological functions and pathways associated with MDA-MB-435 genes The biological functions and their pathway information of the regulated genes in MDA-MB-435 cells are listed in Appendix VI, which are completely different from those in MCF-7 cells. It is surprisingly found that most of the ABC transporter genes in MDA- MB-435 cells are up-regulated (except for ABCA11) when comparing pomiferin treatment and control. Some of the ABC transporter genes are involved in the transport of various molecules across plasma membranes and intracellular membranes, and others may promote immune response and have metal chelating activity (see Section 3.3.8.2 ABCE1). Two other big differences between MCF-7 and MDA-MB-435 cells are: many genes are associated with calcium signalling and mitochondrial functions, which are not found in MCF-7 cells (Appendix VI). 92 3.3.8 The functions of the MDA-MB-435 genes confirmed by RT-qPCR Five of the six selected genes were confirmed with RT-qPCR, which are DICER], ABCE1, TFE3, MFN2 and SWOP. Only SI OOP of these five are downregulated. The functions of these genes are discussed here. 3.3.8.1 DICER1 DICER 1 expression has been found down-regulated in various cancers, and is associated with tumour progression and metastasis (Blenkiron et al, 2007; Chiosea et al, 2007; Kumar et al, 2007; Zheng et al, 2007) and low survival potential (Karube et al, 2005; Chiosea et al, 2006). Many functions of DICER1 are assoicted with regulation of microRNA (miRNA) processing and expression. The protein, Dicer, encoded by DICER1 regulates microRNA (miRNA) processing. Mature miRNAs are a class of small noncoding 19- to 25-nucleotide long molecules cleaved from 70- to 100-nucleotide hairpin pre-miRNA precursors (Bartel, 2004). The precursor is cleaved sequentially by a nucleic RNase III endonuclease, Drosha, and then by a cytoplasmic RNase III endonuclease, Dicer, into an average 22- nucleotide miRNA duplex: one strand (miRNA) of the short-lived duplex is degraded, whereas the other strand serves as mature miRNA (Iorio et al, 2005; Chiosea et al, 2006). Many studies have shown that both human and mouse cancers show a reduction of mature miRNA levels compared with normal tissues (Johnson et al, 2005; Lu et al, 2005; Kumar et al, 2007). The decreased miRNA processing causes a marked change in the transformed phenotype of cancer cells (Kumar et al, 2007). This may also explain that miRNAs are differentially expressed in breast tumour and normal breast tissues with dyregulated DICER1 (Iorio et al, 2005; Mattie et al, 2006; Volinia et al, 2006; 93 Blenkiron et al, 2007), and up-regulation ofDICERl is associated with the sensitivity to RNA interference-based therapy (Chiosea et al, 2006). 3.3.8.2 ABCE1 Most of the ABC family genes encode large transport proteins that contain 6-17 transmembrane domains (Dong et al, 2004). Generally, ABC proteins are transporters and are involved in the transport of molecules across plasma membranes and intracellular membranes (Childs and Ling, 1994; Dean and Allikmets, 1995), and associated with multi-drug resistance. The protein encoded by ABCE1, however, only contains only nucleotide binding domains and no transmemebrane domain, thus is not likely to be a transporter (Zhao et al, 2004). Another uniqueness of ABCE1 is that it has two potential Fe-S metal-binding domains (Kerr, 2004), showing metal chelating effects. Also, ABCE1 may reduce the oxidative damage in the in vitro studies (Darrouzet et al, 2002; Shinkarev et al, 2002). In addition, ABCE1 has been found to promote immune response to cancer cells (Shichijo et al, 2005) but, on the other hand, inhibit classic apoptosis pathway (Chen et al, 2006). 3.3.8.3 TFE3 TFE3 is a downstream player of TGF-p pathway, regulating cell proliferation and differentiation. It acts synergistically with the Smad3 and Smad4 complex to activate Smad7 transcription (Grinberg and Kerppola, 2003). TFE3 has been found to induce cell differentiation, decrease cell proliferation and increase apoptosis (Zanocco-Marani et al, 2006). Down-regulated TFE3 is associated with ovarian tumour progression when compared to normal ovarian tissue (Sunde et al, 2006) and is also associated with renal 94 carcinomas (Argani et al, 2003; Mathur et al, 2003; Argani, 2006). The up-regulation of TFE3 may be related to the antiproliferative activity of pomiferin. 3.3.8.4 MFN2 Mitochondria provide a myriad of functions to the cell, including energy production, calcium buffering, and regulation of apoptosis. Mitochondria change their shapes dynamically mainly through fission and fusion. Dynamin-related GTPases have been shown to mediate re-modeling of mitochondrial membranes during these processes (Nakamura et al, 2006). Normally, Mfn2, one of the GTPases, activated by Bax/Bak promotes mitochondrial fusion (Chen and Chan, 2005; Neuspiel et al, 2005; Conradt, 2006; Karbowski et al, 2006). However, overexpression of Mfn2 causes mitochondrial dysfunction and apoptosis (Santel and Fuller, 2001; Rojo et al, 2002; Huang et al, 2007). When Mfn2 was overexpressed in rat liver cells, mitochondrial morphology drastically changed, forming mitochondrial clusters, and clustered mitochondria released cytochrome c and underwent caspase-mediated apoptosis (Huang et al, 2007). By transfection of the MFN2 gene into MCF-7 cells, apoptosis was increased and proliferation was inhibited (Xia et al, 2007a; Xia et al, 2007b; Xia et al, 2008). In a related study, not only did MFN2 inhibit proliferation of MCF-7 cells, but also restored the chemosensitivity of the cells to camptothecin (Xia et al, 2007a; Xia et al, 2008). MFN2 is also a regulator of the Ras signalling pathway (Chen et al, 2004; Fang et al, 2007). Other activities of MFN2 include reduction in obesity (Bach et al, 2003) and decreased hypertension (Chen et al, 2004; Guo et al, 2007). The up-regulated MFN2 in our study may result in mitochondrial stress and cytochrome c release, in turn, promoting 95 apoptosis, and may also reduce cell proliferation through inhibiting Ras signalling pathway. 3.3.8.5 SWOP SI OOP is expressed in normal and cancer tissues. The protein encoded by SI OOP belongs to the EF-hand superfamily of Ca2+ binding proteins that mediate Ca2+ dependent signal transduction pathways involved in the regulation of cell cycle, growth, differentiation and metabolism (Donato, 2001). The high mRNA levels of SI OOP in normal tissues, however, is limited to the placenta and esophagus (Parkkila et al, 2008) and may play a role in normal development (Sato and Hitomi, 2002). On the other hand, the mRNA levels and protein of SI OOP are highly expressed in various cancers, such as lung cancer (Diederichs et al, 2004), oral squamous cell carcinoma (Li et al, 2004), prostate cancer (Mousses et al, 2002; Basu et al, 2008), breast cancer (Guerreiro Da Silva et al, 2000; Mackay et al, 2003), cervical cancer (Chao et al, 2006), pancreatic cancer (Arumugam et al, 2005; Ohuchida et al, 2006) and colon cancer (Fuentes et al, 2007). It has been found that SI OOP is a ligand of RAGE. It binds RAGE receptor (Arumugam et al, 2005) and activates MAPK and the NF-kB signalling pathway (Arumugam et al, 2005; Fuentes et al, 2007). Increased levels of SI OOP expression have also been found to correlate with poor survival rate (Beer et al, 2002; Wang et al, 2006; Surowiak et al, 2007), tumour progression (Bertram et al, 1998), metastasis (Wang et al, 2006) and drug resistance (Bertram et al, 1998; Arumugam et al, 2005); and blocking SI OOP expression significantly reduces the invasion of tumour cells and improves survival potential (Arumugam et al, 2005; Arumugam et al, 2006). SI OOP protein has been considered a 96 potential biomarker of cancer due to its frequent overexpression in different types of tumour tissues (Ohuchida et al, 2006; Higgins et al, 2007; Basu et al, 2008) and interventions that block SI OOP may provide an important target (Arumugam et al, 2006). 3.3.9 Pomiferin and Melanoma Surprisely, the MDA-MB-435 breast cancer cell line has recently been determined to be a derivative of the M14 melanoma cell line (Rae et al., 2007)). If this holds true, pomiferin displays similar activities in both estrogen receptor positive breast cancer cells and Ml4 melanoma cells. In addition to pomiferin, other isoflavones also show antiproliferative effects on melanoma cells (Wang et al, 2002; Yu et al., 2006); however the IC50 values are not as low as that of pomiferin. The above RT-qPCR confirmed genes in MDA-MB-435 cells play an important role in disease progression and metastesis of melanoma. Particularly, DICER1 is down- regulated in most of the patients with melanoma, resulting in the abnormalities of miRN (Zhang et al, 2006); and the overexpression of SIOOP has been found in many types of melanoma (Bertram et al., 1998; Andres et al,. 2008; Oberholzer et al, 2008). Upregulation of S100P is a strong prognostic factor (Andres et al., 2008) and specific biomarker of metastases (Oberholzer et al, 2008), as well as is associated with chemo- resistant status (Bertram et al., 1998). Thus the upregulation of DICER1 and downregulation of SWOP by pomiferin may play roles in its antiproliferative activity. 3.4 Discussion Pomiferin has a stronger antiproliferative effect in both ER+ and ER- cells than other isoflavones such as genistein. This high activity may be associated with the addition of a prenylated chain (Epifano et al, 2007) when compared to soy isoflavones. 97 By using microarray technology, it was found that the genes involved in the antiproliferative activity of pomiferin in MCF-7 and MDA-MB-435 are completely different. RT-qPCR was also used to confirm some of the antioxidant and cancer related genes in both ER+ and ER- breast cancer cells. All the fourteen genes in MCF-7 cells and five of the six selected genes in MDA-MB-435 cells were confirmed. In MCF-7 cells, all the selected antioxidant related genes (MnSOD, GPX3, TXNRD1 and FTL) were up-regulated. MnSOD, which converts superoxide into hydrogen peroxide, has been found to have antiproliferative activity in MCF-7 cells (Li et al, 1995). Although no research on GPX3 has been done in MCF-7 cells, the proapoptotic function of GPX3 in many other cancer cells (Lee et al., 2005c; Yu et al., 2007) implies that its up-regulation may have similar effect in MCF-7 cells. TXNRD1 tends to be a ROS scavenger, regulates cell survival signals and inhibits apoptosis. The overall effects of those antioxidant enzymes seem to be antiproliferation. FTL was up- regulated in both MCF-7 and MCF-10A cells possibly to maintain iron homeostasis although its anticancer related function, if any, is not clear. Two genes including HSPA1A and PSMA5 play dual roles in cancer cells. They prevent apoptosis and boost immune responses by providing cancer antigens. The latter effect may not be relevant to the in vitro assay, but could play a role in the in vivo setting. Other up-regulated genes include ULPB2, CANX and BCAP31. ULBP2 proteins activate NK cells for cytotoxicity and cytokine production; and up-regulation of ULBP2 is associated with improved survival (Cao et al, 2007). Up-regulation of CANX and BCAP31 is associated with endoplasmic reticulum stress. Proteins, calnexin and Bap31, form a complex similar to Fas/TNFR-1 (Zuppini et al, 2002) and initiate endoplasmic reticulum stress associated 98 apoptosis. Among the down-regulated genes were: TOP2A, HMGB1, H2AFJ, ID2 and MCM7. Overexpression of TOP2A has been found in many breast cancer cases, particularly co-expression with HER-2. Thus, co-administration of Herceptin™ and TOP2A inhibitor may have synergistic or additive effects in treatment of breast cancer. MCM-7 is not expressed in differentiated cells and highly expressed in tumours. The unique expression of MCM7 in cancer cells may become a new predictive marker for classification and treatment of breast cancer. Overexpression of H2AFJ has recently been found in breast cancer cells (Yao et al, 2006) and down-regulation by pomiferin may also be associated with its antiproliferative activity. ID2 is a down stream player in the TNFp pathway and involved in cell differentiation and proliferation. Overexpression of ID2 has been found in many cancers including breast cancer. Down-regulation of ID2 and its upstream partner, BMP7, may have synergistic effects in the antiproliferative activity of pomiferin. Up-regulation oiHMGBl is associated with poor survival potential and metastasis. Down-regulation oiHMGBl, on the other hand, promotes TRAIL-, Casp- 8-, and Bax-induced apoptosis. In MDA-MB-435 cells, no antioxidant genes are significantly regulated. Among the five confirmed genes, four of them including DICER1, ABCE1, TFE3 and MFN2 were up-regulated and SWOP down-regulated. DICER1, a cytoplasmic RNase III endonuclease gene, regulates miRNA processing and down-regulation of DICER1 is associated with breast cancer progression. Pomiferin up-regulates its expression and this effect may be associated with the antiproliferative activity of pomiferin. ABCE1 is a special ABC transporter gene, encoding the protein without being involved in transporting drugs out of the membrane. It can chelate Fe2+ and inhibit the Fenton 99 reaction, in turn, reducing carcinogenesis. It also promotes immune response to tumour cells but inhibits apoptosis. Thus ABCE1 may inhibit carcinogenesis but have no effect on apoptosis. TFE3 regulates cell differentiation and proliferation. Down-regulation of TFE3 is associated with many cancers. Up-regulation by pomiferin may promote cell differentiation and apoptosis. Normally, MFN2 is associated with mitochondrial fusion. Overexpression of MFN2, on the other hand, promotes mitochondrial fission and cytochrome c release, inducing apoptosis. Up-regulation of MFN2 has been found to have antiproliferative effect in breast cancer cells. Overexpression of SWOP has been found in many cancers including breast cancer, and is associated with poor prognosis. Down-regulation of SI OOP may inhibit MAPK and NF-kB signalling pathway. Although pomiferin has similar antiproliferative activity in both MCF-7 and MDA-MB-435 cells, the mechanism appears to be quite different. In MCF-7 cells, antioxidant enzyme genes and endoplasmic reticulum stress apoptotic pathway seem to predominate. In MDA-MB-435 cells, the mechanism is less obvious and probably includes mitochondrial processing and calcium signalling pathway. 100 CHAPTER IV ANTITUMOUR ACTIVITY OF POMIFERIN IN XENOGRAFT MODELS OF HUMAN BREAST CANCER 4.1 Introduction Cancer cell line studies have many advantages. These cells are easily propagated, relatively tractable to genetic manipulation, and under well-defined experimental conditions, generally yield reproducible and quantifiable results. Also, the use of cell lines has resulted in a wealth of information about the genes and signalling pathways that regulate these processes. However, a principal limitation of in vitro cell culture is that the growing conditions differ markedly from the tumour cell's normal microenvironment. Cells in culture lack the architectural and cellular complexity of real tumours, which incorporate inflammatory cells, vasculature and other stromal components (Kamb, 2005). The mouse is the most used animal model for cancer studies. A variety of models are available such as chemical induced cancers, xenografts and genetically altered mouse models. The specific model chosen depends largely on the objectives of the study. In the current study, a xenograft model was used because the cell lines to be tested were of human origin and required an immune compromised host for transplantation success. The lines chosen for the current study were the same cell lines in which we had previously demonstrated activity of pomiferin in the in vitro system (see Chapter III). Transplantation of the tumour cells, thus allowed us to examine the impacts of the more complicated in vivo microenvironment including the tumour-stromal cell interactions that facilitate tumour formation and progression (Heppner et al., 2000). 101 In this study, both MCF-7 and MDA-MB-435 xenografts were used to examine the anticancer activity of pomiferin. Meanwhile, the bioavailability of pomiferin was measured and the correlation of bioavailable pomiferin and its activity were evaluated. 4.2 Materials and Methods 4.2.1 Chemicals and materials /^-glucuronidase type H-5 from Helix pomatia containing both glucuronidase and sulfatase activities was purchased from Sigma-Aldrich (Mississauga, ON). Matrigel™ was from BD Biosciences (Mississauga, ON). The irradiated AIN 93G (American Institute of Nutrition 93 growth) diet was from TestDiet™ (Richmond, IN). The chemicals and medium used were the same as those in Chapters II and III, respectively. 4.2.2 Cell Culture Both MCF-7 and MDA-MB-435 cells were grown under the same conditions as Chapter III. Cell counts and viability were done using a haemocytometer following staining with 1% trypan blue. Cells excluding the dye were considered viable. All cultures used for injection demonstrated >90% viability. Cells were then suspended in a 1:1 mixture of media and Matrigel™ and placed on ice until the injections were performed. 4.2.3 Xenografts Six-week-old female athymic nude mice were purchased from Simonsen Laboratories (Gilroy, CA). Mice were housed in a filtered laminar air flow chamber in standard vinyl cages. Cages and beddings were autoclaved before use. Water was autoclaved and provided ad libitum. The mice were allowed one week to acclimatize in a 102 controlled environment (23 °C, 50% humidity, 12 hour light/dark cycle, 3-4 mice per cage). A xenograft was established by subcutaneous injection of 100 uL of cultured MCF-7 or MDA-MB-435 containing Matrigel™ into the right flank of each mouse (7.5 x 105 cells/100 uL). The experimental protocol was approved by the University of Guelph Animal Care Committee (Animal Utilization Protocols: 05R043 & 08R013). 4.2.4 Tumour and body weight Monitoring For MCF-7 xenografts, tumours were allowed to grow for four weeks until they reached up to approximately 40 mm3, and then mice were randomized into three groups: control diet, control diets containing 0.02% and 0.2% of pomiferin, respectively. Tumour size, diet consumption and body weight were measured every two days for a total of six weeks. For MDA-MB-435 xenografts, two trials were performed. The experimental scheme of the first trial was the same as the MCF-7 trial. In the second trial, 0.02% pomiferin treatment was replaced by 0.5% pomiferin treatment. In both trials, tumours were allowed to grow for two weeks and the size reached approximately 100 mm3, and then mice were randomized into three groups for each trial. Tumour size, diet consumption and body weight were measured every two days for an additional three weeks. Tumour volume was calculated based on the formula: Length X Width 12 (Moon et al, 2008). All the experiments were terminated by euthanizing mice with an overdose of CO2. The blood was collected via cardiac puncture and centrifuged at 2600 Xg at 4 °C for 10 min. Then the plasma was stored at -20 °C before HPLC analysis. The tumour 103 nodules, lungs and liver tissues were harvested and frozen in liquid nitrogen, then stored at -80 °C for future study. 4.2.5 HPLC analysis of plasma samples The plasma samples (200 uL) were treated with 200 uL /^-glucuronidase (25 KU/mL in 0.1 M acetate buffer, pH 5.0) at 37 °C overnight (16 hr) in 1.5 mL Eppendorf tubes, then 0.4 mL of acetonitrile was added to the tubes and centrifuged at 5500 xg for 10 min to precipitate proteins. The supernatant was transferred to a 2-mL vial and the precipitate was redissolved in 50% of acetonitrile (0.4 mL) and centrifuged. The supernatants were combined and dried under N2 flow and were redissolved in 100 uL methanol. The final solutions were filtered through 0.45 um syringe filters before analysis. The HPLC system (see Chapter II) was used for sample analysis and quantification. Separation of pomiferin was carried out in a Phenomenex® Luna Phenyl- Hexyl (Torrance, CA) (250 x 4.6 mm, 5 um) column with a CI8 guard column. The mobile phase was composed of 1% formic acid in water (solvent A) and acetonitrile (solvent B), and pumped at a flow rate of 1 mL/min. The linear gradient elution conditions were as follows: 90% B to 50% B in 10 min, 50% B to 75% B in 30 min, 75% B back to 90% B in 5 min. The injection volumes for all samples and standards were 50 uL. The analytes were monitored at 274 nm. 4.2.6 Statistics One-way ANOVA using SPSS 15.0 for Windows followed by Fisher's least significant difference (LSD) test were used for statistical analysis (p < 0.05). 104 4.3 Results For MCF-7, Twenty-eight mice were inoculated with MCF-7 cells, and of these, twenty-four developed tumours in four weeks. These were randomly assigned into one of three experimental groups with eight mice in each. The four mice without tumours were excluded from the experiment. After a six week observation period, diet consumption and body weight steadily increased in all three groups with no significant differences between the treatments. For ease of presentation, the six weekly measurements were averaged in the chart provided (Figure 4-1). Tumour volume decreased by 34% in the 0.2% pomiferin treatment group and was significantly lower than the control group (p = 0.03) (Figure 4-2). No difference was found between the control and 0.02% pomiferin group. The tumour volume of 0.02% pomiferin group increased marginally by 8.7% compared to the control, but this was not statistically significant. A different HPLC-DAD method with a high-selectivity column was developed to detect pomiferin in biological samples. The linear range was obtained between 8.2 and 328 nM (r2 = 0.998) with a detection limit of 2.0 nM. Plasma pomiferin was undetectable in the both the control and the 0.02% pomiferin treatment groups. In the 0.2% pomiferin group, the concentration was detectable but very low (33.7 ± 20.0 nM). When comparing the concentration of plasma pomiferin to tumour volume in the MCF-7 xenograft (Figure 4-3), the Pearson correlation coefficient (-0.473) showed a modest correlation and the correlation is not significant (p = 0.236). Thus, the plasma pomiferin could partially explain the reduced tumour volume. In other words, other factors may affect the antitumour activity of pomiferin in the in vivo scenario. 105 osson • Control o>28- •0.2% Pomiferin I 27- 0.02% Pomiferin 0) 26- S 25- |24- o 23- j?22- § 21- < 20- 3 4 Week Figure 4-1. The average body weight (g, M ± SD) of MCF-7 xenografted mice is shown over six weeks of treatment. By using one way ANOVA and followed by Fisher's least significant difference (LSD) test, there were no significant differences between groups (p = 0.256). 106 E 75-1 E, • Control o '0.2% Pomiferin E '0.02% Pomiferin _3 50H O > o 25H E 3 *-> O D) (Q i_ a> 2 5 6 > 3 4 < Week Figure 4-2. The average tumour size (mm3, M ±SD) are shown at each week in MCF-7 xenografted mice over the six week treatment period. By using one way ANOVA and followed by Fisher's least significant difference (LSD) test, a significant difference (*) between the 0.2% pomiferin treatment and the control at the six week time point (p = 0.03) was found. 107 70 60- f 50- it 30- O 20- Q- 10H 0 -I 1 1 1— 10 20 30 40 50 60 Tumour (mm3) Figure 4-3. Correlation between the plasma pomiferin concentration (nM) and tumour volume (mm ) in MCF-7 xenografted mice. The 0.02% pomiferin treatment group was excluded since no pomiferin was detectable in the plasma. By using SPSS 15.0 for correlation analysis, the Pearson correlation was -0.473 and this correlation was not significant (p = 0.236). 108 For MDA-MB-435 xenografted mice, the two sets of experimental data were combined. Again, there was no significant difference between treatment groups for diet consumption or weight changes over time (Figure 4-4). In the first trial, 30 mice were inoculated with MDA-MB-435 cells and 27 mice developed tumours. They were evenly divided into control, 0.02% and 0.2% pomiferin treatment groups. Although the tumour size decreased by 23.0% between the 0.2% pomiferin treatment and the control, statistically no difference was found (p = 0.089). Since 0.02% pomiferin treatment did not provide any effects, in the second trial, the three groups were modified and included control (11 mice), 0.2% (12 mice) and 0.5% (12 mice) pomiferin treatments. By pooling the data together, the 0.2% pomiferin treatment still did not show a significant result (p = 0.055), although it reduced the tumour size by 33.5% (151.2 ± 62.7 mm3) compared to control (227.5 ± 16.2 mm3) (Figure 4-5). The 0.5% of pomiferin treatment reduced the tumour size by 34.0% (149.4 + 11.5 mm ) and was significant compared to the control (p = 0.035). Again, the plasma pomiferin was not detected in the control and the 0.02% treatment. For the 0.2% and 0.5% of treatments, the pomiferin concentrations were, on average, 35.7 + 24.8 nM and 43.95 ± 27.45 nM, respectively. The correlation of plasma pomiferin and tumour volume was performed by combining the 0.2% and 0.5% pomiferin groups. There is a moderate correlation (-0.547) between pomiferin plasma concentration and tumour size reduction, which is slightly higher than that of MCF-7 model (Figure 4-6). However, the correlation is highly significant (p < 0.001) mainly because of the much larger sample size. 109 D) 30- 29- • Control 28 0.02% Pomiferin "53 27 '0.2% Pomiferin 26 0.5% Pomiferin (A 3 25 O 24 E 23 O) (0 22 > 21 < 20 -i 5 10 15 20 25 Days Figure 4-4. The average body weight (g, M ± SD) of mice bearing MDA-MB-435 xenografts over the three week treatment period for the four groups including control, 0.02%, 0.2% and 0.5% pomiferin treatments. By using one way ANOVA and followed by Fisher's least significant difference (LSD) test, there were no significant differences between groups (p = 0.11). 110 CO E 300-i E, Control a> 0.02% Pomiferin E 3 200- 0.2% Pomiferin O 0.5% Pomiferin > o E 100- 3 o O) 03 v. > < 5 10 15 20 25 Days -3 Figure 4-5. The average tumour size (mm , M ± SD) of MDA-MB-435 xenografts over three weeks for the four groups including control, 0.02%, 0.2% and 0.5% pomiferin treatments. By using one way ANOVA and followed by Fisher's least significant difference (LSD) test, a significant difference between the 0.5% pomiferin treatment and the control was found (p=0.035). Ill 100n 75^ c 0) 50H E £ 25H • •'• •"•• 100 200 300 Tumour (mm3) Figure 4-6. Correlation of plasma pomiferin concentration (nM) and tumour volume (mm3) in MDA-MB-435 xenografts. The data have been combined for the 0.2% and 0.5% pomiferin treatment groups. Again the 0.02% pomiferin group was excluded because levels of pomiferin were undetectable. By using SPSS 15.0 for correlation analysis, the Pearson correlation was -0.547 and this correlation was very significant (p < 0.001). 112 4.4 Discussion When the mice were fed 0.2% pomiferin, the tumour volumes decreased by one third in both MCF-7 and MDA-MB-435 models compared to the control although it was only significant in the MCF-7 xenografts. One of the reasons that significance may not have been observed in the MDA-MB-435 model is that these tumours tended to be irregular in shape making it difficult to make accurate volume measurements. In the MCF-7 tumour model, the period of treatment had to be extended because of poor tumour growth rates in this estrogen dependent tumour. Because relatively young animals were transplanted, it could be that the animals did not produce sufficient estrogen to support their rapid growth. Because longer times were necessary to reach the 5 mm minimum tumour volume, the treatment times were also extended in the MCF-7 model meaning that the overall exposure to pomiferin and its metabolites would have been higher in this model than the MDA-MB-235 animals where tumour growth was more rapid and the experiment terminated earlier in the treatment protocol. Overall, these in vivo results are consistent with our in vitro findings. In both MCF-7 and MDA-MB-235 xenograft models, the correlations of plasma pomiferin concentration and tumour size are in the medium range. In other words, tumour size can be partially explained by plasma pomiferin concentration, and other unknown factors may also play a significant role. For MDA-MB-435 models, the correlation is highly significant mainly because the sample size is much larger than that of MCF-7. Nevertheless, the low plasma pomiferin concentration cannot explain its anticancer activity. 113 When compared to the following feeding of soy products, genistein and daidzein, the plasma concentration of pomiferin is much lower in our supplementation trial. Genistein and daidzein, tend to have high bioavailability. Plasma levels of total genistein in mice can reach 0.44-0.93 uM based on 0.75% genistein in the diet (Santell et al, 2000; Alfred et al, 2001). On the other hand, our results are consistent with the concentrations of the methoxyled isoflavone, biochanin A, following feeding of red clover where plasma concentrations range from 10-20 nM (Setchell et al, 2001; Choi et al, 2002). In the current study we were surprised by the large "apparent" difference in bioavailability between animals, given that this is an inbred strain. Plasma isoflavone concentrations ranged from 0 to 88.7 nM, when fed the same dietary level. This range is similar to that found in human populations where the genetic variability is much greater than the animal model used here (Xu et al, 1995). Of particular interest is that the plasma concentrations of pomiferin achieved through dietary supplementation (i.e. nM range) had no effect in our in vitro assays, but showed significant antitumour activity in the xenograft models. This is consistent with similar studies on genistein and biochanin A (Shao et al, 2000; Li et al, 2005; Moon et al, 2008). For example, Moon et al, (2008) found that a low plasma concentration of biochanin A was active in a xenograft mouse model but was ineffective in cell proliferation assays of MCF-7 cells in vitro. It is possible that the plasma isoflavone concentration is not a good biomarker of tissue levels of the chemical. In this case, it may be necessary to determine the actual levels in the tissues of interest. Alternatively, it could be that novel activities providing additional mechanisms of antitumour activity are present in the in vivo situation that are not replicated in the in vitro assays. There is 114 considerable support for the idea that plasma levels are a poor surrogate for tissue isoflavone estimates. When genistein were given orally, genistein accumulated in the prostate to a 10-fold higher concentration in prostate tissue compared to plasma. For daidzein, one of its major metabolites, equol, was more than 25-fold increased in the prostate (3,200 ng/ml) compared to the plasma concentration of equol (120 ng/ml) (Morton et ah, 1997). Accessibility of isoflavones to tumour tissue suggests that part of the anticancer activity of isoflavones may be via their direct local effects on breast cancer tissues. Another aspect of the in vivo setting that could be critical in determining whether a particular isoflavone will be effective, is its metabolism in the body, that would be much more limited in vitro (Moon et ah, 2008). One might expect a larger range of metabolites to be produced in vivo, and it is unclear what this range of compounds might be, and whether or not they could have activity as antitumour agents. In the current set of studies, only un-conjugated plasma pomiferin was measured (following enzymatic treatment) so that pomiferin metabolites (other than sulphated and/or glucuronate) would have been missed. Isoflavones are metabolized extensively and differently. Daidzein is converted by the gut microflora to dihydrodaidzein, which can be further metabolized to both equol and 0-desmethylangolensin. Genistein is first reduced by gut bacteria to dihydrogenistein, followed by a cleavage of the C-ring to form 6-hydroxy-O-desmethylangolensin, which can be further degraded to 4-hydroxyphenyl-2-propionic acid. Decarboxylation can then lead to the putative metabolic end product 4-ethylphenol (Chang and Nair, 1995; Joannou et ah, 1995; Heinonen et ah, 2003). For biochanin A, even though it is converted to genistein in vivo, the growth-inhibitory effect of biochanin A is not identical to that of 115 genistein (Peterson et al, 1996; Peterson et al, 1998; Mizunuma et al, 2002), so other unidentified metabolites may also play a role. Also, in the human breast cancer cell line MCF-7, sulphate conjugates represent the major metabolite of isoflavones (Peterson et al, 1998). In the in vivo systems, the isoflavone glucuronate forms are dominant. Unfortunately the very low concentration of the parent compound pomiferin in the plasma makes it difficult to study potentially relevant metabolism. A previous study has indicated that compared to genistein, biochanin A has a greater hydrophobicity, increasing its cellular uptake and/or cellular distribution (Peterson et al, 1996). If this holds true, the cellular uptake of pomiferin should be even higher since pomiferin is more hydrophobic than biochanin A. Although the mechanisms by which pomiferin inhibits tumour growth has yet to be clearly determined, they are clearly not limited to estrogen or anti-estrogen-like activities , since we observed similar effects of pomiferin on ER+ and ER- models. As it was found in Chapter III, pomiferin regulates two completely different sets of genes in MCF-7 and MDA-MB-435 cell models. When they were transferred to the in vivo models, the genes and signalling pathways regulated by pomiferin are also likely to be different. Regardless the type of breast cancer, the anticancer activity of pomiferin in vivo is more complicated, which may include other functions of isoflavones, such as anti- angiogenesis, inhibition of p450 and synthesis of estrogen, and many others. 116 CHAPTER V GENERAL DISCUSSION ROS are ubiquitous and associated with many chronic diseases including cancer, arteriosclerosis, arthritis, diabetes, neurodegenerative disorders and other conditions (Finkel and Holbrook, 2000). The human body has evolved a well-developed endogenous biological antioxidant defence system to combat that oxidative stress. During the process of ageing, it becomes increasingly difficult for the body to maintain adequate defense that may fail to keep pace with increasing production of ROS and therefore allow their accumulation (Chen et al., 2007; Friguet et al., 2008). Thus, exogenous antioxidants such as flavonoids may be needed to help quench ROS and/or boost endogenous antioxidant defenses to curtail carcinogenesis. Even when cancer has developed, flavonoids may still be useful therapeutic agents. Since ROS form part of the signalling cascades that induce and maintain the oncogenic phenotype of cancer cells (Behrend et al, 2003), scavenging ROS with antioxidant flavonoids could short-circuit the signalling events and either inhibit cancer cell proliferation and/or promote apoptosis (Lee and Lee, 2006). Numerous studies have established that flavonoids inhibit the expansion of the pool of cancer cells by inducing cell cycle arrest and/or apoptosis, which may be due to scavenging by the flavonoids of ROS needed by cancer cells for their vitality or viability (Loo, 2003; Stoner etal., 200$). Pomiferin, a prenylated isoflavone from Osage orange fruit, shows much stronger antioxidant activity than soy isoflavones (e.g. daidzein and genistein) in various antioxidant assays including FRAP, P-CLAMS and PCL (Figures 2-6 to 2-8). These three 117 assays cover broad antioxidant functions. FRAP is used for measurement of the redox potential; p-CLAMS for inhibition of free radical chain reaction; and PCL for quenching superoxide radicals, which are the sources of other free radicals in biological systems. Although the results from these chemical models cannot be directly extrapolated to the intact biological system, they can at least be used as screening tools. Since ROS are associated with each step of carcinogenesis and vital for tumour cell survival, this provides the rationale for proposing that antioxidants can be used for chemoprevention and/or chemotherapy. In this study, two breast cancer cell lines, ER+ (MCF-7) and ER- (MDA-MB- 435), and MCF-10A (immortalized human breast epithelial cell line) were used to test the antiproliferative activity and selectivity of pomiferin. We have found that pomiferin shows much stronger antiproliferative activity in both MCF-7 and MDA-MB-435 cancer cells than genistein (Fioravanti et al, 1998; He et al, 2002; Shim et al, 2007), and the selectivity between cancer cells and MCF-10A is high. The greater activity and selectivity of pomiferin may be due to its prenylated functional group (Epifano et al., 2007). Our findings are consistent with many previous studies indicating the high efficacy and selectivity of pomiferin (Svasti et al, 2005; Son et al, 2007). Similarly, many other flavonoids such as genistein and EGCG also have high selectivity for cancer cells compared to their normal counterparts (Brusselmans et al, 2003; Kawai et al, 2005; Caetano et al, 2006). In cancer cells, flavonoids quench ROS and regulate various signaling pathways to show their antiproliferative activity, but the similar pathways may not function in normal cells (Behrend et al., 2003, Loo, 2003 Stoner et al., 2008). For instance, cancer cells constitutively generate large amounts of H2O2 that function as 118 signaling molecules in the MAPK pathway to constantly activate redox-sensitive transcription factors and responsive genes that are involved in the survival of cancer cells as well as their proliferation. The transduction signaling cascade elicited by H2O2 culminates in the activation of phosphorylation and transcriptional activation of NF-kB andAP-1. By using cDNA microarry techniques, the transcription of hundreds and thousands of genes and of their relative expression can be identified between MCF-10A and breast cancer cells, MCF-7 and MDA-MB-435, with and without treatments. Hundreds of genes were significantly regulated in MCF-7 and MDA-MB-435, and 59 genes were modulated in MCF-10A following pomiferin treatment (p <0.05). Since the false-positive results are common in microarray studies, a cut off at p<0.01 was used to further refine the pool of genes likely to be regulated. Using this new cut-off, there were still 94 and 105 regulated genes in MCF-7 and MDA-MB-435, respectively. Only one gene (FTL) from MCF-10A was regulated using this more stringent cut-off. The results from the array analysis were entirely consistent with our cell proliferation assays. The concentration of pomiferin used for the arrays was 5 uM, which is close to the IC50 values of MCF-7 and MDA-MB-435. Notably, this concentration does not significantly inhibit MCF-10A proliferation in vitro. Although pomiferin shows equal efficacy in both MCF-7 and MDA-MB-435 cells, the regulated genes are quite different. In MCF-7 cells, pomiferin, as a strong antioxidant, enhances the activity of fourteen endogenous antioxidant enzymes including BLVRB, MnSOD, GPX3, TXNRD1, FTL, etc. BLVRB is the greatest up-regulated antioxidant gene (Appendix la). Up-regulation of BLVRB plays a pivotal role in the activity of other 119 endogenous antioxidants, since it provides a continuous source of NADPH for the activity of GPX3, TXNRD1 and others. Among all the antioxidant genes, expressions of MnSOD, GPX3, TXNRD1 and FTL were confirmed by RT-qPCR. These enzymes not only quench ROS, but MnSOD and GPX3 also displayed unique antitumour activity. Particularly, MnSOD has been identified as a tumour suppressor gene (Zhong et al, 1997; Xu et al, 1999) and low expression is found in many cancers (Hitchler et al, 2006; Chuang et al., 2007). Over-expression of MnSOD has been demonstrated to effectively suppress breast cancer, in vitro and in vivo (Chuang et al, 2007; Weydert et al, 2008). Up-regulation of GPX3 has also been used to suppress tumour growth and metastasis in prostate cancer both in vitro and in vivo (Yu et al, 2007). Thus far, the role of GPX3 in breast cancer has not been examined. Pomiferin is not only a strong antioxidant, but also displays many other activities. Among the 14 confirmed genes in MCF-7 cells (not including the antioxidant genes), a number of them, MCM7, TOPIIa, CANX and BCAP31, play important roles in apoptosis, and therefore could be important molecular targets for treatment of breast cancer. MCM7 is not expressed in differentiated cells and highly expressed in tumour cells (Lei, 2005), and down-regulation of MCM7 can be used to induce cancer cell-specific apoptosis without killing normal cells (Shreeram and Blow, 2003). Currently, TOP2A is another target for treatment. Co-overexpression of TOP2A and HER-2 genes in approximately 50% of HER-2 positive breast cancer has provoked of co-administration of Herceptin™ and TOP2A inhibitors (Jarvinen and Liu, 2006). However, the clinical application of TOP2A inhibitors is limited due to severe toxic effects on normal cells (Kampa et al, 2007). The use of pomiferin could overcome this 120 limitation, as pomiferin exerts differential effects on cancer cells and their normal counterparts. CANX and BCAP31 are critical in endoplasmic reticulum stress-induced apoptosis. The proteins encoded by CANX and BCAP31 form a complex with procaspase 8 and other factors, inducing Ca release and initiating endoplasmic reticulum stress-mediated apoptosis (Delom et al, 2007), which is similar to the Fas and TNFR-1 apoptotic pathway (Nagata, 1997). Also, p53 is mutated frequently in breast cancer, resulting in dyregulation of cell cycle partially through Gadd45 and 14-3-3a, regulation of Gadd45 and 14-3-3cr activity by pomiferin may substitute for the function of p53 in cell cycle regulation, which has promising implications in breast cancer treatment. In MDA-MB-435 cells, on the other hand, pomiferin did not significantly regulate the antioxidant genes. It seems that the antioxidant activity of pomiferin is cell specific and related to ER status (Breinholt et al, 1999; Yau and Benz, 2008). Instead, pomiferin regulates different genes and signaling pathways for its antiproliferative activity in MDA-MB-435 cells, and the mechanism seems to be more complicated. Possibly pomiferin may induce Ca release and modulate mitochondrial redox potentials, since many genes that regulated Ca2+ and mitochondria are significantly modified (Appendix VI). More recently, it has been suggested that MDA-MB-435 breast cancer cell are actually derivative of the Ml4 melanoma cell line and perhaps, should no longer be considered a model of breast cancer (Rae et al., 2007). The anticancer activity of pomiferin is, however, still valid. We may conclude that pomiferin not only has anti- breast cancer activity, but also shows similar effects in melanoma. In this study, we also 121 found that when comparing the genes regulated by pomiferin in these two cancer cells and MCF-10A. MCF-7 and -10A have some genes in common, but not MDA-MB-435. This may imply that MDA-MB-435 is unrelated to breast cells. The in vitro effects of pomiferin were confirmed in both MCF-7 and MDA-MB- 435 xenograft models when the nude mice were fed with 0.2% and 0.5% pomiferin in their diet for 6 and 3 weeks, respectively. The concentration of pomiferin in the mouse plasma was low (33.7 vs 43.9 nM, for 0.2% and 0.5% animals, respectively), which is approximately 100-150 times lower than the in vitro IC50 values (5.2 vs 5.4 uM). These in vivo concentrations do not show any effect in our in vitro studies. At least three major reasons may explain the antitumour activity of pomiferin. First, tumours and other tissues tend to accumulate much more isoflavones than plasma (Morton et at, 1997), and the accumulation is associated with the hydrophobicity of isoflavones (Peterson et at, 1998). Pomiferin is more hydrophobic than genistein, daidzein or biochanin A. Thus, the tumour tissue may accumulate greater concentration of pomiferin than other flavonoid metabolites. Second, besides the effect of pomiferin, other metabolites of pomiferin through gut microflora and liver may have antitumour activity. In some cases, the metabolites have more potent biological activity than their parent compounds. For example, one of the metabolites of daidzein, equol, has much stronger antioxidant and antitumour activity than daidzein itself (Atkinson et at, 2005; Yuan et at, 2007). And last, since isoflavones in general have function of inhibiting P450 (Han et at, 2006; Nakajima et at, 2006), aromatase activity (Moon et at, 2006; Wang et at, 2008) and angiogenesis (Farina et at, 2006; Piao et at, 2006; Banerjee et at, 2008), and 122 stimulating an immune response (Herst et at, 2007), all these functions may have additive or synergistic effects on the in vivo antitumour activity of pomiferin. The antitumour activity, gene regulation and signaling pathway information gleaned from this study, now set the platform for further study of pomiferin and its related compounds in cancer research, particular in estrogen receptor positive cancer. Not only does it up-regulated the antioxidant enzyme associated genes, it also modulate many other cancer related genes. In addition, these genes are associated with many signaling transduction pathways including cell cycle regulation and apoptosis. Further work is needed to confirm our findings. As a conclusion, pomiferin is not only a stronger antioxidant, but also shows stronger anticancer activity than soy isoflavones. It can be anticipated that this prenylated isoflavone (e.g. pomiferin) may have unique functions compared to soy isoflavones in its anticancer activity. 123 REFERENCES Aheme, S. A., and O'Brien, N. M. (2002). Dietary flavonols: chemistry, food content, and metabolism. Nutrition 18, 75-81. Ahmed, M. I., Fayed, S. T., Hossein, H., and Tash, F. M. (1999). Lipid peroxidation and antioxidant status in human cervical carcinoma. Dis Markers 15, 283-291. Alarmo, E. L., Rauta, J., Kauraniemi, P., Karhu, R., Kuukasjarvi, T., and Kallioniemi, A. (2006). Bone morphogenetic protein 7 is widely overexpressed in primary breast cancer. Genes Chromosomes Cancer 45,411-419. Alexandrow, M. G., and Moses, H. L. (1995). Transforming growth factor beta and cell cycle regulation. Cancer Res 55, 1452-1457. Ali, S., and Coombes, R. C. (2002). Endocrine-responsive breast cancer and strategies for combating resistance. Nat Rev Cancer 2,101-112. Ali, S. M., Carney, W. P., Esteva, F. J., Former, M., Harris, L., Kostler, W. J., Lotz, J. P., Luftner, D., Pichon, M. F., and Lipton, A. (2008). Serum HER-2/neu and relative resistance to trastuzumab-based therapy in patients with metastatic breast cancer. Cancer, in press. Allred, C. D., Ju, Y. H., Allred, K. F., Chang, J., and Helferich, W. G. (2001). Dietary genistin stimulates growth of estrogen-dependent breast cancer tumors similar to that observed with genistein. Carcinogenesis 22, 1667-1673. An, B., Goldfarb, R. H., Siman, R., and Dou, Q. P. (1998). Novel dipeptidyl proteasome inhibitors overcome Bcl-2 protective function and selectively accumulate the cyclin-dependent kinase inhibitor p27 and induce apoptosis in transformed, but not normal, human fibroblasts. Cell Death Differ 5, 1062-1075. Andersson, J., Larsson, L., Klaar, S., Holmberg, L., Nilsson, J., Inganas, M., Carlsson, G., Ohd, J., Rudenstam, C. M., Gustavsson, B., and Bergh, J. (2005). Worse survival for TP53 (p53)-mutated breast cancer patients receiving adjuvant CMF. Ann Oncol 16, 743-748. Andres, R., Mayordomo, J. I., Visus, C, Isla, D., Godino, J., Escudero, P., Saenz, A., Ortega, E., Lastra, R., Lambea, J., Aguirre, E., Elosegui, L., Marcos, I., Ruiz- Echarri, M., Millastre, E., Saez-Gutierrez, B., Asin, L., Vidal, M. J., Ferrer, A., Giner, A., Larrad, L., Carapeto, F. J. and Tres, A. (2008). Prognostic significance and diagnostic value of protein S-100 and tyrosinase in patients with malignant melanoma. Am J Clin Oncol 31:335-339. Argani, P. (2006). The evolving story of renal translocation carcinomas. Am J Clin Pathol 126, 332-334. Argani, P., Lui, M. Y., Couturier, J., Bouvier, R., Fournet, J. C, and Ladanyi, M. (2003). A novel CLTC-TFE3 gene fusion in pediatric renal adenocarcinoma with t(X;17)(pll.2;q23). Oncogene 22, 5374-5378. Arora, A., Byrem, T. M., Nair, M. G., and Strasburg, G. M. (2000). Modulation of liposomal membrane fluidity by flavonoids and isoflavonoids. Arch Biochem Biophys313, 102-109. 124 Arriola, E., Marchio, C, Tan, D. S., Drury, S. C, Lambros, M. B., Natrajan, R., Rodriguez-Pinilla, S. M., Mackay, A., Tamber, N., Fenwick, K., Jones, C, Dowsett, M., Ashworth, A., and Reis-Filho, J. S. (2008). Genomic analysis of the HER2/TOP2A amplicon in breast cancer and breast cancer cell lines. Lab Invest 88,491-503. Arumugam, T., Ramachandran, V., and Logsdon, C. D. (2006). Effect of cromolyn on SI OOP interactions with RAGE and pancreatic cancer growth and invasion in mouse models. J Natl Cancer Inst 98, 1806-1818. Arumugam, T., Simeone, D. M., Van Golen, K., and Logsdon, C. D. (2005). SI OOP promotes pancreatic cancer growth, survival, and invasion. Clin Cancer Res 11, 5356-5364. Atkinson, C, Frankenfeld, C. L., and Lampe, J. W. (2005). Gut bacterial metabolism of the soy isoflavone daidzein: exploring the relevance to human health. Exp Biol Med (Maywood) 230,155-170. Atkinson, T. G., and Meckling-Gill, K. A. (1995). Regulation of nucleoside drug toxicity by transport inhibitors and omega-3 polyunsaturated fatty acids in normal and transformed rat-2 fibroblasts. Cell Pharmacol 2, 259-264. Bach, D., Pich, S., Soriano, F. X., Vega, N., Baumgartner, B., Oriola, J., Daugaard, J. R., Lloberas, J., Camps, M., Zierath, J. R., Rabasa-Lhoret, R., Wallberg-Henriksson, H., Laville, M., Palacin, M., Vidal, H., Rivera, F., Brand, M, and Zorzano, A. (2003). Mitofusin-2 determines mitochondrial network architecture and mitochondrial metabolism. A novel regulatory mechanism altered in obesity. J Biol Chem 278, 17190-17197. Bacon, L., Eagle, R. A., Meyer, M., Easom, N., Young, N. T., and Trowsdale, J. (2004). Two human ULBP/RAET1 molecules with transmembrane regions are ligands for NKG2D. J Immunol 173, 1078-1084. Bae, Y. S., Kang, S. W., Seo, M. S., Baines, I. C, Tekle, E., Chock, P. B., and Rhee, S. G. (1997). Epidermal growth factor (EGF)-induced generation of hydrogen peroxide. Role in EGF receptor-mediated tyrosine phosphorylation. J Biol Chem 272, 217- 221. Banerjee, S., Li, Y., Wang, Z., and Sarkar, F. H. (2008). Multi-targeted therapy of cancer by genistein. Cancer Lett, in press. Barnett, J. P., and Burton, J. D. (1997). Osage-orange: a pioneering stewardship species. Tree Planters' Notes 48, 81-86. Barrett, J. C. (1993). Mechanisms of multistep carcinogenesis and carcinogen risk assessment. Environ Health Perspect 100, 9-20. Battel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116,281-297. Basu, G. D., Azorsa, D. O., Kiefer, J. A., Rojas, A. M., Tuzmen, S., Barrett, M. T., Trent, J. M., Kallioniemi, O., and Mousses, S. (2008). Functional evidence implicating SI OOP in prostate cancer progression. Int J Cancer 123, 330-339. Bauer, K. R., Brown, M., Cress, R. D., Parise, C. A., and Caggiano, V. (2007). Descriptive analysis of estrogen receptor (ER)-negative, progesterone receptor (PR)-negative, and HER2-negative invasive breast cancer, the so-called triple- negative phenotype: a population-based study from the California cancer Registry. Cancer 109, 1721-1728. 125 Baum, M., Budzar, A. U., Cuzick, J., Forbes, J., Houghton, J. H., Klijn, J. G., and Sahmoud, T. (2002). Anastrozole alone or in combination with tamoxifen versus tamoxifen alone for adjuvant treatment of postmenopausal women with early breast cancer: first results of the AT AC randomised trial. Lancet 359, 2131-2139. Bayir, H. (2005). Reactive oxygen species. Crit Care Med 33, S498-501. Beer, D. G., Kardia, S. L., Huang, C. C, Giordano, T. J., Levin, A. M., Misek, D. E., Lin, L., Chen, G., Gharib, T. G., Thomas, D. G., Lizyness, M. L., Kuick, R., Hayasaka, S., Taylor, J. M., Iannettoni, M. D., Orringer, M. B., and Hanash, S. (2002). Gene-expression profiles predict survival of patients with lung adenocarcinoma. Nat Med 8, 816-824. Behrend, L., Henderson, G., and Zwacka, R. M. (2003). Reactive oxygen species in oncogenic transformation. Biochem Soc Trans 31,1441-1444. Benzie, I. F. F., and Strain, J. J. (1996). The ferric reducing ability of plasma (FRAP) as a measure of "antioxidant power": The FRAP Assay. Anal Biochem 239, 70-76. Bertram, J., Palfner, K., Hiddemann, W., and Kneba, M. (1998). Elevated expression of SI OOP, CAPL and MAGE 3 in doxorubicin-resistant cell lines: comparison of mRNA differential display reverse transcription-polymerase chain reaction and subtractive suppressive hybridization for the analysis of differential gene expression. Anticancer Drugs 9, 311 -317. Bhasin, G., Kauser, H., and Athar, M. (2002). Iron augments stage-I and stage-II tumor promotion in murine skin. Cancer Lett 183, 113-122. Bhattacharya, R. K., and Firozi, P. F. (1988). Effect of plant flavonoids on microsome catalyzed reactions of aflatoxin Bl leading to activation and DNA adduct formation. Cancer Lett 39, 85-91. Biaglow, J. E., Donahue, J., Tuttle, S., Held, K., Chrestensen, C, and Mieyal, J. (2000). A method for measuring disulfide reduction by cultured mammalian cells: relative contributions of glutathione-dependent and glutathione-independent mechanisms. Anal Biochem 281, 77-86. Biaglow, J. E., and Miller, R. A. (2005). The thioredoxin reductase/thioredoxin system: novel redox targets for cancer therapy. Cancer Biol Ther 4, 6-13. Birch, A. E., Fenner, G. P., Watkins, R., and Boyd, L. C. (2001). Antioxidant properties of evening primrose seed extracts. JAgric Food Chem 49, 4502-4507. Bjornstedt, M., Kumar, S., Bjorkhem, L., Spyrou, G., and Holmgren, A. (1997). Selenium and the thioredoxin and glutaredoxin systems. Biomed Environ Sci 10, 271-279. Blenkiron, C, Goldstein, L. D., Thorne, N. P., Spiteri, I., Chin, S. F., Dunning, M. J., Barbosa-Morais, N. L., Teschendorf^ A. E., Green, A. R., Ellis, I. O., Tavare, S., Caldas, C, and Miska, E. A. (2007). MicroRNA expression profiling of human breast cancer identifies new markers of tumor subtype. Genome Biol 8, R214. Blokhina, O., Virolainen, E., and Fagerstedt, K. V. (2003). Antioxidants, oxidative damage and oxygen deprivation stress: a review. Ann Bot (Lond) 91 Spec No, 179-194. Bobe, G., Weinstein, S. J., Albanes, D., Hirvonen, T., Ashby, J., Taylor, P. R., Virtamo, J., and Stolzenberg-Solomon, R. Z. (2008). Flavonoid intake and risk of pancreatic cancer in male smokers (Finland). Cancer Epidemiol Biomarkers Prev 17, 553-562. 126 Borresen-Dale, A. L. (2003). TP53 and breast cancer. Hum Mutat 21, 292-300. Bors, W., and Michel, C. (1999). Antioxidant capacity of flavanols and gallate esters: pulse radiolysis studies. Free Radic BiolMed27, 1413-1426. Bors, W., Michel, C, and Stettmaier, K. (2001). Structure-activity relationships governing antioxidant capacities of plant polyphenols. Methods Enzymol 335, 166-180. Bosetti, C, Bertuccio, P., Levi, F., Lucchini, F., Negri, E., and La Vecchia, C. (2008). Cancer mortality in the European Union, 1970-2003, with a joinpoint analysis. Ann Oncol 19, 631-640. Bosetti, C, Bravi, F., Talamini, R., Parpinel, M., Gnagnarella, P., Negri, E., Montella, M., Lagiou, P., Franceschi, S., and La Vecchia, C. (2006). Flavonoids and prostate cancer risk: a study in Italy. Nutr Cancer 56,123-127. Bosetti, C, Spertini, L., Parpinel, M., Gnagnarella, P., Lagiou, P., Negri, E., Franceschi, S., Montella, M., Peterson, J., Dwyer, J., Giacosa, A., and La Vecchia, C. (2005). Flavonoids and breast cancer risk in Italy. Cancer Epidemiol Biomarkers Prev 14, 805-808. Breckenridge, D. G., Stojanovic, M., Marcellus, R. C, and Shore, G. C. (2003). Caspase cleavage product of BAP31 induces mitochondrial fission through endoplasmic reticulum calcium signals, enhancing cytochrome c release to the cytosol. J Cell 5/o/160,1115-1127. Breinholt, V., Lauridsen, S. T., and Dragsted, L. O. (1999). Differential effects of dietary flavonoids on drug metabolizing and antioxidant enzymes in female rat. Xenobiotica 29,1227-1240. Brezniceanu, M. L., Volp, K., Bosser, S., Solbach, C, Lichter, P., Joos, S., and Zornig, M. (2003). HMGB1 inhibits cell death in yeast and mammalian cells and is abundantly expressed in human breast carcinoma. FASEB J17,1295-1297. Bria, E., Cuppone, F., Fornier, M., Nistico, C, Carlini, P., Milella, M., Sperduti, I., Terzoli, E., Cognetti, F., and Giannarelli, D. (2008). Cardiotoxicity and incidence of brain metastases after adjuvant trastuzumab for early breast cancer: the dark side of the moon? A meta-analysis of the randomized trials. Breast Cancer Res Treat 109,231-239. Brueggemeier, R. W., Hackett, J. C, and Diaz-Cruz, E. S. (2005). Aromatase inhibitors in the treatment of breast cancer. Endocr Rev 26, 331-345. Brusselmans, K., De Schrijver, E., Heyns, W., Verhoeven, G., and Swinnen, J. V. (2003). Epigallocatechin-3-gallate is a potent natural inhibitor of fatty acid synthase in intact cells and selectively induces apoptosis in prostate cancer cells. Int J Cancer 106, 856-862. Burda, S., and Oleszek, W. (2001). Antioxidant and antiradical activities of flavonoids. J Agric Food Chem 49, 2774-2779. Burdon, R. H. (1995). Superoxide and hydrogen peroxide in relation to mammalian cell proliferation. Free Radic Biol Med 18, 775-794. Burdon, R. H., Gill, V., and Alliangana, D. (1996). Hydrogen peroxide in relation to proliferation and apoptosis in BHK-21 hamster fibroblasts. Free Radic Res 24, 81-93. Burdon, R. H., Gill, V., and Rice-Evans, C. (1990). Oxidative stress and tumour cell proliferation. Free Radic Res Commun 11, 65-76. 127 Butler, J., and Hoey, B. M. (1993). The one-electron reduction potential of several substrates can be related to their reduction rates by cytochrome P-450 reductase. Biochim Biophys Acta 1161, 73-78. Cadenas, E., and Davies, K. J. (2000). Mitochondrial free radical generation, oxidative stress, and aging. Free Radic Biol Med 29, 222-230. Caetano, B., Le Corre, L., Chalabi, N., Delort, L., Bignon, Y. J., and Bernard-Gallon, D. J. (2006). Soya phytonutrients act on a panel of genes implicated with BRCA1 and BRCA2 oncosuppressors in human breast cell lines. Br JNutr 95, 406-413. Calderwood, S. K., Khaleque, M. A., Sawyer, D. B., and Ciocca, D. R. (2006). Heat shock proteins in cancer: chaperones of tumorigenesis. Trends Biochem Sci 31, 164-172. Cao, W., and He, W. (2004). UL16 binding proteins. Immunobiology 209, 283-290. Cao, W., Xi, X., Hao, Z., Li, W., Kong, Y., Cui, L., Ma, C, Ba, D., and He, W. (2007). RAET1E2, a soluble isoform of the UL16-binding protein RAET1E produced by tumor cells, inhibits NKG2D-mediated NK cytotoxicity. J Biol Chem 282, 18922- 18928. Carlson, B. A., Dubay, M. M., Sausville, E. A., Brizuela, L., and Worland, P. J. (1996). Flavopiridol induces Gl arrest with inhibition of cyclin-dependent kinase (CDK) 2 and CDK4 in human breast carcinoma cells. Cancer Res 56, 2973-2978. Carney, J. M., Starke-Reed, P. E., Oliver, C. N., Landum, R. W., Cheng, M. S., Wu, J. F., and Floyd, R. A. (1991). Reversal of age-related increase in brain protein oxidation, decrease in enzyme activity, and loss in temporal and spatial memory by chronic administration of the spin-trapping compound N-tert-butyl-alpha- phenylnitrone. Proc Natl Acad Sci USA 88, 3633-3636. Carr, A. C, McCall, M. R., and Frei, B. (2000). Oxidation of LDL by myeloperoxidase and reactive nitrogen species: reaction pathways and antioxidant protection. Arterioscler Thromb Vase Biol 20, 1716-1723. Cerda, S., and Weitzman, S. A. (1997). Influence of oxygen radical injury on DNA mefhylation. Mutat Res 386, 141-152. Cerutti, P. A. (1985). Prooxidant states and tumor promotion. Science 227, 375-381. Champoux, J. J. (2001). DNA topoisomerases: structure, function, and mechanism. Annu Rev Biochem 70, 369-413. Chang, Y. C, and Nair, M. G. (1995). Metabolism of daidzein and genistein by intestinal bacteria. J Nat Prod 58, 1892-1896. Chao, A., Wang, T. H., Lee, Y. S., Hsueh, S., Chao, A. S., Chang, T. C, Kung, W. H., Huang, S. L., Chao, F. Y., Wei, M. L., and Lai, C. H. (2006). Molecular characterization of adenocarcinoma and squamous carcinoma of the uterine cervix using microarray analysis of gene expression. Int J Cancer 119, 91-98. Chen, H., and Chan, D. C. (2005). Emerging functions of mammalian mitochondrial fusion and fission. Hum Mol Genet 14 Spec No. 2, R283-289. Chen, J. H., Hales, C. N., and Ozanne, S. E. (2007). DNA damage, cellular senescence and organismal ageing: causal or correlative? Nucleic Acids Res 35, 7417-7428. Chen, K. H., Guo, X., Ma, D., Guo, Y., Li, Q., Yang, D., Li, P., Qiu, X., Wen, S., Xiao, R. P., and Tang, J. (2004). Dysregulation of HSG triggers vascular proliferative disorders. Nat Cell Biol 6, 872-883. 128 Chen, Z. P., Schell, J. B., Ho, C. T., and Chen, K. Y. (1998). Green tea epigallocatechin gallate shows a pronounced growth inhibitory effect on cancerous cells but not on their normal counterparts. Cancer Lett 129, 173-179. Chen, Z. Q., Dong, J., Ishimura, A., Daar, I., Hinnebusch, A. G., and Dean, M. (2006). The essential vertebrate ABCE1 protein interacts with eukaryotic initiation factors. J Biol Chem 281, 7452-7457. Childs, S., and Ling, V. (1994). The MDR superfamily of genes and its biological implications. Important Adv Oncol, 21-36. Chiosea, S., Jelezcova, E., Chandran, U., Acquafondata, M., McHale, T., Sobol, R. W., and Dhir, R. (2006). Up-regulation of dicer, a component of the MicroRNA machinery, in prostate adenocarcinoma. Am J Pathol 169, 1812-1820. Chiosea, S., Jelezcova, E., Chandran, U., Luo, J., Mantha, G., Sobol, R. W., and Dacic, S. (2007). Overexpression of Dicer in precursor lesions of lung adenocarcinoma. Cancer Res 67, 2345-2350. Choi, M. H., Kim, K. R., Hong, J. K., Park, S. J., and Chung, B. C. (2002). Determination of non-steroidal estrogens in breast milk, plasma, urine and hair by gas chromatography/mass spectrometry. Rapid Commun Mass Spectrom 16, 2221-2228. Chuang, T. C, Liu, J. Y., Lin, C. T., Tang, Y. T., Yeh, M. H., Chang, S. C, Li, J. W., and Kao, M. C. (2007). Human manganese superoxide dismutase suppresses HER2/neu-mediated breast cancer malignancy. FEBS Lett 581, 4443-4449. Chung-man Ho, J., Zheng, S., Comhair, S. A., Farver, C, and Erzurum, S. C. (2001). Differential expression of manganese superoxide dismutase and catalase in lung cancer. Cancer Res 61, 8578-8585. Chung, J. H., Han, J. H., Hwang, E. J., Seo, J. Y., Cho, K. H., Kim, K. H., Youn, J. I., and Eun, H. C. (2003). Dual mechanisms of green tea extract (EGCG)-induced cell survival in human epidermal keratinocytes. FASEBJ11,1913-1915. Chung, Y. W., Jeong, D. W., Won, J. Y., Choi, E. J., Choi, Y. H., and Kim, I. Y. (2002). H(2)0(2)-induced AP-1 activation and its effect on p21(WAFl/CIPl)-mediated G2/M arrest in a p53-deficient human lung cancer cell. Biochem Biophys Res Commun293, 1248-1253. Ciocca, D. R., and Calderwood, S. K. (2005). Heat shock proteins in cancer: diagnostic, prognostic, predictive, and treatment implications. Cell Stress Chaperones 10, 86- 103. Clarke, R., Skaar, T., Baumann, K., Leonessa, F., James, M., Lippman, J., Thompson, E. W., Freter, C, and Brunner, N. (1994). Hormonal carcinogenesis in breast cancer: cellular and molecular studies of malignant progression. Breast Cancer Res Treat 31, 237-248. Cohen, C, Shulman, G., and Budgeon, L. R. (1984). Immunohistochemical ferritin in testicular seminoma. Cancer 54, 2190-2194. Conejo-Garcia, J. R., Benencia, F., Courreges, M. C, Gimotty, P. A., Khang, E., Buckanovich, R. J., Frauwirth, K. A., Zhang, L., Katsaros, D., Thompson, C. B., Levine, B., and Coukos, G. (2004). Ovarian carcinoma expresses the NKG2D ligand Letal and promotes the survival and expansion of CD28- antitumor T cells. Cancer Res 64, 2175-2182. Conradt, B. (2006). Cell biology: mitochondria shape up. Nature 443, 646-647. 129 Cook-Mills, J. M. (2006). Hydrogen peroxide activation of endothelial cell-associated MMPs during VCAM-1-dependent leukocyte migration. Cell Mol Biol (Noisy-le- grand) 52, 8-16. Cooke, M. S., Evans, M. D., Dizdaroglu, M., and Lunec, J. (2003). Oxidative DNA damage: mechanisms, mutation, and disease. FASEB J17,1195-1214. Corcoran, D., Rizos, D., Fair, T., Evans, A. C, and Lonergan, P. (2007). Temporal expression of transcripts related to embryo quality in bovine embryos cultured from the two-cell to blastocyst stage in vitro or in vivo. Mol Reprod Dev 74, 972- 977. Coskun, O., Kanter, M., Korkmaz, A., and Oter, S. (2005). Quercetin, a flavonoid antioxidant, prevents and protects streptozotocin-induced oxidative stress and beta-cell damage in rat pancreas. Pharmacol Res 51, 117-123. Cotelle, N. (2001). Role of flavonoids in oxidative stress. Curr Top Med Chem 1, 569- 590. Creagh, E. M., Sheehan, D., and Cotter, T. G. (2000). Heat shock proteins—modulators of apoptosis in tumour cells. Leukemia 14, 1161-1173. Cui, Y., Morgenstern, H., Greenland, S., Tashkin, D. P., Mao, J. T., Cai, L., Cozen, W., Mack, T. M., Lu, Q. Y., and Zhang, Z. F. (2008). Dietary flavonoid intake and lung cancer—a population-based case-control study. Cancer 112, 2241-2248. Cutler, G. J., Nettleton, J. A., Ross, J. A., Harnack, L. J., Jacobs, D. R., Jr., Scrafford, C. G., Barraj, L. M., Mink, P. J., and Robien, K. (2008). Dietary flavonoid intake and risk of cancer in postmenopausal women: the Iowa Women's Health Study. Int J Cancer 123, 664-671. Dahabreh, I. J., Linardou, H., Siannis, F., Fountzilas, G., and Murray, S. (2008). Trastuzumab in the adjuvant treatment of early-stage breast cancer: a systematic review and meta-analysis of randomized controlled trials. Oncologist 13, 620-630. Darrouzet, E., Valkova-Valchanova, M., and Daldal, F. (2002). The [2Fe-2S] cluster E(m) as an indicator of the iron-sulfur subunit position in the ubihydroquinone oxidation site of the cytochrome bcl complex. J Biol Chem 277, 3464-3470. DAVID-Bioinformatic-Team (2008). DAVID Bioinformatics Resources 2008. In The Database for Annotation, Visualization and Integrated Discovery (DAVID). http://david.abcc.ncifcrf.gov/. Davis, J. N., Singh, B., Bhuiyan, M., and Sarkar, F. H. (1998). Genistein-induced upregulation of p21WAFl, downregulation of cyclin B, and induction of apoptosis in prostate cancer cells. Nutr Cancer 32,123-131. de Candia, P., Benera, R., and Solit, D. B. (2004). A role for Id proteins in mammary gland physiology and tumorigenesis. Adv Cancer Res 92, 81-94. de Wit, N. J., Rijntjes, J., Diepstra, J. H., van Kuppevelt, T. H., Weidle, U. H., Ruiter, D. J., and van Muijen, G. N. (2005). Analysis of differential gene expression in human melanocytic tumour lesions by custom made oligonucleotide arrays. Br J Cancer 92, 2249-2261. Dean, M., and Allikmets, R. (1995). Evolution of ATP-binding cassette transporter genes. Curr Opin Genet Dev 5, 779-785. Delle Monache, G., Scurria, R., Vitali, A., Botta, B., Monacelli, B., Pasqua, G., Palocci, C, and Cernia, E. (1994). Two isoflavones and a flavone from the fruits of Madura pomifera. Phytochemistry 37, 893-898. 130 Delom, F., Emadali, A., Cocolakis, E., Lebrun, J. J., Nantel, A., and Chevet, E. (2007). Calnexin-dependent regulation of tunicamycin-induced apoptosis in breast carcinoma MCF-7 cells. Cell Death Differ 14, 586-596. Di Leo, A., Gancberg, D., Larsimont, D., Tanner, M., Jarvinen, T., Rouas, G., Dolci, S., Leroy, J. Y., Paesmans, M., Isola, J., and Piccart, M. J. (2002). HER-2 amplification and topoisomerase Ilalpha gene aberrations as predictive markers in node-positive breast cancer patients randomly treated either with an anthracycline-based therapy or with cyclophosphamide, methotrexate, and 5- fluorouracil. Clin Cancer Res 8,1107-1116. Diederichs, S., Bulk, E., Steffen, B., Ji, P., Tickenbrock, L., Lang, K., Zanker, K. S., Metzger, R., Schneider, P. M., Gerke, V., Thomas, M., Berdel, W. E., Serve, H., and Muller-Tidow, C. (2004). SI00 family members and trypsinogens are predictors of distant metastasis and survival in early-stage non-small cell lung cancer. Cancer Res 64, 5564-5569. Dixit, R., and Gold, B. (1986). Inhibition of N-methyl-N-nitrosourea-induced mutagenicity and DNA methylation by ellagic acid. Proc Natl Acad Sci USAS3, 8039-8043. Dizdaroglu, M. (1994). Chemical determination of oxidative DNA damage by gas chromatography-mass spectrometry. Methods Enzymol 234, 3-16. Dizdaroglu, M., Jaruga, P., Birincioglu, M., and Rodriguez, H. (2002). Free radical- induced damage to DNA: mechanisms and measurement. Free Radic Biol Med 32, 1102-1115.. Donato, R. (2001). S100: a multigenic family of calcium-modulated proteins of the EF- hand type with intracellular and extracellular functional roles. Int J Biochem Cell Biol 33, 637-668. Dong, J., Lai, R., Nielsen, K., Fekete, C. A., Qiu, H., and Hinnebusch, A. G. (2004). The essential ATP-binding cassette protein RLI1 functions in translation by promoting preinitiation complex assembly. J Biol Chem 279, 42157-42168. Donnelly, D. M. X., and Boland, G. M. (1995). lsoflavonoids and Neoflavonoids: Naturally Occurring 0-Heterocycles. Natural Product Reports, 321-338. Dreher, D., and Junod, A. F. (1996). Role of oxygen free radicals in cancer development. Eur J Cancer 32A, 30-38. Dym, O., and Eisenberg, D. (2001). Sequence-structure analysis of FAD-containing proteins. Protein Sci 10, 1712-1728. Eder, E., Wacker, M., Lutz, U., Nair, J., Fang, X., Bartsch, H., Beland, F. A., Schlatter, J., and Lutz, W. K. (2006). Oxidative stress related DNA adducts in the liver of female rats fed with sunflower-, rapeseed-, olive- or coconut oil supplemented diets. Chem Biol Interact 159, 81-89. Emmons, C. L., Peterson, D. M., and Paul, G. L. (1999). Antioxidant capacity of oat (Avena sativa L.) extracts. 2. In vitro antioxidant activity and contents of phenolic andtocol antioxidants. JAgricFoodChem 47, 4894-4898. Epifano, F., Genovese, S., Menghini, L., and Curini, M. (2007). Chemistry and pharmacology of oxyprenylated secondary plant metabolites. Phytochemistry 68, 939-953. Esworthy, R. S., Baker, M. A., and Chu, F. F. (1995). Expression of selenium-dependent glutathione peroxidase in human breast tumor cell lines. Cancer Res 55, 957-962. 131 Fahl, W. E., Lalwani, N. D., Watanabe, T., Goel, S. K., and Reddy, J. K. (1984). DNA damage related to increased hydrogen peroxide generation by hypolipidemic drug-induced liver peroxisomes. Proc Natl Acad Sci USA 81, 7827-7830. Fang, L., Moore, X. L., Gao, X. M, Dart, A. M., Lim, Y. L., and Du, X. J. (2007). Down-regulation of mitofusin-2 expression in cardiac hypertrophy in vitro and in vivo. Life Sci 80, 2154-2160. Farina, H. G., Pomies, M., Alonso, D. F., and Gomez, D. E. (2006). Antitumor and antiangiogenic activity of soy isoflavone genistein in mouse models of melanoma and breast cancer. Oncol Rep 16, 885-891. Farombi, E. O., and Nwaokeafor, I. A. (2005). Anti-oxidant mechanisms of kolaviron: studies on serum lipoprotein oxidation, metal chelation and oxidative membrane damage in rats. Clin Exp Pharmacol Physiol 32, 667-674. Feig, D. I., Reid, T. M., and Loeb, L. A. (1994). Reactive oxygen species in tumorigenesis. Cancer Res 54, 1890s-1894s. Feng, H. C, Tsao, S. W., Ngan, H. Y., Xue, W. C, Chiu, P. M., and Cheung, A. N. (2005). Differential expression of insulin-like growth factor binding protein 1 and ferritin light polypeptide in gestational trophoblastic neoplasia: combined cDNA suppression subtractive hybridization and microarray study. Cancer 104, 2409- 2416. Finch, J. S., Tome, M. E., Kwei, K. A., and Bowden, G. T. (2006). Catalase reverses tumorigenicity in a malignant cell line by an epidermal growth factor receptor pathway. Free Radic Biol Med 40, 863-875. Fink, B. N., Steck, S. E., Wolff, M. S., Britton, J. A., Kabat, G. C, Gaudet, M. M., Abrahamson, P. E., Bell, P., Schroeder, J. C, Teitelbaum, S. L., Neugut, A. I., and Gammon, M. D. (2007). Dietary flavonoid intake and breast cancer survival among women on Long Island. Cancer Epidemiol Biomarkers Prev 16, 2285- 2292. Finkel, T., and Holbrook, N. J. (2000). Oxidants, oxidative stress and the biology of ageing. Nature 408, 239-247. Fioravanti, L., Cappelletti, V., Miodini, P., Ronchi, E., Brivio, M., and Di Fronzo, G. (1998). Genistein in the control of breast cancer cell growth: insights into the mechanism of action in vitro. Cancer Lett 130, 143-152. Flohe , L. (1989). The selenoprotein glutathione peroxidase. In Glutathione: chemical, biochemical and medical aspects—Part A, pp. 643—731. John Wiley & Sons Inc, New York. Flohr, A. M., Rogalla, P., Meiboom, M., Borrmann, L., Krohn, M., Thode-Halle, B., and Bullerdiek, J. (2001). Variation of HMGB1 expression in breast cancer. Anticancer Res 21, 3881-3885. Florian, T. A. R. A., Necas, J. A., Bartosikova, L. A., Klusakova, J. A., Suchy, V. A., El, N. E. B. A., Janostikova, E. A., and Bartosik, T. A. (2006). Effects of prenylated isoflavones osajin and pomiferin in premedication on heart ischemia-reperfusion. Biomedical-Papers-(Olomouc). 150, 93-100. Fontanini, G., Boldrini, L., Calcinai, A., Chine, S., Lucchi, M., Mussi, A., Angeletti, C. A., Basolo, F., and Bevilacqua, G. (1999). Thrombospondins I and II messenger RNA expression in lung carcinoma: relationship with p53 alterations, angiogenic growth factors, and vascular density. Clin Cancer Res 5, 155-161. 132 Frankel, E. N. (1993). In search of better methods to evaluate natural antioxidants and oxidative stability in food lipids. Trends Food Sex Technol 4, 220-225. Frankel, E. N., and Meyer, A. S. (2000). The problems of using one-dimensional methods to evaluate multifunctional food and biological antioxidants. J Sci Food Agric 80, 1925-1941. Friese, M. A., Platten, M., Lutz, S. Z., Naumann, U., Aulwurm, S., Bischof, F., Buhring, H. J., Dichgans, J., Rammensee, H. G., Steinle, A., and Weller, M. (2003). MICA/NKG2D-mediated immunogene therapy of experimental gliomas. Cancer Res 63, 8996-9006. Friguet, B., Bulteau, A. L., and Petropoulos, I. (2008). Mitochondrial protein quality control: implications in ageing. Biotechnol Jr3, 757-764. Fuentes, M. K., Nigavekar, S. S., Arumugam, T., Logsdon, C. D., Schmidt, A. M., Park, J. C, and Huang, E. H. (2007). RAGE activation by SI OOP in colon cancer stimulates growth, migration, and cell signaling pathways. Dis Colon Rectum 50, 1230-1240. Fukumoto, L. R., and Mazza, G. (2000). Assessing antioxidant and prooxidant activities of phenolic compounds. J Agric Food Chem 48, 3597-3604. Gabai, V. L., Meriin, A. B., Mosser, D. D., Caron, A. W., Rits, S., Shifrin, V. I., and Sherman, M. Y. (1997). Hsp70 prevents activation of stress kinases. A novel pathway of cellular thermotolerance. J Biol Chem 272,18033-18037. Gabai, V. L., Yaglom, J. A., Volloch, V., Meriin, A. B., Force, T., Koutroumanis, M., Massie, B., Mosser, D. D., and Sherman, M. Y. (2000). Hsp72-mediated suppression of c-Jun N-terminal kinase is implicated in development of tolerance to caspase-independent cell death. Mol Cell Biol 20, 6826-6836. Garbi, N., Tanaka, S., van den Broek, M., Momburg, F., and Hammerling, G. J. (2005). Accessory molecules in the assembly of major histocompatibility complex class I/peptide complexes: how essential are they for CD8(+) T-cell immune responses? Immunol Rev 207, 77-88. Gates, M. A., Tworoger, S. S., Hecht, J. L., De Vivo, I., Rosner, B., and Hankinson, S. E. (2007). A prospective study of dietary flavonoid intake and incidence of epithelial ovarian cancer. Int J Cancer 121, 2225-2232. Geisler, S., Lonning, P. E., Aas, T., Johnsen, H., Fluge, O., Haugen, D. F., Lillehaug, J. R., Akslen, L. A., and Borresen-Dale, A. L. (2001). Influence of TP53 gene alterations and c-erbB-2 expression on the response to treatment with doxorubicin in locally advanced breast cancer. Cancer Res 61, 2505-2512. Ghosh, J., and Myers, C. E. (1998). Inhibition of arachidonate 5-lipoxygenase triggers massive apoptosis in human prostate cancer cells. Proc Nad Acad Sci USA 95, 13182-13187. Gilbert, H. F. (1990). Molecular and cellular aspects of thiol-disulfide exchange. Adv Enzymol Relat Areas Mol Biol 63, 69-172. Govindarajan, R., Vijayakumar, M., Rao, C. H. V., Shirwaikar, A., Kumar, S., Rawat, A. K., and Pushpangadan, P. (2007). Antiinflammatory and antioxidant activities of Desmodium gangeticum fractions in carrageenan-induced inflamed rats. PhytotherRes 21, 975-979. 133 Grinberg, A. V., and Kerppola, T. (2003). Both Max and TFE3 cooperate with Smad proteins to bind the plasminogen activator inhibitor-1 promoter, but they have opposite effects on transcriptional activity. J Biol Chem 278, 11227-11236. Grollman, A. P., and Moriya, M. (1993). Mutagenesis by 8-oxoguanine: an enemy within. Trends Genet 9, 246-249. Grossfeld, G. D., Ginsberg, D. A., Stein, J. P., Bochner, B. H., Esrig, D., Groshen, S., Dunn, M., Nichols, P. W., Taylor, C. R., Skinner, D. G., and Cote, R. J. (1997). Thrombospondin-1 expression in bladder cancer: association with p53 alterations, tumor angiogenesis, and tumor progression. J Natl Cancer Inst 89, 219-227. Guerreiro Da Silva, I. D., Hu, Y. F., Russo, I. H., Ao, X., Salicioni, A. M., Yang, X., and Russo, J. (2000). SI OOP calcium-binding protein overexpression is associated with immortalization of human breast epithelial cells in vitro and early stages of breast cancer development in vivo. IntJ Oncol 16, 231-240. Guner, G., Kirkali, G., Yenisey, C, and Tore, I. R. (1992). Cytosol and serum ferritin in breast carcinoma. Cancer Lett 67, 103-112. Guo, Y. H., Chen, K., Gao, W., Li, Q., Chen, L., Wang, G. S., and Tang, J. (2007). Overexpression of Mitofusin 2 inhibited oxidized low-density lipoprotein induced vascular smooth muscle cell proliferation and reduced atherosclerotic lesion formation in rabbit. Biochem Biophys Res Commun 363, 411-417. Gusman, J., Malonne, H., and Atassi, G. (2001). A reappraisal of the potential chemopreventive and chemotherapeutic properties of resveratrol. Carcinogenesis 22,1111-1117. Gutteridge, J. M., and Halliwell, B. (2000). Free radicals and antioxidants in the year 2000. A historical look to the future. Ann N YAcadSci 899, 136-147. Hall, J. M., and McDonnell, D. P. (1999). The estrogen receptor beta-isoform (ERbeta) of the human estrogen receptor modulates ERalpha transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140, 5566-5578. Halliwell, B., and Gutteridge, J. M. C. (1989). Free Radicals in Biology and Medicine. Clarendon Press, Second Edition; Oxford, UK. Halliwell, B., and Gutteridge, J. M. C. (1999). Free Radicals in Biology and Medicine. Oxford University Press, third edition; Oxford, UK. Halliwell, B., and Gutteridge, J. M. C. (2007). Free Radicals in Biology and Medicine. Clarendon Press, Fourth Edition; Oxford, UK. Hammamieh, R., Chakraborty, N., Miller, S. A., Waddy, E., Barmada, M., Das, R., Peel, S. A., Day, A. A., and Jett, M. (2007). Differential effects of omega-3 and omega- 6 Fatty acids on gene expression in breast cancer cells. Breast Cancer Res Treat 101,7-16. Han, E. H., Kim, J. Y., and Jeong, H. G. (2006). Effect of biochanin A on the aryl hydrocarbon receptor and cytochrome P450 1A1 in MCF-7 human breast carcinoma cells. Arch Pharm Res 29, 570-576. Handayani, R., Rice, L., Cui, Y., Medrano, T. A., Samedi, V. G., Baker, H. V., Szabo, N. J., and Shiverick, K. T. (2006). Soy isoflavones alter expression of genes associated with cancer progression, including interleukin-8, in androgen- independent PC-3 human prostate cancer cells. JNutr 136, 75-82. 134 Harborne, J. B., and Williams, C. A. (2000). Advances in flavonoid research since 1992. Phytochemistry 55, 481 -504. Harkins, B., and Geyer, C. E., Jr. (2007). Overcoming treatment challenges in advanced breast cancer. Semin OncolNurs 23, SI0-16. He, F. J., Wang, J., Niu, J. Z., and Wang, J. F. (2002). [The inhibiting effect of genistein on the growth of human breast cancer cells in vitro]. Zhongguo Zhong Yao Za Zhi 27, 936-939. Health-Canada (2008). It's Your Health - Reducing the Risk of Breast Cancer. In. www, hc-sc. gc. ca/ivh-vsv/diseases-maladies/breast-sein_e. html. Health Canada. Heinonen, S. M., Hoikkala, A., Wahala, K., and Adlercreutz, H. (2003). Metabolism of the soy isoflavones daidzein, genistein and glycitein in human subjects. Identification of new metabolites having an intact isoflavonoid skeleton. J Steroid Biochem Mol Biol 87,285-299. Heppner, G. H., Miller, F. R., and Shekhar, P. M. (2000). Nontransgenic models of breast cancer. Breast Cancer Res 2, 331-334. Herst, P. M., Petersen, T., Jerram, P., Baty, J., and Berridge, M. V. (2007). The antiproliferative effects of phenoxodiol are associated with inhibition of plasma membrane electron transport in tumour cell lines and primary immune cells. Biochem Pharmacol 1 A, 1587-1595. Hery, C, Ferlay, J., Boniol, M., and Autier, P. (2008). Quantification of changes in breast cancer incidence and mortality since 1990 in 35 countries with Caucasian- majority populations. Ann Oncol 19, 1187-1194. Higgins, J. P., Kaygusuz, G., Wang, L., Montgomery, K., Mason, V., Zhu, S. X., Marinelli, R. J., Presti, J. C, Jr., van de Rijn, M., and Brooks, J. D. (2007). Placental SI00 (SIOOP) and GATA3: markers for transitional epithelium and urothelial carcinoma discovered by complementary DNA microarray. Am J Surg Pathol 31, 673-680. Hirota, K., Murata, M., Sachi, Y., Nakamura, H., Takeuchi, J., Mori, K., and Yodoi, J. (1999). Distinct roles of thioredoxin in the cytoplasm and in the nucleus. A two- step mechanism of redox regulation of transcription factor NF-kappaB. J Biol Chem 21 A, 27891-27897. Hitchler, M. J., Wikainapakul, K., Yu, L., Powers, K., Attatippaholkun, W., and Domann, F. E. (2006). Epigenetic regulation of manganese superoxide dismutase expression in human breast cancer cells. Epigenetics 1,163-171. Holmgren, A., and Luthman, M. (1978). Tissue distrubution and subcellular localization of bovine thioredoxin determined by radioimmunoassay. Biochemistry 17, 4071- 4077. Huang, D., Ou, B., and Prior, R. L. (2005). The chemistry behind antioxidant capacity assays. JAgric Food Chem 53, 1841-1856. Huang, P., Yu, T., and Yoon, Y. (2007). Mitochondrial clustering induced by overexpression of the mitochondrial fusion protein Mfn2 causes mitochondrial dysfunction and cell death. Eur J Cell Biol 86, 289-302. Hussain, S. A., Palmer, D. H., Spooner, D., and Rea, D. W. (2007). Molecularly targeted therapeutics for breast cancer. BioDrugs 21, 215-224. Hussain, S. P., Hofseth, L. J., and Harris, C. C. (2003). Radical causes of cancer. Nat Rev Cancer 3, 276-285. 135 Husson, H., Carideo, E. G., Neuberg, D., Schultze, J., Munoz, O., Marks, P. W., Donovan, J. W., Chillemi, A. C, O'Connell, P., and Freedman, A. S. (2002). Gene expression profiling of follicular lymphoma and normal germinal center B cells using cDNA arrays. Blood 99, 282-289. Inoue, M., Sato, E. F., Nishikawa, M., Park, A. M., Kira, Y., Imada, I., and Utsumi, K. (2003). Mitochondrial generation of reactive oxygen species and its role in aerobic life. Curr Med Chem 10, 2495-2505. Iorio, M. V., Ferracin, M., Liu, C. G., Veronese, A., Spizzo, R., Sabbioni, S., Magri, E., Pedriali, M., Fabbri, M., Campiglio, M., Menard, S., Palazzo, J. P., Rosenberg, A., Musiani, P., Volinia, S., Nenci, I., Calin, G. A., Querzoli, P., Negrini, M., and Croce, C. M. (2005). MicroRNA gene expression deregulation in human breast cancer. Cancer Res 65, 7065-7070. Ishida, S., Jinno, H., Tanaka-Kagawa, T., Ando, M., Ohno, Y., Ozawa, S., and Sawada, J. (2002). Characterization of human CYP1A1/1A2 induction by DNA microarray and alpha-naphthoflavone. Biochem Biophys Res Commun 296,172-177. Itahana, Y., Singh, J., Sumida, T., Coppe, J. P., Parrinello, S., Bennington, J. L., and Desprez, P. Y. (2003). Role of Id-2 in the maintenance of a differentiated and noninvasive phenotype in breast cancer cells. Cancer Res 63, 7098-7105. Jarvinen, T. A., and Liu, E. T. (2006). Simultaneous amplification of HER-2 (ERBB2) and topoisomerase Ilalpha (TOP2A) genes—molecular basis for combination chemotherapy in cancer. Curr Cancer Drug Targets 6, 579-602. Jarvinen, T. A., Tanner, M., Rantanen, V., Barlund, M., Borg, A., Grenman, S., and Isola, J. (2000). Amplification and deletion of topoisomerase Ilalpha associate with ErbB-2 amplification and affect sensitivity to topoisomerase II inhibitor doxorubicin in breast cancer. Am J Pathol 156, 839-847. Jha, H. C, von Recklinghausen, G., and Zilliken, F. (1985). Inhibition of in vitro microsomal lipid peroxidation by isoflavonoids. Biochem Pharmacol 34, 1367- 1369. Jin, S., Antinore, M. J., Lung, F. D., Dong, X., Zhao, H., Fan, F., Colchagie, A. B., Blanck, P., Roller, P. P., Fornace, A. J., Jr., and Zhan, Q. (2000). The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem 275, 16602-16608. Joannou, G. E., Kelly, G. E., Reeder, A. Y., Waring, M., and Nelson, C. (1995). A urinary profile study of dietary phytoestrogens. The identification and mode of metabolism of new isoflavonoids. J Steroid Biochem Mol Biol 54, 167-184. Johnson, I. T. (2002). Anticarcinogenic effects of diet-related apoptosis in the colorectal mucosa. Food Chem Toxicol 40, 1171-1178. Johnson, S. M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng, A., Labourier, E., Reinert, K. L., Brown, D., and Slack, F. J. (2005). RAS is regulated by the let- 7 microRNA family. Cell 120, 635-647. Jolly, C, and Morimoto, R. I. (2000). Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Natl Cancer Inst 92, 1564-1572. Ju, B. G., Lunyak, V. V., Perissi, V., Garcia-Bassets, I., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (2006). A topoisomerase Ilbeta-mediated dsDNA break required for regulated transcription. Science 312, 1798-1802. 136 Kagawa, T. F., Geierstanger, B. H., Wang, A. H., and Ho, P. S. (1991). Covalent modification of guanine bases in double-stranded DNA. The 1.2-A Z-DNA structure of d(CGCGCG) in the presence of CuC12. J Biol Chem 266, 20175- 20184. Kamb, A. (2005). What's wrong with our cancer models? Nat Rev Drug Discov 4, 161- 165. Kampa, M., Nifli, A. P., Notas, G., and Castanas, E. (2007). Polyphenols and cancer cell growth. Rev Physiol Biochem Pharmacol 159, 79-113. Kandioler-Eckersberger, D., Ludwig, C, Rudas, M, Kappel, S., Janschek, E., Wenzel, C, Schlagbauer-Wadl, H., Mittlbock, M., Gnant, M., Steger, G., and Jakesz, R. (2000). TP53 mutation and p53 overexpression for prediction of response to neoadjuvant treatment in breast cancer patients. Clin Cancer Res 6, 50-56. Karbowski, M., Norris, K. L., Cleland, M. M., Jeong, S. Y., and Youle, R. J. (2006). Role of Bax and Bak in mitochondrial morphogenesis. Nature 443, 658-662. Kaushik, G., Kaushik, T., Khanduja, S., Pathak, C. M., and Khanduja, K. L. (2008). Cigarette smoke condensate promotes cell proliferation through disturbance in cellular redox homeostasis of transformed lung epithelial type-II cells. Cancer Lett, in press. Kawai, K., Tsuno, N. H., Kitayama, J., Okaji, Y., Yazawa, K., Asakage, M., Sasaki, S., Watanabe, T., Takahashi, K., and Nagawa, H. (2005). Epigallocatechin gallate induces apoptosis of monocytes. J Allergy Clin Immunol 115, 186-191. Kellis, J. T., Jr., and Vickery, L. E. (1984). Inhibition of human estrogen synthetase (aromatase) by ftavones. Science 225, 1032-1034. Kerr, I. D. (2004). Sequence analysis of twin ATP binding cassette proteins involved in translational control, antibiotic resistance, and ribonuclease L inhibition. Biochem Biophys Res Commun 315,166-173. Khan, S. A., Rogers, M. A., Obando, J. A., and Tamsen, A. (1994). Estrogen receptor expression of benign breast epithelium and its association with breast cancer. Cancer Res 54, 993-997. Kletzien, R. F., Harris, P. K., and Foellmi, L. A. (1994). Glucose-6-phosphate dehydrogenase: a "housekeeping" enzyme subject to tissue-specific regulation by hormones, nutrients, and oxidant stress. FASEBJS, 174-181. Kloetzel, P. M. (2004). Generation of major histocompatibility complex class I antigens: functional interplay between proteasomes and TPPII. Nat Immunol 5, 661-669. Konturek, P. C, Kania, J., Konturek, J. W., Nikiforuk, A., Konturek, S. J., and Hahn, E. G. (2003). H. pylori infection, atrophic gastritis, cytokines, gastrin, COX-2, PPAR gamma and impaired apoptosis in gastric carcinogenesis. Med Sci Monit 9, SR53-66. Kowanetz, M., Valcourt, U., Bergstrom, R., Heldin, C. H., and Moustakas, A. (2004). Id2 and Id3 define the potency of cell proliferation and differentiation responses to transforming growth factor beta and bone morphogenetic protein. Mol Cell Biol 24,4241-4254. Kumar, M. S., Lu, J., Mercer, K. L., Golub, T. R., and Jacks, T. (2007). Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat Genet 3,9, 613-611. 137 Kuniyasu, H., Chihara, Y., Kondo, H., Ohmori, H., and Ukai, R. (2003a). Amphoterin induction in prostatic stromal cells by androgen deprivation is associated with metastatic prostate cancer. Oncol Rep 10,1863-1868. Kuniyasu, H., Chihara, Y., and Takahashi, T. (2003b). Co-expression of receptor for advanced glycation end products and the ligand amphoterin associates closely with metastasis of colorectal cancer. Oncol Rep 10, 445-448. Kupeli, E., Orhan, I., Toker, G., and Yesilada, E. (2006). Anti-inflammatory and antinociceptive potential of Madura pomifera (Rafin.) Schneider fruit extracts and its major isoflavonoids, scandenone and auriculasin. J Ethnopharm 107, 169- 174. Lai, H., Lin, L., Nadji, M., Lai, S., Trapido, E., and Meng, L. (2002). Mutations in the p53 tumor suppressor gene and early onset breast cancer. Cancer Biol Ther 1, 31- 36. Landis, G. N., and Tower, J. (2005). Superoxide dismutase evolution and life span regulation. Mech Ageing Dev 126, 365-379. Lasorella, A., Noseda, M., Beyna, M., Yokota, Y., and Iavarone, A. (2000). Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature 407, 592-598. Lawson, J. S., Field, A. S., Champion, S., Tran, D., Ishikura, H., and Trichopoulos, D. (1999). Low oestrogen receptor alpha expression in normal breast tissue underlies low breast cancer incidence in Japan. Lancet 354,1787-1788. Lawson, J. S., Field, A. S., Tran, D. D., Killeen, J., Maskarenic, G., Ishikura, H., and Trichopoulos, D. (2002). Breast cancer incidence and estrogen receptor alpha in normal mammary tissue—an epidemiologic study among Japanese women in Japan and Hawaii. Int J Cancer 97, 685-687. Lee, C. H. A., Yang, L. A., Xu, J. Z. A., Yeung, S. Y. V. A., Huang, Y. A., and Chen, Z. Y. A. R. A. (2005a). Relative antioxidant activity of soybean isoflavones and their glycosides. FoodChem 90, 735-741. Lee, H. J., Wang, C. J., Kuo, H. C, Chou, F. P., Jean, L. F., and Tseng, T. H. (2005b). Induction apoptosis of luteolin in human hepatoma HepG2 cells involving mitochondria translocation of Bax/Bak and activation of JNK. Toxicol Appl Pharmacol203, 124-131. Lee, K. T., Sohn, I. C, Kim, Y. K., Choi, J. H., Choi, J. W., Park, H. J., Itoh, Y., and Miyamoto, K. (2001). Tectorigenin, an isoflavone of Pueraria thunbergiana Benth., induces differentiation and apoptosis in human promyelocytic leukemia HL-60 cells. Biol Pharm Bull 24, 1117-1121. Lee, K. W., and Lee, H. J. (2006). The roles of polyphenols in cancer chemoprevention. Biofactors 26,105-121. Lee, O. J., Schneider-Stock, R., McChesney, P. A., Kuester, D., Roessner, A., Vieth, M., Moskaluk, C. A., and El-Rifai, W. (2005c). Hypermethylation and loss of expression of glutathione peroxidase-3 in Barrett's tumorigenesis. Neoplasia 7, 854-861. Lei, M. (2005). The MCM complex: its role in DNA replication and implications for cancer therapy. Curr Cancer Drug Targets 5, 365-380. Lei, X. G., Cheng, W. H., and McClung, J. P. (2007). Metabolic regulation and function of glutathione peroxidase-1. Annu Rev Nutr 27, 41 -61. 138 Leonard, S. S., Harris, G. K., and Shi, X. (2004). Metal-induced oxidative stress and signal transduction. Free Radic Biol Med'37, 1921-1942. Levine, M. (2001). Clinical practice guidelines for the care and treatment of breast cancer: adjuvant systemic therapy for node-negative breast cancer (summary of the 2001 update). CMA J164, 213. Leygue, E., Dotzlaw, H., Watson, P. H., and Murphy, L. C. (1998). Altered estrogen receptor alpha and beta messenger RNA expression during human breast tumorigenesis. Cancer Res 58, 3197-3201. Li, J. J., Oberley, L. W., Fan, M., and Colburn, N. H. (1998). Inhibition of AP-1 and NF- kappaB by manganese-containing superoxide dismutase in human breast cancer cells. FASEB J12,1713-1723. Li, J. J., Oberley, L. W., St Clair, D. K., Ridnour, L. A., and Oberley, T. D. (1995). Phenotypic changes induced in human breast cancer cells by overexpression of manganese-containing superoxide dismutase. Oncogene 10, 1989-2000. Li, M., Zhang, Z., Hill, D. L., Chen, X., Wang, H., and Zhang, R. (2005). Genistein, a dietary isoflavone, down-regulates the MDM2 oncogene at both transcriptional and posttranslational levels. Cancer Res 65, 8200-8208. Li, Q., and Engelhardt, J. F. (2006). Interleukin-lbeta induction of NFkappaB is partially regulated by H202-mediated activation of NFkappaB-inducing kinase. J Biol Chem 281,1495-1505. Li, Q., Sanlioglu, S., Li, S., Ritchie, T., Oberley, L., and Engelhardt, J. F. (2001). GPx-1 gene delivery modulates NFkappaB activation following diverse environmental injuries through a specific subunit of the IKK complex. Antioxid Redox Signal 3, 415-432. Li, T. K., and Liu, L. F. (2001). Tumor cell death induced by topoisomerase-targeting drugs. Annu Rev Pharmacol Toxicol 41, 53-77. Li, Y., St John, M. A., Zhou, X., Kim, Y., Sinha, U., Jordan, R. C, Eisele, D., Abemayor, E., Elashoff, D., Park, N. H., and Wong, D. T. (2004). Salivary transcriptome diagnostics for oral cancer detection. Clin Cancer Res 10, 8442-8450. Lian, F., Bhuiyan, M., Li, Y. W., Wall, N., Kraut, M., and Sarkar, F. H. (1998). Genistein-induced G2-M arrest, p21WAFl upregulation, and apoptosis in a non- small-cell lung cancer cell line. Nutr Cancer 31, 184-191. Lin, J., Zhang, S. M., Wu, K., Willett, W. C, Fuchs, C. S., and Giovannucci, E. (2006). Flavonoid intake and colorectal cancer risk in men and women. Am J Epidemiol 164,644-651. Linn, S. C, Pinedo, H. M., van Ark-Otte, J., van der Valk, P., Hoekman, K., Honkoop, A. H., Vermorken, J. B., and Giaccone, G. (1997). Expression of drug resistance proteins in breast cancer, in relation to chemotherapy. Int J Cancer 71, 787-795. Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408. Loeb, G. A., Skelton, D. C, Coates, T. D., and Forman, H. J. (1988). Role of selenium- dependent glutathione peroxidase in antioxidant defenses in rat alveolar macrophages. Exp Lung Res 14 Suppl, 921-936. Loft, S., and Poulsen, H. E. (1996). Cancer risk and oxidative DNA damage in man. J Mol Med 74, 297-312. 139 Loo, G. (2003). Redox-sensitive mechanisms of phytochemical-mediated inhibition of cancer cell proliferation (review). JNutr Biochem 14, 64-73. Lopes, U. G., Erhardt, P., Yao, R., and Cooper, G. M. (1997). p53-dependent induction of apoptosis by proteasome inhibitors. J Biol Chem 272,12893-12896. Lu, J., Getz, G., Miska, E. A., Alvarez-Saavedra, E., Lamb, J., Peck, D., Sweet-Cordero, A., Ebert, B. L., Mak, R. H., Ferrando, A. A., Downing, J. R., Jacks, T., Horvitz, H. R., and Golub, T. R. (2005). MicroRNA expression profiles classify human cancers. Nature 435, 834-838. MacFarlane, M., and Williams, A. C. (2004). Apoptosis and disease: a life or death decision. EMBO Rep 5, 674-678. Mackay, A., Jones, C., Dexter, T., Silva, R. L., Bulmer, K., Jones, A., Simpson, P., Harris, R..A., Jat, P. S., Neville, A. M., Reis, L. F., Lakhani, S. R., and O'Hare, M. J. (2003). cDNA microarray analysis of genes associated with ERBB2 (HER2/neu) overexpression in human mammary luminal epithelial cells. Oncogene 22, 2680- 2688. Mahmoud, Z. F. (1981). Antimicrobial Components from Madura pomifera Fruit. Planta Med 42, 299-301. Manju, V., Balasubramaniyan, V., and Nalini, N. (2005). Rat colonic lipid peroxidation and antioxidant status: the effects of dietary luteolin on 1,2-dimethylhydrazine challenge. Cell Mol Biol Lett 10, 535-551. Mannervik, B., and Danielson, U. H. (1988). Glutathione transferases—structure and catalytic activity. CRC Crit Rev Biochem 23, 283-337. Mano, M. S., Rosa, D. D., De Azambuja, E., Ismael, G. F., and Durbecq, V. (2007). The 17ql2-q21 amplicon: Her2 and topoisomerase-IIalpha and their importance to the biology of solid tumours. Cancer Treat Rev 33, 64-77. Marnett, L. J. (1999). Lipid peroxidation-DNA damage by malondialdehyde. Mutat Res 424,83-95. Marnett, L. J. (2000). Oxyradicals and DNA damage. Carcinogenesis 21, 361-370. Masella, R., Di Benedetto, R., Vari, R., Filesi, C, and Giovannini, C. (2005). Novel mechanisms of natural antioxidant compounds in biological systems: involvement of glutathione and glutathione-related enzymes. JNutr Biochem 16, 577-586. Masuda, M., Suzui, M., and Weinstein, I. B. (2001). Effects of epigallocatechin-3-gallate on growth, epidermal growth factor receptor signaling pathways, gene expression, and chemosensitivity in human head and neck squamous cell carcinoma cell lines. Clin Cancer Res 7,4220-4229. Mates, J. M., Perez-Gomez, C, and Nunez de Castro, I. (1999). Antioxidant enzymes and human diseases. Clin Biochem 32, 595-603. Mathur, M., Das, S., and Samuels, H. H. (2003). PSF-TFE3 oncoprotein in papillary renal cell carcinoma inactivates TFE3 and p53 through cytoplasmic sequestration. Oncogene 22, 5031-5044. Matthews, J., and Gustafsson, J. A. (2003). Estrogen signaling: a subtle balance between ER alpha and ER beta. Mol Interv 3,281-292. Mattie, M. D., Benz, C. C, Bowers, J., Sensinger, K., Wong, L., Scott, G. K., Fedele, V., Ginzinger, D., Getts, R., and Haqq, C. (2006). Optimized high-throughput microRNA expression profiling provides novel biomarker assessment of clinical prostate and breast cancer biopsies. Mol Cancer 5, 24. 140 McCall, M. R., and Frei, B. (1999). Can antioxidant vitamins materially reduce oxidative damage in humans? Free Radic Biol Med26, 1034-1053. McGuire, W. L. (1978). Hormone receptors: their role in predicting prognosis and response to endocrine therapy. Semin Oncol 5, 428-433. Meister, A. (1988). Glutathione metabolism and its selective modification. J Biol Chem 263, 17205-17208. Michels, G., Watjen, W., Niering, P., Steffan, B., Thi, Q. H., Chovolou, Y., Kampkotter, A., Bast, A., Proksch, P., and Kahl, R. (2005). Pro-apoptotic effects of the flavonoid luteolin in rat H4IIE cells. Toxicology 206, 337-348. Miller, H. E. (1971). A simplified method for the evaluation of antioxidants. J Am Oil Chem Soc 48,91-95. Mitchell, J. H., Gardner, P. T., McPhail, D. B., Morrice, P. C, Collins, A. R., and Duthie, G. G. (1998). Antioxidant efficacy of phytoestrogens in chemical and biological model systems. Arch Biochem Biophys 360,142-148. Miyazawa, K., Shinozaki, M., Hara, T., Furuya, T., and Miyazono, K. (2002). Two major Smad pathways in TGF-beta superfamily signalling. Genes Cells 7,1191-1204. Miyazono, K., and Miyazawa, K. (2002). Id: a target of BMP signaling. Sci STKE 2002, PE40. Mizunuma, H., Kanazawa, K., Ogura, S., Otsuka, S., and Nagai, H. (2002). Anticarcinogenic effects of isoflavones may be mediated by genistein in mouse mammary tumor virus-induced breast cancer. Oncology 62, 78-84. Molina, M. F., Sanchez-Reus, I., Iglesias, I., and Benedi, J. (2003). Quercetin, a flavonoid antioxidant, prevents and protects against ethanol-induced oxidative stress in mouse liver. Biol Pharm Bull 26, 1398-1402. Monteiro, R., Becker, H., Azevedo, I., and Calhau, C. (2006). Effect of hop (Humulus lupulus L.) flavonoids on aromatase (estrogen synthase) activity. J Agric Food Chem 54, 2938-2943. Moon, Y. J., Shin, B. S., An, G., and Morris, M. E. (2008). Biochanin A Inhibits Breast Cancer Tumor Growth in A Murine Xenograft Model. Pharm Res. in press. Moon, Y. J., Wang, X., and Morris, M. E. (2006). Dietary flavonoids: effects on xenobiotic and carcinogen metabolism. Toxicol In Vitro 20, 187-210. Mori, S., Nishikawa, S. I., and Yokota, Y. (2000). Lactation defect in mice lacking the helix-loop-helix inhibitor Id2. EMBO J19, 5772-5781. Moriwaki, Y., Yamamoto, T., and Higashino, K. (1999). Enzymes involved in purine metabolism—a review of histochemical localization and functional implications. Histol Histopathol 14,1321-1340. Mork, H., al-Taie, O. H., Bahr, K., Zierer, A., Beck, C, Scheurlen, M., Jakob, F., and Kohrle, J. (2000). Inverse mRNA expression of the selenocysteine-containing proteins GI-GPx and SeP in colorectal adenomas compared with adjacent normal mucosa. Nutr Cancer 37, 108-116. Mork, H., Scheurlen, M., Al-Taie, O., Zierer, A., Kraus, M., Schottker, K., Jakob, F., and Kohrle, J. (2003). Glutathione peroxidase isoforms as part of the local antioxidative defense system in normal and Barrett's esophagus. Int J Cancer 105, 300-304. Morton, M. S., Chan, P. S., Cheng, C, Blacklock, N., Matos-Ferreira, A., Abranches- Monteiro, L., Correia, R., Lloyd, S., and Griffiths, K. (1997). Lignans and 141 isoflavonoids in plasma and prostatic fluid in men: samples from Portugal, Hong- Kong, and the United Kingdom. Prostate 32, 122-128. Mousses, S., Bubendorf, L., Wagner, U., Hostetter, G., Kononen, J., Cornelison, R., Goldberger, N., Elkahloun, A. G., Willi, N., Koivisto, P., Ferhle, W., Raffeld, M., Sauter, G., and Kallioniemi, O. P. (2002). Clinical validation of candidate genes associated with prostate cancer progression in the CWR22 model system using tissue microarrays. Cancer Res 62,1256-1260. Murphy, L., Cherlet, T., Lewis, A., Banu, Y., and Watson, P. (2003). New insights into estrogen receptor function in human breast cancer. Ann Med 35, 614-631. Murphy, L. C, and Watson, P. (2002). Steroid receptors in human breast tumorigenesis and breast cancer progression. Biomed Pharmacother 56, 65-77. Muzio, M., Salvesen, G. S., and Dixit, V. M. (1997). FLICE induced apoptosis in a cell- free system. Cleavage of caspase zymogens. J Biol Chem 272, 2952-2956. Nagata, S. (1997). Apoptosis by death factor. Cell 88, 355-365. Nakajima, M., Itoh, M., Yamanaka, H., Fukami, T., Tokudome, S., Yamamoto, Y., Yamamoto, H., and Yokoi, T. (2006). Isoflavones inhibit nicotine C-oxidation catalyzed by human CYP2A6. J Clin Pharmacol 46, 337-344. Nakamura, H., Nakamura, K., and Yodoi, J. (1997). Redox regulation of cellular activation. Annu Rev Immunol 15, 351-369. Nakamura, N., Kimura, Y., Tokuda, M., Honda, S., and Hirose, S. (2006). MARCH-V is a novel mitofusin 2- and Drpl-binding protein able to change mitochondrial morphology. EMBO Rep 7, 1019-1022. Nanda, R. (2007). Targeting the human epidermal growth factor receptor 2 (HER2) in the treatment of breast cancer: recent advances and future directions. Rev Recent Clin Trials 2, 111-116. Nelson, K. K., and Melendez, J. A. (2004). Mitochondrial redox control of matrix metalloproteinases. Free Radic Biol Med 37, 768-784. Nelson, K. K., Subbaram, S., Connor, K. M., Dasgupta, J., Ha, X. F., Meng, T. C, Tonks, N. K., and Melendez, J. A. (2006). Redox-dependent matrix metalloproteinase-1 expression is regulated by JNK through Ets and AP-1 promoter motifs. J Biol Chem 281, 14100-14110. Neuspiel, M., Zunino, R., Gangaraju, S., Rippstein, P., and McBride, H. (2005). Activated mitofusin 2 signals mitochondrial fusion, interferes with Bax activation, and reduces susceptibility to radical induced depolarization. J Biol Chem 280, 25060-25070. Ng, F. W., Nguyen, M., Kwan, T., Branton, P. E., Nicholson, D. W., Cromlish, J. A., and Shore, G. C. (1997). p28 Bap31, a Bcl-2/Bcl-XL- and procaspase-8-associated protein in the endoplasmic reticulum. J Cell Biol 139, 327-338. Nishigori, C, Hattori, Y., and Toyokuni, S. (2004). Role of reactive oxygen species in skin carcinogenesis. Antioxid Redox Signal 6, 561-570. Norton, J. D., Deed, R. W., Craggs, G., and Sablitzky, F. (1998). Id helix-loop-helix proteins in cell growth and differentiation. Trends Cell Biol 8, 58-65. Nothlings, U., Murphy, S. P., Wilkens, L. R., Henderson, B. E., and Kolonel, L. N. (2007). Flavonols and pancreatic cancer risk: the multiethnic cohort study. Am J Epidemiol 166,924-931. 142 Nylandsted, J., Brand, K., and Jaattela, M. (2000). Heat shock protein 70 is required for the survival of cancer cells. Ann N YAcadSci 926, 122-125. Oberholzer, P. A., Urosevic, M., Steinert, H. C. and Dummer, R. (2008). Baseline staging of melanoma with unknown primary site: the value of serum si00 protein and positron emission tomography. Dermatology 217:351-355. Oberley, L. W., and Oberley, T. D. (1994). Reactive oxygen species in the aetiology of cancer. In Drugs, Diet, and Disease, Vol. 1. (C. Ioannides, and D. V. Lewis, Eds.), pp. 49-63, Prentice Hall. Ohuchida, K., Mizumoto, K., Egami, T., Yamaguchi, H., Fujii, K., Konomi, H., Nagai, E., Yamaguchi, K., Tsuneyoshi, M., and Tanaka, M. (2006). SI OOP is an early developmental marker of pancreatic carcinogenesis. Clin Cancer Res 12, 5411- 5416. Okada, F., Tazawa, H., Kobayashi, T., Kobayashi, M., and Hosokawa, M. (2006). Involvement of reactive nitrogen oxides for acquisition of metastatic properties of benign tumors in a model of inflammation-based tumor progression. Nitric Oxide 14, 122-129. Orr, F. W., and Wang, H. H. (2001). Tumor cell interactions with the micro vasculature: a rate-limiting step in metastasis. Surg Oncol Clin N Am 10, 357-381, ix-x. Park, H. S., Lee, J. S., Huh, S. H., Seo, J. S., and Choi, E. J. (2001). Hsp72 functions as a natural inhibitory protein of c-Jun N-terminal kinase. EMBO J20,446-456. Park, S. Y., and Seol, D. W. (2002). Regulation of Akt by EGF-R inhibitors, a possible mechanism of EGF-R inhibitor-enhanced TRAIL-induced apoptosis. Biochem Biophys Res Commun 295, 515-518. Parkkila, S., Pan, P. W., Ward, A., Gibadulinova, A., Oveckova, I., Pastorekova, S., Pastorek, J., Martinez, A. R., Helin, H. O., and Isola, J. (2008). The calcium- binding protein SI OOP in normal and malignant human tissues. BMC Clin Pathol 8,2. Peattie, D. C. (1953). A Natural History of Western Trees. Houghton Mifflin, Boston, MA. Peng, B., Lu, B., Leygue, E., and Murphy, L. C. (2003). Putative functional characteristics of human estrogen receptor-beta isoforms. J Mol Endocrinol 30, 13-29. Peterson, C, and Coats, J. (2001). Insect repellents - past, present and future. Pesticide Outlook 4, 155-158. Peterson, C, Fristad, A., Tsao, R., and Coats, J. R. (2000). Osajin and pomiferin, two isoflavones purified from osage orange fruits, tested for repellency to the maize weevil (Coleoptera: Curculionidae). Environmental-Entomology. 29, 1133-1137. Peterson, T. G., Coward, L., Kirk, M., Falany, C. N., and Barnes, S. (1996). The role of metabolism in mammary epithelial cell growth inhibition by the isoflavones genistein and biochanin A. Carcinogenesis 17, 1861-1869. Peterson, T. G., Ji, G. P., Kirk, M., Coward, L., Falany, C. N., and Barnes, S. (1998). Metabolism of the isoflavones genistein and biochanin A in human breast cancer cell lines. Am J Clin Nutr 68, 1505S-151 IS. Pfaffi, M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, e45. 143 Pharoah, P. D., Day, N. E., and Caldas, C. (1999). Somatic mutations in the p53 gene and prognosis in breast cancer: a meta-analysis. Br J Cancer 80, 1968-1973. Piao, M., Mori, D., Satoh, T., Sugita, Y., and Tokunaga, O. (2006). Inhibition of endothelial cell proliferation, in vitro angiogenesis, and the down-regulation of cell adhesion-related genes by genistein. Combined with a cDNA microarray analysis. Endothelium 13,249-266. Poggi, A., Venturino, C, Catellani, S., Clavio, M., Miglino, M., Gobbi, M., Steinle, A., Ghia, P., Stella, S., Caligaris-Cappio, F., and Zocchi, M. R. (2004). Vdeltal T lymphocytes from B-CLL patients recognize ULBP3 expressed on leukemic B cells and up-regulated by trans-retinoic acid. Cancer Res 64, 9172-9179. Policastro, L., Molinari, B., Larcher, F., Blanco, P., Podhajcer, O. L., Costa, C. S., Rojas, P., and Duran, H. (2004). Imbalance of antioxidant enzymes in tumor cells and inhibition of proliferation and malignant features by scavenging hydrogen peroxide. Mol Carcinog 39,103-113. Popov, I., and Lewin, G. (1999). Antioxidative homeostasis: characterization by means of chemiluminescent technique. In Methods in Enzymology, Vol. 300, Oxidants and Antioxidants, Part B (L. Packer, Ed., Ed.), pp. 437-456. Academic Press, San Diego, CA. Pouget, C, Fagnere, C, Basly, J. P., Besson, A. E., Champavier, Y., Habrioux, G., and Chulia, A. J. (2002). Synthesis and aromatase inhibitory activity of flavanones. Pharm Res 19,286-291. Pouliot, F., Blais, A., and Labrie, C. (2003). Overexpression of a dominant negative type II bone morphogenetic protein receptor inhibits the growth of human breast cancer cells. Cancer Res 63,277-281. Powis, G., Briehl, M., and Oblong, J. (1995). Redox signalling and the control of cell growth and death. Pharmacol Ther 68,149-173. Pritchard, K. I. (2000). Current and future directions in medical therapy for breast carcinoma: endocrine treatment. Cancer 88, 3065-3072. Rae, J. M., Creighton, C. J., Meek, J. M., Haddad, B .R. and Johnson, M, D. (2007). MDA-MB-435 cells are derived from M14 melanoma cells—a loss for breast cancer, but a boon for melanoma research. Breast Cancer Res Treat 104:13-19. Raffaghello, L., Prigione, I., Airoldi, I., Camoriano, M., Levreri, I., Gambini, C, Pende, D., Steinle, A,, Ferrone, S., and Pistoia, V. (2004). Downregulation and/or release of NKG2D ligands as immune evasion strategy of human neuroblastoma. Neoplasia 6, 558-568. Rahman, Q., Abidi, P., Afaq, F., Schiffmann, D., Mossman, B. T., Kamp, D. W., and Athar, M. (1999). Glutathione redox system in oxidative lung injury. Crit Rev Toxicol 29, 543-568. Ramana, B. V., Kumar, V. V., Krishna, P. N., Kumar, C. S., Reddy, P. U., and Raju, T. N. (2006). Effect of quercetin on galactose-induced hyperglycaemic oxidative stress in hepatic and neuronal tissues of Wistar rats. Acta Diabetol 43, 135-141. Rasulev, B. F. A. R. A., Abdullaev, N. D. A., Syrov, V. N. A., and Leszczynski, J. A. (2005). A Quantitative Structure-Activity Relationship (QSAR) study of the antioxidant activity of flavonoids. QSAR Combin Sci 24, 1056-1065. 144 Reichard, J. F., Motz, G. T., and Puga, A. (2007). Heme oxygenase-1 induction by NRF2 requires inactivation of the transcriptional repressor BACH1. Nucleic Acids Res 35, 7074-7086. Rice-Evans, C. A., Miller, N. J., Bolwell, P. G., Bramley, P. M, and Pridham, J. B. (1995). The relative antioxidant activities of plant-derived polyphenolic flavonoids. Free Radic Res 22, 375-383. Rice-Evans, C. A., Miller, N. J., and Paganga, G. (1996). Structure-antioxidant activity relationships of flavonoids and phenolic acids. Free Radic Biol Med 20, 933-956. Rice-Evans, C. A., Miller, N. J., and Paganga, G. (1997). Antioxidant properties of phenolic compounds. Trends Plant Sci 2,152-159. Rimbach, G., De Pascual-Teresa, S., Ewins, B. A., Matsugo, S., Uchida, Y., Minihane, A. M., Turner, R., VafeiAdou, K., and Weinberg, P. D. (2003). Antioxidant and free radical scavenging activity of isoflavone metabolites. Xenobiotica 33, 913-925. Rock, K. L., York, I. A., and Goldberg, A. L. (2004). Post-proteasomal antigen processing for major histocompatibility complex class I presentation. Nat Immunol 5, 670-677. Roger, P., Sahla, M. E., Makela, S., Gustafsson, J. A., Baldet, P., and Rochefort, H. (2001). Decreased expression of estrogen receptor beta protein in proliferative preinvasive mammary tumors. Cancer Res 61, 2537-2541. Rohner, A., Langenkamp, U., Siegler, U., Kalberer, C. P., and Wodnar-Filipowicz, A. (2007). Differentiation-promoting drugs up-regulate NKG2D ligand expression and enhance the susceptibility of acute myeloid leukemia cells to natural killer cell-mediated lysis. LeukRes 31,1393-1402. Rojo, M., Legros, F., Chateau, D., and Lombes, A. (2002). Membrane topology and mitochondrial targeting of mitofusins, ubiquitous mammalian homologs of the transmembrane GTPase Fzo. J Cell Sci 115,1663-1674. Rossi, M., Negri, E., Lagiou, P., Talamini, R., Dal Maso, L., Montella, M., Franceschi, S., and La Vecchia, C. (2008). Flavonoids and ovarian cancer risk: A case-control study in Italy. Int J Cancer 123, 895-898. Rossi, M., Negri, E., Talamini, R., Bosetti, C, Parpinel, M., Gnagnarella, P., Franceschi, S., Dal Maso, L., Montella, M., Giacosa, A., and La Vecchia, C. (2006). Flavonoids and colorectal cancer in Italy. Cancer Epidemiol Biomarkers Prev 15, 1555-1558. Royds, J. A., and Iacopetta, B. (2006). p53 and disease: when the guardian angel fails. Cell Death Differ 13, 1017-1026. Rufer, C. E., and Kulling, S. E. (2006). Antioxidant activity of isoflavones and their major metabolites using different in vitro assays. J Agric Food Chem 54, 2926- 2931. Russo, I. H., and Russo, J. (2005). The role of estrogen in breast cancer. In Molecular Basis of Breast Cancer Prevention and Treatment (I. H. Russo, and J. Russo, Eds.), pp. 89-136. Springer-Verlag, Heidelberg. Russo, J., Ao, X., Grill, C., and Russo, I. H. (1999). Pattern of distribution of cells positive for estrogen receptor alpha and progesterone receptor in relation to proliferating cells in the mammary gland. Breast Cancer Res Treat 53, 217-227. Ruzinova, M. B., and Benezra, R. (2003). Id proteins in development, cell cycle and cancer. Trends Cell Biol 13, 410-418. 145 Salim, A. S. (1993). The permissive role of oxygen-derived free radicals in the development of colonic cancer in the rat. A new theory for carcinogenesis. Int J Cancer 53, 1031-1035. Santel, A., and Fuller, M. T. (2001). Control of mitochondrial morphology by a human mitofusin. J Cell Sci 114, 867-874. Santell, R. C, Kieu, N., and Helferich, W. G. (2000). Genistein inhibits growth of estrogen-independent human breast cancer cells in culture but not in athymic mice. JNutr 130, 1665-1669. Sato, N., and Hitomi, J. (2002). SI OOP expression in human esophageal epithelial cells: Human esophageal epithelial cells sequentially produce different SI00 proteins in the process of differentiation. Anat Rec 267, 60-69. Scandalios, J. G. (2005). Oxidative stress: molecular perception and transduction of signals triggering antioxidant gene defenses. Braz J Med Biol Res 38, 995-1014. Schenkman, J. B., and Jansson, I. (2003). The many roles of cytochrome b5. Pharmacol Ther 97,139-152. Schmielau, J., and Finn, O. J. (2001). Activated granulocytes and granulocyte-derived hydrogen peroxide are the underlying mechanism of suppression of t-cell function in advanced cancer patients. Cancer Res 61, 4756-4760. Schroeder, A., Mueller, O., Stocker, S., Salowsky, R., Leiber, M., Gassmann, M., Lightfoot, S., Menzel, W., Granzow, M., and Ragg, T. (2006). The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol 7, 3. Selvendiran, K., Koga, H., Ueno, T., Yoshida, T., Maeyama, M, Torimura, T., Yano, H., Kojiro, M., and Sata, M. (2006). Luteolin promotes degradation in signal transducer and activator of transcription 3 in human hepatoma cells: an implication for the antitumor potential of flavonoids. Cancer Res 66, 4826-4834. Sen, G., Mukhopadhyay, S., Ray, M., and Biswas, T. (2008). Quercetin interferes with iron metabolism in Leishmania donovani and targets ribonucleotide reductase to exert leishmanicidal activity. JAntimicrob Chemother 61, 1066-1075. Seralini, G., and Moslemi, S. (2001). Aromatase inhibitors: past, present and future. Mol Cell Endocrinol 178, 117-131. Setchell, K. D., Brown, N. M., Desai, P., Zimmer-Nechemias, L., Wolfe, B. E., Brashear, W. T., Kirschner, A. S., Cassidy, A., and Heubi, J. E. (2001). Bioavailability of pure isoflavones in healthy humans and analysis of commercial soy isofiavone supplements. JNutr 131,1362S-1375S. Shacter, E., Williams, J. A., and Levine, R. L. (1995). Oxidative modification of fibrinogen inhibits thrombin-catalyzed clot formation. Free Radic Biol Med 18, 815-821. Shao, Z., Wu, J., and Shen, Z. (2000). [Genistein exerts multiple suppressive effects on human breast carcinoma cells]. Zhonghua Zhong Liu Za Zhi 22, 362-365. Shao, Z. M., Alpaugh, M. L., Fontana, J. A., and Barsky, S. H. (1998a). Genistein inhibits proliferation similarly in estrogen receptor-positive and negative human breast carcinoma cell lines characterized by P21WAF1/CIP1 induction, G2/M arrest, and apoptosis. J Cell Biochem 69, 44-54. Shao, Z. M., Wu, J., Shen, Z. Z., and Barsky, S. H. (1998b). Genistein exerts multiple suppressive effects on human breast carcinoma cells. Cancer Res 58,4851-4857. 146 Shepard, H. M., Jin, P., Slamon, D. J., Pirot, Z., and Maneval, D. C. (2008). Herceptin. Handb Exp Pharmacol, 183-219. Sherman, M., and Multhoff, G. (2007). Heat shock proteins in cancer. Ann N Y Acad Sci 1113, 192-201. Shichijo, S., Ishihara, Y., Azuma, K., Komatsu, N., Higashimoto, N., Ito, M., Nakamura, T., Ueno, T., Harada, M., and Itoh, K. (2005). ABCE1, a member of ATP-binding cassette transporter gene, encodes peptides capable of inducing HLA-A2- restricted and tumor-reactive cytotoxic T lymphocytes in colon cancer patients. Oncol Rep 13, 907-913. Shim, H. Y., Park, J. H., Paik, H. D., Nah, S. Y., Kim, D. S., and Han, Y. S. (2007). Genistein-induced apoptosis of human breast cancer MCF-7 cells involves calpain-caspase and apoptosis signaling kinase l-p38 mitogen-activated protein kinase activation cascades. Anticancer Drugs 18, 649-657. Shinkarev, V. P., Rolling, D. R., Miller, T. J., and Crofts, A. R. (2002). Modulation of the midpoint potential of the [2Fe-2S] Rieske iron sulfur center by Qo occupants in the bcl complex. Biochemistry 41, 14372-14382. Shreeram, S., and Blow, J. J. (2003). The role of the replication licensing system in cell proliferation and cancer. Prog Cell Cycle Res 5,287-293. Shreeram, S., Sparks, A., Lane, D. P., and Blow, J. J. (2002). Cell type-specific responses of human cells to inhibition of replication licensing. Oncogene 21, 6624-6632. Siegel, P. M., and Massague, J. (2003). Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat Rev Cancer 3, 807-821. Sikder, H. A., Devlin, M. K., Dunlap, S., Ryu, B., and Alani, R. M. (2003). Id proteins in cell growth and tumorigenesis. Cancer Cell 3, 525-530. Smith, J. L., and Perino, J. V. (1981). Osage Orange (Madura pomifera): History and economic uses. Economic Botany 35, 24-41. Son, I. H., Chung, I. M., Lee, S. I., Yang, H. D., and Moon, H. I. (2007). Pomiferin, histone deacetylase inhibitor isolated from the fruits of Madura pomifera. Bioorg Med Chem Lett 17,4753-4755. Soobrattee, M. A., Bahorun, T., and Aruoma, O. I. (2006). Chemopreventive actions of polyphenols compounds in cancer. Biofactors 27,19-35. Soto, C, Recoba, R., Barron, H., Alvarez, C, and Favari, L. (2003). Silymarin increases antioxidant enzymes in alloxan-induced diabetes in rat pancreas. Comp Biochem Physiol C Toxicol Pharmacol 136, 205-212. St Clair, D. K., Wan, X. S., Oberley, T. D., Muse, K. E., and St Clair, W. H. (1992). Suppression of radiation-induced neoplastic transformation by overexpression of mitochondrial superoxide dismutase. Mol Carcinog 6, 238-242. Stadtman, E. R. (1992). Protein oxidation and aging. Science 257, 1220-1224. Stadtman, E. R. (2004). Role of oxidant species in aging. Curr Med Chem 11, 1105-1112. Statistics-Canada (2008). Canadian Cancer Statistics 2008. Canadian Cancer Society/National Cancer Institute of Canada, Toronto. Steinau, M., Rajeevan, M. S., Lee, D. R., Ruffin, M. T., Horowitz, I. R., Flowers, L. C, Tadros, T., Birdsong, G., Husain, M., Kmak, D. C, Longton, G. M., Vernon, S. D., and Unger, E. R. (2007). Evaluation of RNA markers for early detection of cervical neoplasia in exfoliated cervical cells. Cancer Epidemiol Biomarkers Prev 16,295-301. 147 Stoeber, K., Halsall, I., Freeman, A., Swinn, R., Doble, A., Morris, L., Coleman, N., Bullock, N., Laskey, R. A., Hales, C. N., and Williams, G. H. (1999). Immunoassay for urothelial cancers that detects DNA replication protein Mcm5 in urine. Lancet 354, 1524-1525. Stoner, G. D., Wang, L. S., and Casto, B. C. (2008). Laboratory and Clinical Studies of Cancer Chemoprevention by Antioxidants in Berries. Carcinogenesis, in press. Storz, P. (2005). Reactive oxygen species in tumor progression. Front Biosci 10, 1881- 1896. Strand, C, Enell, J., Hedenfalk, I., and Ferno, M. (2007). RNA quality in frozen breast cancer samples and the influence on gene expression analysis—a comparison of three evaluation methods using microcapillary electrophoresis traces. BMC Mol 5/o/8,38. Sudheer, A. R., Muthukumaran, S., Devipriya, N., and Menon, V. P. (2007). Ellagic acid, a natural polyphenol protects rat peripheral blood lymphocytes against nicotine- induced cellular and DNA damage in vitro: with the comparison of N- acetylcysteine. Toxicology 230, 11-21. Sunde, J. S., Donninger, H., Wu, K., Johnson, M. E., Pestell, R. G., Rose, G. S., Mok, S. C, Brady, J., Bonome, T., and Birrer, M. J. (2006). Expression profiling identifies altered expression of genes that contribute to the inhibition of transforming growth factor-beta signaling in ovarian cancer. Cancer Res 66, 8404-8412. Surowiak, P., Maciejczyk, A., Materna, V., Drag-Zalesinska, M., Wojnar, A., Pudelko, M., Kedzia, W., Spaczynski, M., Dietel, M., Zabel, M., and Lage, H. (2007). Unfavourable prognostic significance of SI OOP expression in ovarian cancers. Histopathology 51, 125-128. Sutherland, C. L., Rabinovich, B., Chalupny, N. J., Brawand, P., Miller, R., and Cosman, D. (2006). ULBPs, human ligands of the NKG2D receptor, stimulate tumor immunity with enhancement by IL-15. Blood 108, 1313-1319. Suzuki, K., Koike, H., Matsui, H., Ono, Y., Hasumi, M., Nakazato, H., Okugi, H., Sekine, Y., Oki, K., Ito, K., Yamamoto, T., Fukabori, Y., Kurokawa, K., and Yamanaka, H. (2002). Genistein, a soy isoflavone, induces glutathione peroxidase in the human prostate cancer cell lines LNCaP and PC-3. Int J Cancer 99, 846-852. Svasti, J., Srisomsap, C, Subhasitanont, P., Keeratichamroen, S., Chokchaichamnankit, D., Ngiwsara, L., Chimnoi, N., Pisutjaroenpong, S., Techasakul, S., and Chen, S. T. (2005). Proteomic profiling of cholangiocarcinoma cell line treated with pomiferin from Derris malaccensis. Proteomics 5, 4504-4509. Swain, J., and Gutteridge, J. M. (1995). Prooxidant iron and copper, with ferroxidase and xanthine oxidase activities in human atherosclerotic material. FEBS Lett 368, 513-515. Taga, M. S., Miller, E. E., and Pratt, D. E. (1984). Chia seeds as a source of natural lipid antioxidants. J Am Oil Chem Soc 61, 928-931. Taguchi, A., Blood, D. C, del Toro, G., Canet, A., Lee, D. C, Qu, W., Tanji, N., Lu, Y., Lalla, E., Fu, C, Hofmann, M. A., Kislinger, T., Ingram, M., Lu, A., Tanaka, H., Hori, O., Ogawa, S., Stern, D. M., and Schmidt, A. M. (2000). Blockade of RAGE-amphoterin signalling suppresses tumour growth and metastases. Nature 405, 354-360. 148 Tahara, S., and Ibrahim, R. K. (1995). PRENYLATED ISOFLAVONOIDS--AN UPDATE. Phytochem 38, 1073-1094. Takizawa, T., Tatematsu, C, Watanabe, K., Kato, K., and Nakanishi, Y. (2004). Cleavage of calnexin caused by apoptotic stimuli: implication for the regulation of apoptosis. JBiochem 136, 399-405. Tan, D. F., Huberman, J. A., Hyland, A., Loewen, G. M., Brooks, J. S., Beck, A. F., Todorov, I. T., and Bepler, G. (2001). MCM2~a promising marker for premalignant lesions of the lung: a cohort study. BMC Cancer 1, 6. Tan, W. F., Lin, L. P., Li, M. H., Zhang, Y. X., Tong, Y. G., Xiao, D., and Ding, J. (2003). Quercetin, a dietary-derived flavonoid, possesses antiangiogenic potential. Eur J Pharmacol 459, 255-262. Tao, J., Li, Y., Liu, Y. Q., Wang, L., Yang, J., Dong, J., Wu, Y., Shen, G. X., and Tu, Y. T. (2008). Restoration of the expression of transports associated with antigen processing in human malignant melanoma increases tumor-specific immunity. J Invest Dermatol 128, 1991-1996. Taylor, W. R., and Stark, G. R. (2001). Regulation of the G2/M transition by p53. Oncogene 20, 1803-1815. Ten Dijke, P., Goumans, M. J., Itoh, F., and Itoh, S. (2002). Regulation of cell proliferation by Smad proteins. J Cell Physiol 191,1-16. Thannickal, V. J., and Fanburg, B. L. (2000). Reactive oxygen species in cell signaling. Am J Physiol Lung Cell Mol Physiol 279, L1005-1028. The Massachusetts General Hospital (2008). Primer Bank: PCR Primers for Gene Expression Detection and Quantification In http://pga. mgh. harvard, edu/primerbank/index. html. Theodoratou, E., Kyle, J., Cetnarskyj, R., Farrington, S. M., Tenesa, A., Barnetson, R., Porteous, M., Dunlop, M., and Campbell, H. (2007). Dietary flavonoids and the risk of colorectal cancer. Cancer Epidemiol Biomarkers Prev 16, 684-693. Thompson, K. J., Fried, M. G., Ye, Z., Boyer, P., and Connor, J. R. (2002). Regulation, mechanisms and proposed function of ferritin translocation to cell nuclei. J Cell Sci 115, 2165-2177. Tirkey, N., Pilkhwal, S., Kuhad, A., and Chopra, K. (2005). Hesperidin, a citrus bioflavonoid, decreases the oxidative stress produced by carbon tetrachloride in rat liver and kidney. BMC Pharmacol 5, 2. Toyokuni, S. (1996). Iron-induced carcinogenesis: the role of redox regulation. Free Radic Biol Med 20, 553-566. Trosko, J. E., and Chang, C. C. (2000). Modulation of cell-cell communication in the cause and chemoprevention/chemotherapy of cancer. Biofactors 12, 259-263. Trueba, G. P., Sanchez, G. M., and Giuliani, A. (2004). Oxygen free radical and antioxidant defense mechanism in cancer. Front Biosci 9, 2029-2044. Tuszynski, G. P., and Nicosia, R. F. (1994). Localization of thrombospondin and its cysteine-serine-valine-threonine-cysteine-glycine-specific receptor in human breast carcinoma. Lab Invest 70, 228-233. Uneri, C, Sari, M., Baglam, T., Polat, S., and Yuksel, M. (2006). Effects of vitamin E on cigarette smoke induced oxidative damage in larynx and lung. Laryngoscope 116, 97-100. 149 Upham, B. L., Kang, K. S., Cho, H. Y., and Trosko, J. E. (1997). Hydrogen peroxide inhibits gap junctional intercellular communication in glutathione sufficient but not glutathione deficient cells. Carcinogenesis 18, 37-42. Ushio-Fukai, M., and Alexander, R. W. (2004). Reactive oxygen species as mediators of angiogenesis signaling: role of NAD(P)H oxidase. Mol Cell Biochem 264, 85-97. Valabrega, G., Montemurro, F., and Aglietta, M. (2007). Trastuzumab: mechanism of action, resistance and future perspectives in HER2-overexpressing breast cancer. Ann Oncol 18, 977-984. Valko, M., Izakovic, M., Mazur, M., Rhodes, C. J., and Telser, J. (2004). Role of oxygen radicals in DNA damage and cancer incidence. Mol Cell Biochem 266, 37-56. Valko, M., Rhodes, C. J., Moncol, J., Izakovic, M., and Mazur, M. (2006). Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem Biol Interact 160,1-40. Vaughn, C. B., Weinstein, R., Bond, B., Rice, R., Vaughn, R. W., McKendrick, A., Ayad, G., Rockwell, M. A., and Rocchio, R. (1987). Ferritin content in human cancerous and noncancerous colonic tissue. Cancer Invest 5, 7-10. Vesela, D., Kubinova, R., Muselik, J., Zemlicka, M., and Suchy, V. (2004). Antioxidative and EROD activities of osajin and pomiferin. Fitoterapia 75, 209- 211. Vet, J. A., van Moorselaar, R. J., Debruyne, F. M., and Schalken, J. A. (1997). Differential expression of ferritin heavy chain in a rat transitional cell carcinoma progression model. Biochim Biophys Acta 1360, 39-44. Vivier, E., Tomasello, E., and Paul, P. (2002). Lymphocyte activation via NKG2D: towards a new paradigm in immune recognition? Curr Opin Immunol 14, 306-311. Volinia, S., Calin, G. A., Liu, C. G., Ambs, S., Cimmino, A., Petrocca, F., Visone, R., Iorio, ML, Roldo, C., Ferracin, M., Prueitt, R. L., Yanaihara, N., Lanza, G., Scarpa, A., Vecchione, A., Negrini, M., Harris, C. C, and Croce, C. M. (2006). A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA 103, 2257-2261. Wang, G., Platt-Higgins, A., Carroll, J., de Silva Rudland, S., Winstanley, J., Barraclough, R., and Rudland, P. S. (2006). Induction of metastasis by S100P in a rat mammary model and its association with poor survival of breast cancer patients. Cancer Res 66, 1199-1207. Wang, H. Z., Zhang, Y., Xie, L. P., Yu, X. Y. and Zhang, R. Q. (2002). Effects of genistein and daidzein on the cell growth, cell cycle, and differentiation of human and murine melanoma cells(l). JNutr Biochem 13:421-426. Wang, S., and Hirschberg, R. (2004). Bone morphogenetic protein-7 signals opposing transforming growth factor beta in mesangial cells. J Biol Chem 279, 23200- 23206. Wang, Y., Man Gho, W., Chan, F. L., Chen, S., and Leung, L. K. (2008). The red clover (Trifolium pratense) isoflavone biochanin A inhibits aromatase activity and expression. Br JNutr 99, 303-310. Wei, H., Bowen, R., Cai, Q., Barnes, S., and Wang, Y. (1995). Antioxidant and antipromotional effects of the soybean isoflavone genistein. Proc Soc Exp Biol Med 208, 124-130. 150 Weihua, Z., Saji, S., Makinen, S., Cheng, G., Jensen, E. V., Warner, M., and Gustafsson, J. A. (2000). Estrogen receptor (ER) beta, a modulator of ERalpha in the uterus. Proc Natl Acad Sci USA 97, 5936-5941. Weinstein, R. E., Bond, B. H., Silberberg, B. K., Vaughn, C. B., Subbaiah, P., and Pieper, D. R. (1989). Tissue ferritin concentration and prognosis in carcinoma of the breast. Breast Cancer Res Treat 14, 349-353. Weydert, C. J., Zhang, Y., Sun, W., Waugh, T. A., Teoh, M. L., Andringa, K. K., Aykin- Burns, N., Spitz, D. R., Smith, B. J., and Oberley, L. W. (2008). Increased oxidative stress created by adenoviral MnSOD or CuZnSOD plus BCNU (1,3- bis(2-chloroethyl)-l-nitrosourea) inhibits breast cancer cell growth. Free Radic Biol Med 44, 856-867. Williams, G. H., Romanowski, P., Morris, L., Madine, M., Mills, A. D., Stoeber, K., Marr, J., Laskey, R. A., and Coleman, N. (1998). Improved cervical smear assessment using antibodies against proteins that regulate DNA replication. Proc Natl Acad Sci USA 95,14932-14937. Wiseman, H., Casey, K., Clarke, D. B., Barnes, K. A., and Bowey, E. (2002). Isoflavone aglycon and glucoconjugate content of high- and low-soy U.K. foods used in nutritional studies. JAgric Food Chem 50, 1404-1410. Wiseman, L. R., and Adkins, J. C. (1998). Anastrozole. A review of its use in the management of postmenopausal women with advanced breast cancer. Drugs Aging 13, 321-332. Wolfe, J. T., Ross, D., and Cohen, G. M. (1994). A role for metals and free radicals in the induction of apoptosis in thymocytes. FEBS Lett 352, 58-62. Wolfrom, M. L., Harris, W. D., Johnson, G. F., Mahan, J. E., Moffet, S. M., and Wildi, B. (1946). Osage orange pigments. X. Complete structures of osajin and pomiferin. J Amer Chem Soc 68,406-408. Wood, A. W., Huang, M. T., Chang, R. L., Newmark, H. L., Lehr, R. E., Yagi, H., Sayer, J. M., Jerina, D. M., and Conney, A. H. (1982). Inhibition of the mutagenicity of bay-region diol epoxides of polycyclic aromatic hydrocarbons by naturally occurring plant phenols: exceptional activity of ellagic acid. Proc Natl Acad Sci U SA 79, 5513-5517. Xia, Y., Wu, Y., He, X., Gong, J., and Qiu, F. (2008). Effects of mitofusin-2 gene on cell proliferation and chemotherapy sensitivity of MCF-7. J Huazhong Univ Sci Technolog Med Sci 28, 185-189. Xia, Y., Wu, Y. Q., Zhang, L., Li, X. L., Yuan, H. L., He, X. J., Tao, D. D., Gong, J. P., and Qiu, F. Z. (2007a). [Effects of mitofusin-2 gene on proliferation and chemosensitivity of human breast carcinoma cell line MCF-7]. Ai Zheng 26, 815- 819. Xia, Y., Wu, Y. Q., Zheng, Q. C, Zhang, W., Gong, J. P., and Qiu, F. Z. (2007b). [Effect of mitofusin-2 gene in apoptosis of human breast carcinoma cell line in vitro]. Zhonghua Zhong Liu Za Zhi 29, 653-656. Xu, X., Harris, K. S., Wang, H. J., Murphy, P. A., and Hendrich, S. (1995). Bioavailability of soybean isoflavones depends upon gut microflora in women. J Nutr 125, 2307-2315. Xu, Y., Krishnan, A., Wan, X. S., Majima, H., Yeh, C. C, Ludewig, G., Kasarskis, E. J., and St Clair, D. K. (1999). Mutations in the promoter reveal a cause for the 151 reduced expression of the human manganese superoxide dismutase gene in cancer cells. Oncogene 18, 93-102. Yamashita, Y., Kurohiji, T., Tuszynski, G. P., Sakai, T., and Shirakusa, T. (1998). Plasma thrombospondin levels in patients with colorectal carcinoma. Cancer 82, 632-638. Yan, L. J., Levine, R. L., and Sohal, R. S. (1997). Oxidative damage during aging targets mitochondrial aconitase. Proc Natl Acad Sci U S A 94,11168-11172. Yao, J., Weremowicz, S., Feng, B., Gentleman, R. C, Marks, J. R., German, R., Brennan, C, and Polyak, K. (2006). Combined cDNA array comparative genomic hybridization and serial analysis of gene expression analysis of breast tumor progression. Cancer Res 66, 4065-4078. Yau, C, and Benz, C. C. (2008). Genes responsive to both oxidant stress and loss of estrogen receptor function identify a poor prognosis group of estrogen receptor positive primary breast cancers. Breast Cancer Res 10, R61. Yin, G. Y., Yin, Y. F., and He, X. F. (1995). [Effect of zhuchun pill on immunity and endocrine function of elderly with kidney-yang deficiency]. Zhongguo Zhong Xi Yi Jie He Za Zhi 15, 601-603. Yokota, Y., and Mori, S. (2002). Role of Id family proteins in growth control. J Cell Physiol 190,21-28. Yoon, S. O., Park, S. J., Yoon, S. Y., Yun, C. FL, and Chung, A. S. (2002). Sustained production of H(2)0(2) activates pro-matrix metalloproteinase-2 through receptor tyrosine kinases/phosphatidylinositol 3-kinase/NF-kappa B pathway. J Biol Chem 277, 30271-30282. York, T. P., Plymate, S. R., Nelson, P. S., Eaves, L. J., Webb, H. D., and Ware, J. L. (2005). cDNA microarray analysis identifies genes induced in common by peptide growth factors and androgen in human prostate epithelial cells. Mol Carcinog 44, 242-251. Yoshihara, T., Kadota, Y., Yoshimura, Y., Tatano, Y., Takeuchi, N., Okitsu, H., Umemoto, A., Yamauchi, T., and Itoh, K. (2006). Proteomic alteration in gastic adenocarcinomas from Japanese patients. Mol Cancer 5, 75. Yoshioka, J., Schreiter, E. R., and Lee, R. T. (2006). Role of thioredoxin in cell growth through interactions with signaling molecules. Antioxid Redox Signal 8, 2143- 2151. Yu, F., Watts, R. N., Zhang, X. D., Borrow, J. M. and Hersey, P. (2006). Involvement of BH3-only proapoptotic proteins in mitochondrial-dependent Phenoxodiol-induced apoptosis of human melanoma cells. Anticancer Drugs. 17:1151-1161. Yu, Y. P., Yu, G., Tseng, G., Cieply, K., Nelson, J., Defrances, M., Zarnegar, R., Michalopoulos, G., and Luo, J. H. (2007). Glutathione peroxidase 3, deleted or methylated in prostate cancer, suppresses prostate cancer growth and metastasis. Cancer Res 67, 8043-8050. Yuan, J. P., Wang, J. H., and Liu, X. (2007). Metabolism of dietary soy isoflavones to equol by human intestinal microflora—implications for health. Mol Nutr Food Res 51,765-781. Zanocco-Marani, T., Vignudelli, T., Gemelli, C, Pirondi, S., Testa, A., Montanari, M., Parenti, S., Tenedini, E., Grande, A., and Ferrari, S. (2006). Tfe3 expression is 152 closely associated to macrophage terminal differentiation of human hematopoietic myeloid precursors. Exp Cell Res 312,4079-4089. Zhan, C, and Yang, J. (2006). Protective effects of isoliquiritigenin in transient middle cerebral artery occlusion-induced focal cerebral ischemia in rats. Pharmacol Res 53, 303-309. Zhan, Q., Antinore, M. J., Wang, X. W., Carrier, F., Smith, M. L., Harris, C. C, and Fornace, A. J., Jr. (1999). Association with Cdc2 and inhibition of Cdc2/Cyclin Bl kinase activity by the p53-regulated protein Gadd45. Oncogene 18, 2892-2900. Zhang, L., Huang, J., Yang, N., Greshock, J., Megraw, M. S., Giannakakis, A., Liang, S., Naylor, T. L., Barchetti, A., Ward, M. R., Yao, G., Medina, A., O'brien-Jenkins, A., Katsaros, D., Hatzigeorgiou, A., Gimotty, P. A., Weber, B. L. and Coukos, G. (2006). microRNAs exhibit high frequency genomic alterations in human cancer. Proc Natl Acad Sci USA 103:9136-9141. Zhao, Z., Fang, L. L., Johnsen, R., and Baillie, D. L. (2004). ATP-binding cassette protein E is involved in gene transcription and translation in Caenorhabditis elegans. Biochem Biophys Res Commun 323, 104-111. Zheng, Z. H., Sun, X. J., Fu, W. N., Guan, Y., Gao, F., Wang, Y., and Sun, K. L. (2007). Decreased expression of DICER1 in gastric cancer. Chin Med J (Engl) 120, 2099- 2104. Zhong, W., Oberley, L. W., Oberley, T. D., and St Clair, D. K. (1997). Suppression of the malignant phenotype of human glioma cells by overexpression of manganese superoxide dismutase. Oncogene 14, 481-490. Zhou, X. D., DeTolla, L., Custer, R. P., and London, W. T. (1987). Iron, ferritin, hepatitis B surface and core antigens in the livers of Chinese patients with hepatocellular carcinoma. Cancer 59,1430-1437. Zhu, B. T., and Conney, A. H. (1998). Functional role of estrogen metabolism in target cells: review and perspectives. Carcinogenesis 19, 1-27. Zou, Y., Lu, Y., and Wei, D. (2004). Antioxidant activity of a flavonoid-rich extract of Hypericum perforatum L. in vitro. JAgric Food Chem 52, 5032-5039. Zuppini, A., Groenendyk, J., Cormack, L. A., Shore, G., Opas, M., Bleackley, R. C, and Michalak, M. (2002). Calnexin deficiency and endoplasmic reticulum stress- induced apoptosis. Biochemistry 41, 2850-2858. 153 Appendix la The 80 up-regulated genes (PO.01) in MCF-7 cells after treatment with pomiferin (5 uM) for 24 hr Gene Symbol Accession No. Description Fold Change MLLT11 W20010 Myeloid/lymphoid or mixed-lineage leukemia 4.32±1.36 BLVRB R99052 Biliverdin reductase B (flavin reductase (NADPH)) 3.86+2.21 GPX3* R71940 Glutathione peroxidase 3 (plasma) 3.65+1.11 ULBP2 AW959307 UL16 binding protein 2 2.95±1.07 ME1 R60083 Malic enzyme 1, NADP(+)-dependent, cytosolic 2.65±1.10 MTAC2D1 BM925067 Membrane targeting (tandem) C2 domain containing 1 2.49+0.44 FTL BQ130731 Ferritin, light polypeptide 2.49±0.62 SLC38A6 AA129932 Solute carrier family 38, member 6 2.49±0.73 MGC14376 R71612 Hypothetical protein MGC14376 2.39±0.70 CALCOC02 BM981211 Calcium binding and coiled-coil domain 2 2.29±1.06 HSPA1A N27681 Heat shock 70kDa protein 1A 2.29±1.19 BSCL2 H18273 Bernardinelli-Seip congenital lipodystrophy 2 (seipin) 2.26+0.67 TXNRD1 T97105 Thioredoxin reductase 1 2.21±1.01 ABHD3 N76691 Abhydrolase domain containing 3 2.08+0.69 MAP1LC3B BM707025 Microtubule-associated protein 1 light chain 3 beta 2.05±0.50 PSMA5 BQ052293 Proteasome (prosome, macropain) subunit, alpha type, 5 2.03±0.78 C14orfl00 T78200 Chromosome 14 open reading frame 100 1.99+0.77 BCAP31 N44935 B-cell receptor-associated protein 31 1.98±0.48 PCYT1A N75919 Phosphate cytidylyltransferase 1, choline, alpha 1.92±0.71 PHGDH W63787 Phosphoglycerate dehydrogenase 1.86+0.50 KIAA0746 H20906 KIAA0746 protein 1.86±0.78 C19orf62 W78924 Chromosome 19 open reading frame 62 1.84±0.47 GABARAPL1 R67150 GABA(A) receptor-associated protein like 1 1.83±1.02 CLDND1 R25979 Claudin domain containing 1 1.82±0.66 CAMK2G BI544916 Calcium/calmodulin-dependent protein kinase (CaM kinase) Ily 1.78±0.53 MAPRE3 BM907619 Microtubule-associated protein, RP/EB family, member 3 1.78±0.51 154 ZUBR1 AL534216 Zinc finger, UBR1 type 1 1.77+0.69 TM2D2 H29628 TM2 domain containing 2 1.77±0.42 TALD01 BQ069589 Transaldolase 1 1.7610.73 CANX BM994316 Calnexin 1.72±0.64 IGF2R R35160 Insulin-like growth factor 2 receptor 1.7010.53 CTSL1 W25407 CathepsinLl 1.6810.29 NPLOC4 BQ051520 Nuclear protein localization 4 homolog (S. cerevisiae) 1.6410.47 TMEM49 BG697291 Transmembrane protein 49 1.62+0.54 YWHAG H09565 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, y polypeptide 1.6210.66 SEPX1 BM980487 Selenoprotein X, 1 1.6010.3 8 SPIRE1 H23374 Spire homolog 1 (Drosophila) 1.5810.64 SOD1 N28535 Superoxide dismutase 1 1.5610.43 PPAP2C AA151344 Phosphatidic acid phosphatase type 2C 1.5510.37 LOC541471 T97914 Hypothetical LOC541471 1.5510.62 IFRD1 AA133453 Interferon-related developmental regulator 1 1.5410.56 FADS3 BF984256 Fatty acid desaturase 3 1.5410.62 ATP6V0B W58264 ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b 1.54+0.28 MBNL2 N44278 Muscleblind-like 2 (Drosophila) 1.53+0.38 ENPP1 N46159 Ectonucleotide pyrophosphatase/phosphodiesterase 1 1.5110.31 TBC1D23 AA128096 TBC1 domain family, member 23 1.5010.31 DHRS7 T84331 Dehydrogenase/reductase (SDR family) member 7 1.5010.50 GAPDH BQ067508 Glyceraldehyde-3-phosphate dehydrogenase 1.47+0.39 C10orf30 R52896 Chromosome 10 open reading frame 30 1.4610.30 UBB BM782284 UbiquitinB 1.4610.32 ATF4 BQ068278 Activating transcription factor 4 1.4610.41 GADD45A BM999387 Growth arrest and DNA-damage-inducible, alpha 1.4510.37 CSGlcA-T R51977 Chondroitin sulfate glucuronyltransferase 1.4310.43 TFG BI492104 TRK-fused gene 1.4310.38 C9orf30 AA001144 Chromosome 9 open reading frame 30 1.4210.28 PAM AA045364 Peptidylglycine alpha-amidating monooxygenase 1.4110.28 155 STK17A AW131518 Serine/threonine kinase 17a 1.41±0.37 YWHAQ BM557897 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, a polypeptide 1.41 ±0.5 0 EX0C5 H02393 Exocyst complex component 5 1.40±0.20 PSMD4 N98784 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 1.38+0.35 CD47 BG333273 CD47 molecule 1.37±0.20 DNAJB1 W63752 DnaJ (Hsp40) homolog, subfamily B, member 1 1.37±0.30 GDAP2 AA127840 Ganglioside induced differentiation associated protein 2 1.37+0,22 RAB6IP1 BM046897 RAB6 interacting protein 1 1.36±0.32 DST N31521 Dystonin 1.36±0.12 SETD7 AA151018 SET domain containing (lysine methyltransferase) 7 1.36±0.28 AC0X1 HI 5642 Acyl-Coenzyme A oxidase 1, palmitoyl 1.35+0.33 SHMT2 H22827 Serine hydroxymethyltransferase 2 (mitochondrial) 1.34±0.26 SEC61A1 BM818656 Sec61 alpha 1 subunit (S. cerevisiae) 1.34±0.31 STX17 T66200 Syntaxinl7 1.33±0.31 ADRM1 BM913272 Adhesion regulating molecule 1 1.33+0.32 ADIPOR1 R74559 Adiponectin receptor 1 1.32±0.25 CLTC BM907211 Clathrin, heavy chain (He) 1.31+0.28 SLC2A1 BQ000388 Solute carrier family 2, member 1 1.31+0.20 WDFY2 H81335 WD repeat and FYVE domain containing 2 1.30±0.29 SLC20A1 W47073 Solute carrier family 20 (phosphate transporter), member 1 1.28+0.21 MCFD2 AA132163 Multiple coagulation factor deficiency 2 1.27±0.25 PRDX6 BM471713 Peroxiredoxin 6 1.27±0.18 DPP3 BM450721 Dipeptidyl-peptidase 3 1.22±0.12 *The bold genes were selected for the RT-qPCR study 156 Appendix lb The 14 down-regulated genes (P<0.01) in MCF-7 cells after treatment with pomiferin (5 uM) for 24 hr Gene Symbol Accession No. Description Fold Change TOP2A* H17813 Topoisomerase (DNA) II alpha 170kDa 0.55±0.16 ID2 BQ014525 Inhibitor of DNA binding 2 0.59±0.11 HMGB2 N31851 High-mobility group box 2 0.60±0.20 H2AFJ W57808 H2A histone family, member J 0.62±0.21 MCM7 AL561620 Minichromosome maintenance complex component 7 0.63±0.21 EFHD1 H27676 EF-hand domain family, member Dl 0.64±0.11 HMGB1 H27400 High-mobility group box 1 0.64±0.26 SMC4 H06950 Structural maintenance of chromosomes 4 0.69+0.17 MCM6 H14471 Minichromosome maintenance complex component 6 0.69+0.15 BMP7 BM671826 Bone morphogenetic protein 7 (osteogenic protein 1) 0.70±0.16 BCL2L11 AA016186 BCL2-like 11 (apoptosis facilitator) 0.71±0.16 ZFP91 H41955 Zinc finger protein 91 homolog (mouse) 0.71±0.16 CEP110 N64856 Centrosomal protein HOkDa 0.76±0.09 "The bold genes were selected for the RT-qPCR study 157 Appendix Ha The 101 up-regulated genes (P<0.01) in MDA-MB-435 cells after treatment with pomiferin (5 uM) for 24 hr Gene Symbol Accession No. Description Fold Change FBXL6 R54646 F-box and leucine-rich repeat protein 6 1.92±0.82 POSTN W35228 Periostin, osteoblast specific factor 1.88±1.06 LOC157627 T77401 Hypothetical protein LOC157627 1.82+1.18 CNGB3 AA069498 Cyclic nucleotide gated channel beta 3 1.81 ±0.5 0 TRAPPC2 AA029595 Trafficking protein particle complex 2 1.81+1.48 CLEC14A BI758953 C-type lectin domain family 14, member A 1.78±0.89 DPT BM999162 Dermatopontin 1.78±1.00 ZNF714 H13735 Zinc finger protein 714 1.77±0.91 CDC42SE2 H59874 CDC42 small effector 2 1.69±0.79 MFN2 H75877 Mitofusin 2 1.69±0.73 IGFBP5 W47505 Insulin-like growth factor binding protein 5 1.66±0.85 ZNF117 R27526 Zinc finger protein 117 1.65±0.53 LOC286440 W92098 Hypothetical protein LOC286440 1.64+0.72 SLC25A25 H53924 Solute carrier family 25 (mitochondrial carrier; phosphate carrier) 1.63±0.39 C20orf39 N54874 Chromosome 20 open reading frame 39 1.62±0.61 ABCE1 R01839 ATP-binding cassette, sub-family E (OABP), member 1 1.61±0.48 NSL1 AA854294 NSL1, MIND kinetochore complex component, homolog (S. 1.61±0.57 cerevisiae) OAS3 W47619 2'-5'-oligoadenylate synthetase 3, lOOkDa 1.61±0.67 QKI R11951 Quaking homolog, KH domain RNA binding (mouse) 1.61+0.90 Clorf54 AA027214 Chromosome 1 open reading frame 54 1.60±0.46 SPTBN1 N43952 Spectrin, beta, non-erythrocytic 1 1.58±0.73 ADORA2A W15613 Adenosine A2a receptor 1.57±0.61 BTBD7 W44398 BTB (POZ) domain containing 7 1.57+0.64 DICER1 AA069472 Dicerl, Dcr-1 homolog (Drosophila) 1.57±0.67 SSSCA1 W78864 Sjogren's syndrome/scleroderma autoantigen 1 1.57±0.38 TFE3 W42519 Transcription factor binding to IGHM enhancer 3 1.56±0.47 158 GALNT12 N50776 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- 1.53+0.71 acetylgalactosaminyltransferase 12 (GalNAc-T12) MAF W05129 V-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) 1.53±0.32 PPTC7 W46278 PTC7 protein phosphatase homolog (S. cerevisiae) 1.52±0.49 SPG7 AA156458 Spastic paraplegia 7 (pure and complicated autosomal recessive) 1.52±0.44 ANKS6 R51933 Ankyrin repeat and sterile alpha motif domain containing 6 1.51 ±0.3 8 EPvLINl BF983867 ER lipid raft associated 1 1.51+0.66 LOC728676 AI822112 Similar to SR protein related family member (rsr-1) 1.51±0.40 JPH3 R61765 Junctophilin 3 1.50±0.33 SLC35C1 AA026902 Solute carrier family 35, member CI 1.50±0.54 ASGR1 H58598 Asialoglycoprotein receptor 1 1.49±0.39 NC0A3 BG106752 Nuclear receptor coactivator 3 1.49±0.55 CALN1 R14007 Calneuron 1 1.48±0.31 CCDC82 H01638 Coiled-coil domain containing 82 1,48±0.51 0SBPL1A N90823 Oxysterol binding protein-like 1A 1.48±0.44 AFAP1 BF036843 Actin filament associated protein 1 1.45±0.38 MGC22014 N53192 Hypothetical protein MGC22014 1.4510.20 SYK R59656 Spleen tyrosine kinase 1.4510.37 AGT W03663 Angiotensinogen (serpin peptidase inhibitor, clade A, member 8) 1.4410.26 PT0V1 AA142987 Prostate tumour overexpressed gene 1 1.4410.33 ABCG1 AA131527 ATP-binding cassette, sub-family G (WHITE), member 1 1.43+0.39 GRM3 BQ067738 Glutamate receptor, metabotropic 3 , 1.4310.27 MKI67IP R09658 MKI67 (FHA domain) interacting nucleolar phosphoprotein 1.4310.46 TNFAIP3 BM716683 Tumour necrosis factor, alpha-induced protein 3 1.4310.20 ZNF764 W38754 Zinc finger protein 764 1.4310.39 FLJ13611 H56735 Hypothetical protein FLJ13611 1.4010.27 GART R59532 Phosphoribosylglycinamide formyltransferase/synthetase, 1.4010.39 phosphoribosylaminoimidazole synthetase ISG20L1 H59600 Interferon stimulated exonuclease gene 20kDa-like 1 1.4010.35 MTM1 BG287461 Myotubularin 1 1.4010.35 TBC1D2B R48450 TBC1 domain family, member 2B 1.4010.28 159 MTR T99689 5-methyltetrahydrofolate-homocysteine methyltransferase 1.39±0.27 RPUSD1 H19375 RNA pseudouridylate synthase domain containing 1 1.39±0.26 YPEL5 BM716887 Yippee-like 5 (Drosophila) 1.39±0.38 ZAK W35313 Sterile alpha motif and leucine zipper containing kinase AZK 1.3 9±0.3 5 AGPAT7 H26802 l-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid 1.38+0.33 acyltransferase, eta) ALDOB AL563945 Aldolase B, fructose-bisphosphate 1.38+0.32 SOX6 H52386 SRY (sex determining region Y)-box 6 1.38±0.28 KIAA1267 W04767 KIAA1267 1.37±0.29 KIAA1604 N48661 KIAA1604 protein 1.37±0.19 SNIP N45643 SNAP25-interacting protein 1.37±0.37 VPS54 N79343 Vacuolar protein sorting 54 homolog (S. cerevisiae) 1.37±0.35 ATP2B4 R47740 ATPase, Ca++ transporting, plasma membrane 4 1.36±0.27 SGCD N44481 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) 1.36±0.25 SLMAP H12660 Sarcolemma associated protein 1.3610.34 LOC284998 N94730 Hypothetical protein LOC284998 1.3510.30 Clorf96 H59921 Chromosome 1 open reading frame 96 1.3410.33 CDH13 AU118872 Cadherin 13, H-cadherin (heart) 1.3410.32 KRT81 BG489894 Keratin 81 1.3410.22 ROB03 H08044 Roundabout, axon guidance receptor, homolog 3 (Drosophila) 1.3410.25 SNX10 R12040 Sorting nexin 10 1.3410.17 TMEM183B BM809949 Transmembrane protein 18 3 B 1.3 410.3 0 ZNF228 N78400 Zinc finger protein 228 1.3410.20 LOC221442 WO 1329 Hypothetical LOC221442 1.33+0.22 POLR2K W05510 Polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa 1.3310.33 TMEM144 N98471 Transmembrane protein 144 1.3310.25 BTN2A1 AV651052 Butyrophilin, subfamily 2, member Al 1.3210.28 CCDC115 W92124 Coiled-coil domain containing 115 1.3210.22 CASK N92643 Calcium/calmodulin-dependent serine protein kinase (MAGUK family) 1.3110.25 LOC492311 R35352 Similar to bovine IgA regulatory protein 1.3110.23 MDK W19684 Midkine (neurite growth-promoting factor 2) 1.3110.23 160 BCAT1 N55039 Branched chain aminotransferase 1, cytosolic 1.30±0.25 C14orfl72 AA133364 Chromosome 14 open reading frame 172 1.30±0.22 CSTF2T N45679 Cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant 1.30±0.14 INTS10 N90962 Integrator complex subunit 10 1.30±0.22 FAM124A T94496 Family with sequence similarity 124A 1.29±0.22 LIX1L N72764 Lixl homolog (mouse)-like 1.29±0.17 TTC17 AA005070 Tetratricopeptide repeat domain 17 1.29±0.22 DMXL1 H61900 Dmx-likel 1.28±0.23 DZIP3 N48837 Zinc finger DAZ interacting protein 3 1.28±0.21 LOC440104 T95157 Similar to RIKEN cDNA 1110012D08 1.28±0.21 MBNL2 N71848 Muscleblind-like 2 (Drosophila) 1.28±0.12 RAPGEF6 N93892 Rap guanine nucleotide exchange factor (GEF) 6 1.28±0.17 SBN02 T95376 Strawberry notch homolog 2 (Drosophila) 1.27±0.14 ZNF217 W05407 Zinc finger protein 217 1.27±0.18 FOXK1 N30436 Forkhead box Kl 1.26±0.18 C10orfl37 R14617 Chromosome 10 open reading frame 137 1.25±0.15 *The bold genes were selected for the RT-qPCR study 161 Appendix lib The four down-regulated genes (P<0.01) in MDA-MB-435 cells after treatment with pomiferin (5 uM) for 24 hr Gene Symbol Accession No. Description Fold Change EXDL2 BF925109 Exonuclease 3'-5' domain-like 2 0.6310.10 AMN1 T75157 Antagonist of mitotic exit network 1 homolog 0.66±0.12 IMMT H04620 Inner membrane protein, mitochondrial (mitofilin) 0.67±0.15 S100P BM854679 SI00 calcium binding protein P 0.69±0.12 *The bold genes were selected for the RT-qPCR study 162 Appendix Ilia The Dissociation Curves of PCR Products from MCF-7 Cells MnSOD 70 75 80 85 Temperature (° C) HSPA1A 0.5-1 0.4- o Derivativ e 0.1 - - \ I i 60 65 70 75 80 85 90 95 Temperature (° C) 163 FTL -0.1 70 75 80 85 Temperature (° C) GPX3 60 65 70 75 80 85 90 95 Temperature (° C) ULBP2 164 CANX TXNRD1 PSMA5 165 BCAP31 70 75 80 85 Temperature (° C) TOP2A 0.35- e 0.25- 1 •c 0.15 - 8 0.05- 1 -0.056 0 65 70 75 80 85 90 95 Temperature (°C) ID2 0.25 -, 0.2- „ 0.15- > I 0.1 " 0.05 - 1 6 0 65 70 75 80 85 90 95 -0.05 J Temperature (°C) 166 MCM7 o eo 65 70 75 80 85 90 95 -0.1 Temperature (°C) HMGB2 75 80 85 Temperature (°C) H2AFJ 0.3 -I 0.25 - a, 0.2- _> £ 0.15 - S 0.1 - 0.05 - 60 65 70 75 80 85 90 95 Temperature (°C) 167 Appendix Illb The Dissociation Curves of PCR Products from MDA-MB-435 Cells SI OOP 70 75 80 85 Temperature (°C) DICER1 168 ABCE1 0.7 n 0.6- |\ 0.5- M Derivativ e I o p 0.1 - \ 0 65 70 75 80 85 90 95 -0.1^ Temperature (°C) CDC42SE2 70 75 80 85 Temperature (°C) MFN2 70 75 80 85 Temperature (°C) 169 TFE3 70 75 80 85 90 Temperature (°C) 18srRNA 170 Appendix IVa Gel electrophoresis of RT-qPCR products from MCF-7 ^ O '-d ffi O H X 03 H =d 05 g ;> 00 E3 > O t3o Q§ n •-d > C0 in O to > O > O s x > to Digital image was taken under UV light. Gel electrophoresis was run on a 1.5% of agarose (w/v) and stained with ethidium bromide. 171 Appendix IVb Gel electrophoresis of RT-qPCR products from MDA-MB-435 *- -<- -Well i|&8ii5 ^ & W *j 6 w W Digital image was taken under UV light. Gel electrophoresis was run on a 1.5% of agarose (w/v) and stained with ethidium bromide. 172 Appendix V The biological functions and their pathway information of the regulated genes in MCF-7 cells (p<0.05) Gene Name Accession No. Description Antigen processing and presentation CTSL1 W25407 Cathepsin LI HLA-B BM793706 Major histocompatibility complex, class I, B CANX BM994316 Calnexin PSME1 N57398 Proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) Calcium signalling pathway CAMK2G BI544916 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma PRKCG HI 2977 Protein kinase C, gamma SLC25A5 BM911240 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 Cell cycle regulation THBS1 AL079948 Thrombospondin 1 BG497332 MCM6 H14471 Minichromosome maintenance complex component 6 MCM7 AL561620 Minichromosome maintenance complex component 7 PCNA W91932 Proliferating cell nuclear antigen YWHAQ BM557897 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide YWHAG H09565 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide GADD45A BM999387 Growth arrest and DNA-damage-inducible, alpha CCNA2 AA001329 Cyclin A2 Cytokine-cytokine receptor interaction BMP7 BM671826 Bone morphogenetic protein 7 (osteogenic protein 1) VEGFA N91060 Vascular endothelial growth factor A 173 PRL BG393056 Prolactin CNTFR R73050 ECM-receptor interaction Ciliary neurotrophic factor receptor THBS1 AL079948 BG497332 Thrombospondin 1 CD47 BG333273 HSPG2 AA001946 CD47 molecule ITGB5 H97449 Heparan sulfate proteoglycan 2 CD44 N28294 Integrin, beta 5 CD44 molecule (Indian blood group) Focal adhesion ITGB5 H97449 Integrin, beta 5 ACTN1 BQ017489 Actinin, alpha 1 PRKCG HI 2977 Protein kinase C, gamma THBS1 AL079948 Thrombospondin 1 THBS1 BG497332 Thrombospondin 1 VEGFA N91060 Vascular endothelial growth factor A Glutathione metabolism GPX3 R71940 Glutathione peroxidase 3 (plasma) GCLM W38982 Glutamate-cysteine ligase, modifier subunit GSTZ1 N99682 Glutathione transferase zeta 1 (maleylacetoacetate isomerase) Jak-STAT signaling pathway STAM W05099 Signal transducing adaptor molecule (SH3 domain and IT AM motif) 1 CNTFR R73050 Ciliary neurotrophic factor receptor PRL BG393056 Prolactin Leukocyte transendothelial migration GNAI1 N48427 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 ACTN1 BQO17489 Actinin, alpha 1 PRKCG H12977 Protein kinase C, gamma 174 Long-term depression GNAI1 N48427 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 PRKCG HI 2977 Protein kinase C, gamma LYN R67762 V-yes-1 Yamaguchi sarcoma viral related oncogene homolog MAPK signaling pathway STMN1 BM560697 Stathmin 1/oncoprotein 18 BF686314 BM687827 PRKCG H12977 Protein kinase C, gamma ATF4 BQ068278 Activating transcription factor 4 (tax-responsive enhancer element B67) GADD45A BM999387 Growth arrest and DNA-damage-inducible, alpha Melanogenesis CAMK2G BI544916 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma GNAI1 N48427 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 PRKCG HI 2977 Protein kinase C, gamma Natural killer cell mediated cytotoxicity PRKCG H12977 Protein kinase C, gamma ULBP2 AW959307 UL16 binding protein 2 BG675590 HLA-B BM793706 Major histocompatibility complex, class I, B Neurodegenerative Disorders GAPDH BQ067508 Glyceraldehyde-3-phosphate dehydrogenase FBXW7 H23330 F-box and WD repeat domain containing 7 SOD1 BM686754 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 N28535 (adult)) 175 W17182 PPAR signalingI pathway FABP5 R82782 Fatty acid binding protein 5 (psoriasis-associated) AC0X1 HI 5642 Acyl-Coenzyme A oxidase 1, palmitoyl FADS2 R25719 Fatty acid desaturase 2 DBI W58163 Diazepam binding inhibitor (GABA receptor modulator, acyl- W72686 Coenzyme A binding protein) ME1 R60083 Malic enzyme l,NADP(+)-dependent, cytosolic T80682 Proteasome PSMA5 BQ052293 Proteasome (prosome, macropain) subunit, alpha type, 5 BQ056718 PSMB2 AA132004 Proteasome (prosome, macropain) subunit, beta type, 2 BQ050102 PSMB4 BG397205 Proteasome (prosome, macropain) subunit, beta type, 4 Purine/Pyrimidine metabolism POLR2K W05510 Polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa RFC5 H10531 Replication factor C (activator 1) 5, 36.5kDa NME7 W24109 Non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) ENPP1 N46159 Ectonucleotide pyrophosphatase/phosphodiesterase 1 POLR2K W05510 Polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa TXNRD1 T97105 Thioredoxin reductase 1 Regulation of actin cytoskeletoi PFN2 H10616 Profilin 2 NCKAP1 N45518 NCK-associated protein 1 CYFIP2 AA034345 Cytoplasmic FMR1 interacting protein 2 CFL1 BI258438 Cofilin 1 (non-muscle) ACTN1 BQ017489 Actinin, alpha 1 ITGB5 H97449 Integrin, beta 5 176 TGF-beta signaling pathway THBS1 AL079948 Thrombospondin 1 BG497332 ID2 R83815 Inhibitor of DNA binding 2, dominant negative helix-loop-helix N44132 protein BQ014525 ID3 H13942 Inhibitor of DNA binding 3, dominant negative helix-loop-helix protein BMP7 BM671826 Bone morphogenetic protein 7 (osteogenic protein 1) Tight junction PRKCG H12977 Protein kinase C, gamma PARD6G W05503 Par-6 partitioning defective 6 homolog gamma (C. elegans) GNAI1 N48427 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 ACTN1 BQ017489 Actinin, alpha 1 VEGF signaling pathway PRKCG H12977 Protein kinase C, gamma VEGFA N91060 Vascular endothelial growth factor A Wnt signaling pathway PRKCG H12977 Protein kinase C, gamma CAMK2G BI544916 Calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma 177 Appendix VI The biological functions and their pathway information of the regulated genes in MDA-MB-435 cells (p<0.05) Gene Name Accessio Description nNo. ABC transports ABCA5 W32871 ATP-binding cassette, sub-family A (ABC1), member 5 ABCA8 AA029504 ATP-binding cassette, sub-family A (ABC1), member 8 ABCA9 AA027211 ATP-binding cassette, sub-family A (ABC1), member 9 ABCA11 R20318 ATP-binding cassette, sub-family A (ABC1), member 11 (pseudogene) ABCE1 R01839 ATP-binding cassette, sub-family E (OABP), member 1 ABCG1 AA131527 ATP-binding cassette, sub-family G (WHITE), member 1 ABCG8 H55873 ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2) Apoptosis & other cell death BCAP31 BM789856 B-cell receptor-associated protein 31 DOCK180 AL157538 dedicator of cytokinesis 1 TNFAIP3 BM716683 Tumour necrosis factor, alpha-induced protein 3 Calcium signalling pathway CALM1 R93756 Calmodulin 1 (phosphorylase kinase, delta) CAMKK1 BI195904 Calcium/calmodulin-dependent protein kinase kinase 1, alpha CASK N92643 Calcium/calmodulin-dependent serine protein kinase (MAGUK family) EFCBP1 AV730822 EF-hand calcium binding protein 1 PDE1B R24757 Phosphodiesterase IB, calmodulin-dependent PRKCD H53712 Protein kinase C, delta SI 00 A3 AA147919 SI00 calcium binding protein A3 S100A4 AA036758 SI00 calcium binding protein A4 SI OOP BM854679 SI00 calcium binding protein P Cell cycle regulation AMN1 T75157 Antagonist of mitotic exit network 1 homolog (S. cerevisiae) 178 ANAPC1 R51281 Anaphase promoting complex subunit 1 CDC6 H59203 Cell division cycle 6 homolog (S. cerevisiae) CDC7 N79336 Cell division cycle 7 homolog (S. cerevisiae) D0CK3 T78686 Dedicator of cytokinesis 3 MTSS1 H83379 Metastasis suppressor 1 NEK2 W94994 NIMA (never in mitosis gene a)-related kinase 2 NUMA1 R54756 Nuclear mitotic apparatus protein 1 PRC1 H14800 Protein regulator of cytokinesis 1 Cell differentiation EDG2 AA147456 Endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 EDG3 AA149845 Endothelial differentiation, sphingolipid G-protein-coupled receptor, 3 EID2 W05126 EP300 interacting inhibitor of differentiation 2 BM043738 Cell-cell siginailin g & Comm ADCY8 R61009 Adenylate cyclase 8 (brain) B1R W49512 bradykinin receptor Bl BPHL N46097 Biphenyl hydrolase-like (serine hydrolase; breast epithelial mucin- CSH2 associated antigen) G0LGA8A BM717592 Chorionic somatomammotropin hormone 2 GPR116 BE877114 Golgi autoantigen, golgin subfamily a, 8A GPR177 W03697 G protein-coupled receptor 116 HGF N46532 G protein-coupled receptor 177 ICA1 AA037738 Hepatocyte growth factor (hepapoietin A; scatter factor) IFIT1L AA039791 Islet cell autoantigen 1, 69kDa IGF2 R09292 Interferon-induced protein with tetratricopeptide repeats 1 -like IGFBP5 BG619049 Insulin-like growth factor 2 (somatomedin A) IKBKE W47505 Insulin-like growth factor binding protein 5 BM051314 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon ISG20L1 H59600 Interferon stimulated exonuclease gene 20kDa-like 1 ISLR2 BI914695 Immunoglobulin superfamily containing leucine-rich repeat 2 ITGAL T83460 Integrin, alpha L (antigen CD11A (pi80), lymphocyte function- 179 LOC729231 associated antigen 1; alpha polypeptide) MC1R T82817 Similar to Fos-related antigen 1 (FRA-1) MDK AI820754 Melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) MEKK3 W19684 Midkine (neurite growth-promoting factor 2) MGEA5 BM800091 mitogen-activated protein kinase kinase kinase 3 RGS18 AA126378 Meningioma expressed antigen 5 (hyaluronidase) RGS5 AA195206 Regulator of G-protein signalling 18 SDCCAG8 W37862 Regulator of G-protein signalling 5 SIGIRR N46720 Serologically defined colon cancer antigen 8 S0CS6 N24896 Single immunoglobulin and toll-interleukin 1 receptor (TIR) domain SPAG9 H44888 Suppressor of cytokine signaling 6 SSSCA1 T82899 Sperm associated antigen 9 TACSTD1 W78864 Sjogren's syndrome/scleroderma autoantigen 1 TIE1 W37704 Tumour-associated calcium signal transducer 1 TRIP 11 AA045267 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 TSTA3 AA028997 Thyroid hormone receptor interactor 11 W30866 Tissue specific transplantation antigen P35B Energy mitochondiral pathways COX 11 W24852 COX11 homolog, cytochrome c oxidase assembly protein (yeast) COX15 W63762 COX 15 homolog, cytochrome c oxidase assembly protein (yeast) COX4I1 BG255790 Cytochrome c oxidase subunit TV isoform 1 COX7B H52746 COX8A H49485 Cytochrome c oxidase subunit Vllb IMMT H44717 Cytochrome c oxidase subunit 8A (ubiquitous) MRPL18 H04620 Inner membrane protein, mitochondrial (mitofilin) MRPS12 R34109 Mitochondrial ribosomal protein LI 8 H72224 Mitochondrial ribosomal protein S12 SLC25A10 BG392309 Solute carrier family 25 (dicarboxylate transporter), member 10 SLC25A11 H15638 Solute carrier family 25 (oxoglutarate carrier), member 11 SLC25A25 H53924 Solute carrier family 25 (phosphate carrier), member 25 SLC25A5 BM911240 Solute carrier family 25 (adenine nucleotide translocator), member 5 180 Immunity regulation BPHL N46097 Biphenyl hydrolase-like (serine hydrolase; breast epithelial mucin-associated antigen) GOLGA8A BE877114 Golgi autoantigen, golgin subfamily a, 8A ICA1 AA039791 Islet cell autoantigen 1, 69kDa ISLR2 BI914695 Immunoglobulin superfamily containing leucine-rich repeat 2 ITGAL T83460 Integrin, alpha L (antigen CD11A (pi 80), lymphocyte function-associated antigen 1; LOC729231 alpha polypeptide) MGEA5 T82817 Similar to Fos-related antigen 1 (FRA-1) SDCCAG8 AA126378 Meningioma expressed antigen 5 (hyaluronidase) SIGIRR N46720 Serologically defined colon cancer antigen 8 SPAG9 N24896 Single immunoglobulin and toll-interleukin 1 receptor (TIR) domain SSSCA1 T82899 Sperm associated antigen 9 TIE1 W78864 Sjogren's syndrome/scleroderma autoantigen 1 TSTA3 AA045267 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 W30866 Tissue specific transplantation antigen P35B Lipid metabolism EDG3 AA149845 Endothelial differentiation, sphingolipid G-protein-coupled receptor, 3 ERLIN1 BF983867 ER lipid raft associated 1 FADS1 W05088 BI670486 Fatty acid desaturase 1 Protein metabolism & transport EEF1A1 AL567209 Eukaryotic translation elongation factor 1 alpha 1 EEF1E1 H24969 Eukaryotic translation elongation factor 1 epsilon 1 EIF2S1 W16774 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa EIF3S9 T84174 Eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa Protein kinase activity (various) ADCK5 T77980 AarF domain containing kinase 5 AURKA H57643 Aurora kinase A BMPR2 BE617901 Bone morphogenetic protein receptor, type II (serine/threonine kinase) 181 CDK9 W47090 Cyclin-dependent kinase 9 (CDC2-related kinase) CHKA AA057270 Choline kinase alpha IKBKE BM051314 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon KALRN R90768 Kalirin, RhoGEF kinase MAP2K6 AA203666 Mitogen-activated protein kinase kinase 6 NEK2 W94994 NIMA (never in mitosis gene a)-related kinase 2 PFKP W35243 Phosphofructokinase, platelet PIK3AP1 BM562200 Phosphoinositide-3-kinase adaptor protein 1 RP6-213H19.1 T84468 Serine/threonine protein kinase MST4 PvPS6KB2 AA284234 Ribosomal protein S6 kinase, 70kDa, polypeptide 2 SKAP1 R01281 Src kinase associated phosphoprotein 1 SYK R59656 Spleen tyrosine kinase TIE1 AA045267 Tyrosine kinase with immunoglobulin-like and EGF-like domains 1 ZAK W35313 Sterile alpha motif and leucine zipper containing kinase AZK 182