DOCSLIB.ORG

Evolutionary Conservation of Annexins in Petromyzon Marinus, Sea Lamprey, a Neurodegenerative Disease Model

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evolutionary Conservation of Annexins in Petromyzon Marinus, Sea Lamprey, a Neurodegenerative Disease Model Evolutionary Conservation of Annexins in Petromyzon marinus, Sea Lamprey, a Neurodegenerative Disease Model Caitlin Quaempts Abstract Annexin proteins are a family of well characterized calcium-dependent membrane binding proteins with highly conserved sequences, but still a diversity of function and localization. There are 12 annexins observed in humans, with annexins A2, A5, A6, and A7 having extensive research in their roles in endocytosis, exocytosis, and reducing toxic effects of aggregated proteins associated with neurodegenerative diseases. Due to the identification of multiple annexins playing roles in neuronal processes, the need to further examine the remaining annexin proteins in a neuronal environment may provide vital information in their pathophysiological roles in neurodegenerative diseases. Lamprey provide large axons for observation of this interaction and their conserved neuronal pathways with humans will allow for application of the findings, making them a good model organism. Genome, transcriptome, and phylogenetic tree analysis were performed to identify annexins present in lamprey. Annexins A2, A4, A7, A8, A10, A11, and A13 were identified in lamprey with duplication events in A2, A7, and A13 which supports previous findings. Unidentified annexins were also present in lamprey and were named annexins A14, and A15. These lamprey annexin proteins should be validated with a more complete taxonomical phylogenetic tree and can then be applied to the model organism to observe specific neuronal roles of individual annexins. Introduction: Annexin proteins are known as a family of calcium-dependent membrane binding proteins consisting of 12 subfamilies in mammals that may differ for other vertebrates, consisting of the Annexin A proteins (Moss & Morgan, 2004). There are also annexin B, C, D, and E 1 proteins for invertebrates, fungi/unicellular eukaryotes, plants, and protists, respectively, (Moss & Morgan, 2004). The fact that these proteins conserved throughout all eukaryotes and are able to be identified as annexins, even within the protists, indicates a retained function of this protein that plays a fundamental role in eukaryotic cell biology (Moss & Morgan, 2004). The ancestral founder of vertebrate annexins have been found to be ANXA13, ANXA7, and ANXA11, by multiple sources (Moss & Morgan, 2004; Morgan et al., 2004; Morgan et al., 2006). The core domain of the protein is widely conserved among all 12 subfamilies (Morgan, et al., 2004). This core domain consists of four similar repeats of about 70 amino acids in length each, which form 5-α helices per domain (Morgan, et al., 2004). These domains are characteristic of a “type 2” calcium binding motif, which has a sequence of GxGT-38 residues-D/E (Moss & Morgan, 2004). While the core amino acid sequence is largely conserved, the N-terminus and cytosolic exposed amino acids show an increased chance of sequence variety which determines protein and membrane binding interactions (Moss & Morgan, 2004). This in addition to the posttranslational modifications, like phosphorylation, can provide an explanation for the differentiation of localization and function of annexins. The different annexins have been found to interact with different proteins, such as ANXA1 with epithelial growth factor receptor, a receptor that controls proliferation, apoptosis, and angiogenesis, that is upregulated in many cancer types, ANXA2 can interact with tissue plasminogen activator, which contributes to breakdown of clots, and additional protein-protein interactions (Moss & Morgan, 2004). Although the core domain is conserved, it is clear there is a wide variation of functionality between the individual annexin proteins. Each individual annexin gene is not expressed in every cell in the body. Annexins A1, A2, A4, A5, A6, A7, and A11 have been found to be ubiquitously expressed, but other protein 2 members are more selective within the body. In addition to localization at the presynaptic terminal, some annexins may localize to the cell surface, like ANXA1, or to the nucleus at times, such as ANXA2 and ANXA11 (Moss & Morgan, 2004). Annexins have been found to function in calcium regulated exocytosis, endocytosis, and stabilization of organelles and the plasma membrane (Moss & Morgan, 2004). Specifically, annexin A7 has been found to play a role in vesicle trafficking due to its role in calcium signaling (Rescher & Gerke, 2004). Additionally, ANXA7 mediates the calcium-dependent hydrolysis of GTP that initiates exocytotic membrane fusion in neurons and chromaffin cells (Caohuy, Srivastava & Pollard, 1996). For endocytosis, cell surface expression of ANXA6 could possibly have an important role in regulating the budding of clathrin-coated vesicles (Grewal et al., 2000). In addition to ANXA6, ANXA2 has also been investigated in respect to its role in endocytic processes. This was performed by using RNAi to downregulate express of ANXA2 in HeLa cells. Results showed defects in endosomal carrier vesicles, specifically with its shape and redistribution of recycled the vesicles (Rescher & Gerke, 2004). In terms of pathological diseases, ANXA5 has even been identified as a marker in neurodegenerative diseases, such as Alzheimer’s disease, Dementia with Lewy bodies, and Parkinson’s Disease, that have overexpression of toxic protein aggregates like α-synuclein (Sohma et al., 2013). It has been hypothesized that ANXA5 is upregulated in response to protecting the neuron from calcium-induced damage (Sohma et al., 2013). ANXA5 has also been found to interact with the toxic proteins, such as α-synuclein inclusions, and eventually reduce the toxic effect of these (Bedrood et al., 2009). It appears ANXA2/ANXA6, ANXA7, and ANXA5 play a role in endocytosis, exocytosis, and reduces the toxic effects of proteins associated with neurodegenerative diseases, respectively. Neurodegenerative diseases, such as Alzheimer’s Disease and Parkinson’s Disease 3 (PD), also exhibit defects along the endocytic and exocytotic pathways in addition to the toxic effects of proteins like α-synuclein. Because the ANXA2, ANXA6, ANXA5, and ANXA7 play a role in each of these pathways, further studies of annexins could contribute to further understanding of the pathophysiology of neurodegenerative diseases. Parkinson’s Disease (PD), the second most common neurodegenerative disorder of the brain, is characterized by a loss of the dopaminergic neurons in the substantia nigra pars compacta region of the brain (Vallone et al., 2000). This part of the brain is responsible for voluntary movement, causing motor abnormalities such as stiffness, bradykinesia and resting tremor (Chinta & Anderson, 2005). The exact cause of PD is still unknown, and there are no currently available treatments that have an effect on the disease or its progression. Increased understanding of the cellular mechanisms involved, such as the regulatory role of annexins within neurons, and their evolutionary conservation may guide the identification of novel targets for treatments. In order to investigate the proteins involved in the degeneration of these neurons, the normal functions of neurons must be understood. Neurons use endo and exocytosis to transmit chemical signals, known as neurotransmitters, between one another. When this pathway is altered or defective, it can possibly lead to cell death. These neurotransmitters are packaged in organelles, known as synaptic vesicles, that are composed of a phospholipid membrane (Lodish et al., 2000). When the neuron receives an influx of calcium ions, these synaptic vesicles fuse to the plasma membrane in a process known as exocytosis, and release their neurotransmitters to the receiving neuron in order to propagate the signal (Augustine et al., 1999). After exocytosis, there is a need to regenerate the synaptic vesicle that was just lost through a process called endocytosis. This occurs through a number of regulated pathways, such as clathrin-mediated endocytosis, which causes the plasma membrane to invaginate and recreate another synaptic 4 vesicle in order to complete this recycling pathway (Augustine et al., 1999). Recycling of synaptic vesicles is a highly regulated process, so it is possible that when one regulatory protein is present at irregular levels, it can lead to defects in neuronal transmission. Studies such as Busch et al., (2014), and Banks et al (2020), have investigated the defects seen in neurons that mimic conditions of neurodegenerative diseases. This study investigated what happens in neurons immediately after injecting axons with α-synuclein, the protein seen in excess in PD patients. This showed a decrease in synaptic vesicles and irregular invaginations of the plasma membrane in comparison to control samples, indicating endocytic and exocytic defects in this synaptic vesicle recycling pathway in response to excess α-synuclein (Busch et al., 2014; Banks et al., 2020). Excess α-synuclein also interrupts the formation of the SNARE complex, a protein that regulates endocytosis, therefore inhibiting the fusion of synaptic vesicles to the plasma membrane (Bridi & Hirth, 2018). Additionally, α-synuclein is found to disrupt cellular inorganic ion homeostasis like calcium, that leads to cell death (Soma et al., 2013). It is possible that α-synuclein interacts with other regulatory proteins, like annexins, in a stoichiometrically specific interaction. Therefore, when α-synuclein is in excess, this interaction is altered and causes the synaptic vesicle recycling defects observed. Annexins play a role in
Load more

Recommended publications
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Gene Expression Signature for Biliary Atresia and a Role for Interleukin-8
    SUPPLEMENTARY “PATIENTS AND METHODS” “Gene expression signature for biliary atresia and a role for Interleukin-8 in pathogenesis of experimental disease” Bessho K, et al. PATIENTS AND METHODS Patients. Liver biopsies, serum samples and clinical data were obtained from infants with cholestasis enrolled into a prospective study (ClinicalTrials.gov Identifier: NCT00061828) of the NIDDK-funded Childhood Liver Disease Research and Education Network (www.childrennetwork.org) or from infants evaluated at Cincinnati Children’s Hospital Medical Center. For subjects with biliary atresia (BA), liver biopsies were obtained from 64 infants during the preoperative workup or at the time of intraoperative cholangiogram, with ages ranging from 22-169 days after birth (Supplementary Table 7). For subjects with intrahepatic cholestasis (serving as diseased controls, and referred to as non- BA), liver biopsy samples were obtained percutaneously or intraoperatively from 14 infants at the time of diagnostic evaluation, with ages ranging from 19-189 days. Their diagnosis were Alagille syndrome (N=1), multidrug resistance protein-3 deficiency (N=2), alpha-1-antitrypsin deficiency (N=2) and cholestasis with unknown etiology (N=9) (Supplementary Table 7). Representative liver biopsy photomicrographs are shown in Supplementary Figure 6A-D. A third group of normal controls (NC) consisted of liver biopsy samples obtained from 7 deceased-donor children aged 22-42 months as described previously (1). This group serves as a reference cohort, with the median levels of gene expression used to normalize gene expression across all patients in the BA and non-BA groups. This greatly facilitates the visual identification of key differences in gene expression levels between BA and non-BA groups.
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Human/Mouse Annexin A13 Antibody Antigen Affinity-Purified Polyclonal Goat Igg Catalog Number: AF4149
    Human/Mouse Annexin A13 Antibody Antigen Affinity-purified Polyclonal Goat IgG Catalog Number: AF4149 DESCRIPTION Species Reactivity Human/Mouse Specificity Detects endogenous human and mouse Annexin A13 in Western blots. In Western blots, this antibody did not cross­react with recombinant human Annexin A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, or A11. Source Polyclonal Goat IgG Purification Antigen Affinity­purified Immunogen E. coli­derived recombinant human Annexin A13 Met1­His316 Accession # P27216 Formulation Lyophilized from a 0.2 μm filtered solution in PBS with Trehalose. See Certificate of Analysis for details. *Small pack size (­SP) is supplied either lyophilized or as a 0.2 μm filtered solution in PBS. APPLICATIONS Please Note: Optimal dilutions should be determined by each laboratory for each application. General Protocols are available in the Technical Information section on our website. Recommended Sample Concentration Western Blot 1 µg/mL See Below DATA Western Blot Detection of Human/Mouse Annexin A13 by Western Blot. Western blot shows lysates of human and mouse small intestine tissue. PVDF membrane was probed with 1 µg/mL of Human/Mouse Annexin A13 Antigen Affinity­purified Polyclonal Antibody (Catalog # AF4149) followed by HRP­conjugated Anti­Goat IgG Secondary Antibody (Catalog # HAF017). A specific band was detected for Annexin A13 at approximately 36 kDa (as indicated). This experiment was conducted under reducing conditions and using Immunoblot Buffer Group 1. PREPARATION AND STORAGE Reconstitution Reconstitute at 0.2 mg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below.
    [Show full text]
  • Time Course of Renal Transcriptomics After Subchronic Exposure to Ochratoxin a in Fisher Rats
    toxins Article Time Course of Renal Transcriptomics after Subchronic Exposure to Ochratoxin A in Fisher Rats Laura Pastor 1,2,†,‡, Ariane Vettorazzi 1,2,*,† , Elizabeth Guruceaga 2,3 and Adela López de Cerain 1,2,† 1 Department of Pharmacology and Toxicology, Faculty of Pharmacy and Nutrition, University of Navarra, CIFA Building, c/Irunlarrea 1, E-31008 Pamplona, Spain; [email protected] (L.P.); [email protected] (A.L.d.C.) 2 IdiSNA, Navarra Institute for Health Research, E-31008 Pamplona, Spain; [email protected] 3 Bioinformatics Platform, Center for Applied Medical Research (CIMA), University of Navarra, E-31008 Pamplona, Spain * Correspondence: [email protected]; Tel.: +34-948425600 † These authors contributed equally to this work. ‡ Current address: General Mills, 31570 San Adrián, Navarra, Spain. Abstract: The mycotoxin ochratoxin A (OTA) is a potent nephrocarcinogen, mainly in male rats. The aim of this study was to determine the time course of gene expression (GeneChip® Rat Gene 2.0 ST Array, Affymetrix) in kidney samples from male and female F344 rats, treated daily (p.o) with 0.50 mg/kg b.w. (body weight) of OTA for 7 or 21 days, and evaluate if there were differences between both sexes. After OTA treatment, there was an evolution of gene expression in the kidney over time, with more differentially expressed genes (DEG) at 21 days. The gene expression time course was different between sexes with respect to the number of DEG and the direction of expression (up or down): the female response was progressive and consistent over time, whereas males had a different early response with more DEG, most of them up-regulated.
    [Show full text]
  • Annexin A13 (ANXA13) (NM 004306) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC223936 Annexin A13 (ANXA13) (NM_004306) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Annexin A13 (ANXA13) (NM_004306) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ANXA13 Synonyms: ANX13; ISA Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC223936 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCAATCGTCATGCTAAAGCGAGCAGTCCTCAGGGTTTTGATGTGGATCGAGATGCCAAAAAGCTGA ACAAAGCCTGCAAAGGAATGGGGACCAATGAAGCAGCCATCATTGAAATCTTATCGGGCAGGACATCAGA TGAGAGGCAACAAATCAAGCAAAAGTACAAGGCAACGTACGGCAAGGAGCTGGAGGAAGTACTCAAGAGT GAGCTGAGTGGAAACTTCGAGAAGACAGCGTTGGCCCTTCTGGACCATCCCAGCGAGTACGCCGCCCGGC AGCTGCAGAAGGCTATGAAGGGTCTGGGCACAGATGAGTCCGTCCTCATTGAGGTCCTGTGCACGAGGAC CAATAAGGAAATCATCGCCATTAAAGAGGCCTACCAAAGGCTATTTGATAGGAGCCTCGAATCAGATGTC AAAGGTGATACAAGTGGAAACCTAAAAAAAATCCTGGTGTCTCTGCTGCAGGCTAATCGCAATGAAGGAG ATGACGTGGACAAAGATCTAGCTGGTCAGGATGCCAAAGATCTGTATGATGCAGGGGAAGGCCGCTGGGG CACTGATGAGCTTGCGTTCAATGAAGTCCTGGCCAAGAGGAGCTACAAGCAGTTACGAGCCACCTTTCAA GCCTATCAAATTCTCATTGGCAAAGACATAGAAGAAGCCATTGAAGAAGAAACATCAGGCGACTTGCAGA AGGCCTATTTAACTCTCGTGAGATGTGCCCAGGATTGTGAGGACTATTTTGCTGAACGTCTGTACAAGTC GATGAAGGGTGCGGGGACCGATGAGGAGACGTTGATTCGCATAATCGTGACCAGGGCCGAGGTGGACCTT CAGGGGATCAAAGCAAAGTTCCAAGAGAAGTATCAGAAGTCTCTCTCTGACATGGTTCGCTCAGATACCT
    [Show full text]
  • A Comparative Quantitative LC-MS/MS Profiling Analysis Of
    proteomes Article A Comparative Quantitative LC-MS/MS Profiling Analysis of Human Pancreatic Adenocarcinoma, Adjacent-Normal Tissue, and Patient-Derived Tumour Xenografts Orla Coleman 1,* , Michael Henry 1, Fiona O’Neill 1 , Sandra Roche 1, Niall Swan 2, Lorraine Boyle 2, Jean Murphy 2, Justine Meiller 1, Neil T. Conlon 1, Justin Geoghegan 2, Kevin C. Conlon 2,3, Vincent Lynch 1,2, Ninfa L. Straubinger 4, Robert M. Straubinger 4, Gerard McVey 2,5, Michael Moriarty 1,5,†, Paula Meleady 1,† and Martin Clynes 1,† 1 National Institute for Cellular Biotechnology, Dublin City University, Glasnevin, Dublin 9, Ireland; [email protected] (M.H.); fi[email protected] (F.O.); [email protected] (S.R.); [email protected] (J.M.); [email protected] (N.T.C.); [email protected] (V.L.); [email protected] (M.M.); [email protected] (P.M.); [email protected] (M.C.) 2 St. Vincent’s University Hospital, Dublin 4, Ireland; [email protected] (N.S.); [email protected] (L.B.); [email protected] (J.M.); [email protected] (J.G.); [email protected] (K.C.C.); [email protected] (G.M.) 3 Trinity College Dublin, College Green, Dublin 2, Ireland 4 Department of Pharmaceutical Sciences, University at Buffalo, State University of New York, Buffalo, NY 14214, USA; [email protected] (N.L.S.); [email protected] (R.M.S.) 5 St. Luke’s Hospital, Highfield Road, Rathgar, Dublin 6, Ireland * Correspondence: [email protected]; Tel.: +353-01-700-5700 † These authors contributed equally to this work.
    [Show full text]
  • Annexin A5 As a Marker for Hepatocellular Carcinoma in Cirrhotic Hepatitis C Virus Patients Waleed Mohamed Serag1* and Basem Eysa Elsayed2
    Serag and Elsayed Egyptian Liver Journal (2021) 11:32 https://doi.org/10.1186/s43066-021-00101-y Egyptian Liver Journal ORIGINAL RESEARCH ARTICLE Open Access Annexin A5 as a marker for hepatocellular carcinoma in cirrhotic hepatitis C virus patients Waleed Mohamed Serag1* and Basem Eysa Elsayed2 Abstract Background: The tumorigenesis and development in a variety of cancers is reportedly encouraged via Annexin A5. The levels of Annexin A5 were tested in patients with or without HCC who were affected by liver cirrhosis. The objective of our study was to detect Annexin A5 levels in such patients in order to assess their function as an HCC marker. The longitudinal study comprised 91 cirrhotic HCV patients with and without HCC, and 20 healthy volunteers in the control group approved by the National Hepatology and Tropical Medicine Research Institute (NHTMRI) between March 2017 and August 2018.The serum levels Annexin A5 were found in all groups with ELISA. ANOVA, Mann-Whitney, and χ2 tests had been applied. Results: High scales of Annexin A5 (3.89 + 0.85) were recorded for cirrhosis with HCC, either than cirrhotic patients without HCC (3.06 ± 0.88) (P = 0.041), and either than the control group (0.54 ± 0.11) (P < 0.001). Conclusion: In HCV cirrhotic patients with and without HCC, AnxA5 can be used as HCC marker. Keywords: AnxA5 level, HCV, HCC, Cirrhosis Background of the 36 kDa molecular weight annexin family which is One of the world’s most common cancers is hepatocel- based on the Ca2+ membrane binding [4]. Inhibition of lular carcinomas (HCC).
    [Show full text]
  • A Molecular Dynamics Study Into Annexin A1 Induced Membrane Binding and Aggregation
    A Molecular Dynamics Study into Annexin A1 Induced Membrane Binding and Aggregation by Matthew P. Donohue July, 2010 Chair: Rickey P. Hicks Department of Chemistry Annexins constitute a family of proteins that bind to anionic membranes in a reversible and calcium dependent manner through the unique architecture of their calcium binding sites. In addition, annexins with relatively large N-terminal domains have been identified to cause membrane aggregation and fusion. There is a contradiction between x-ray crystallography and cryo-EM studies as to the proposed mechanism of annexin-induced membrane aggregation. Molecular dynamics simulations were performed in an effort to study the calcium dependent binding of annexin I to a phospholipid bilayer and to investigate the N- terminus as a possible second membrane binding site. Site specific mutations were created on the N-terminus to study the effects phosphorylation has on the tertiary structure of the protein. Simulation trajectories were analyzed in terms of non-bonded interaction energies of protein residues, root mean square deviations of the protein backbone, root mean square fluctuations of residues and nuclear distances between calcium ions and their oxygen ligands. Calcium coordination with lipid headgroups was observed in repeat IV of the core domain. Two lysine residues located in the N-terminus and speculated to be crucial to membrane aggregation displayed significant electrostatic attractions to the phospholipid layer based on MM-PBSA calculations. This thesis will present a model for the mechanism of interaction between annexin A1 and membranes. A Thesis A Molecular Dynamics Study into Annexin A1 Induced Membrane Binding and Aggregation Presented to the Faculty in the Department of Chemistry East Carolina University In Partial Fulfillment of the Requirements for the Degree Master of Science by Matthew P.
    [Show full text]
  • Transcriptome-Based Analysis of Kidney Gene Expression Changes Associated with Diabetes in OVE26 Mice, in the Presence and Absence of Losartan Treatment
    Transcriptome-Based Analysis of Kidney Gene Expression Changes Associated with Diabetes in OVE26 Mice, in the Presence and Absence of Losartan Treatment Radko Komers1,2, Bei Xu1,2,YiFu1,2, Aaron McClelland4, Phillip Kantharidis4, Amit Mittal3, Herbert T. Cohen3, David M. Cohen1,2* 1 Division of Nephrology and Hypertension, Department of Medicine, Oregon Health & Science University, Portland, Oregon, 2 Portland V. A. Medical Center, Portland, Oregon, United States of America, 3 Nephrology Section, Boston University School of Medicine, Boston, Massachusetts, United States of America, 4 JDRF Danielle Alberti Memorial Centre for Diabetes Complications, Diabetes Division, Baker IDI Heart and Diabetes Institute, Melbourne, Australia Abstract Diabetes is among the most common causes of end-stage renal disease, although its pathophysiology is incompletely understood. We performed next-generation sequencing-based transcriptome analysis of renal gene expression changes in the OVE26 murine model of diabetes (age 15 weeks), relative to non-diabetic control, in the presence and absence of short- term (seven-day) treatment with the angiotensin receptor blocker, losartan (n = 3–6 biological replicates per condition). We detected 1438 statistically significant changes in gene expression across conditions. Of the 638 genes dysregulated in diabetes relative to the non-diabetic state, .70% were downregulation events. Unbiased functional annotation of genes up- and down-regulated by diabetes strongly associated (p,161028) with terms for oxidative stress and for endoplasmic reticulum stress/protein folding. Most of the individual gene products up- or down-regulated with diabetes were unaffected by losartan treatment; however, of the gene products dysregulated in diabetes and influenced by losartan treatment, the vast majority of changes were in the direction of amelioration rather than exacerbation of the diabetic dysregulation.
    [Show full text]
  • Whole Rat DNA Array Survey for Candidate Genes Related To
    EXPERIMENTAL AND THERAPEUTIC MeDICINE 2: 201-212, 2011 Whole rat DNA array survey for candidate genes related to hypertension in kidneys from three spontaneously hypertensive rat substrains at two stages of age and with hypotensive induction caused by hydralazine hydrochloride KOSHO Kinoshita, MOHAMMAD SAID ASHeNAGAR, MASAKI TABUCHI and HIDeAKI HIGASHINO Department of Pharmacology, Kinki University School of Medicine, Osaka 589-8511, Japan Received October 1, 2010; Accepted December 28, 2010 DOI: 10.3892/etm.2011.193 Abstract. Clarification of the genetic nature and more effective not markedly affect quality of life when it is moderate and care for hypertension are required, given the high incidences not serious. However, when left untreated it leads to life- of cardiovascular and cerebrovascular mortality. Thus, we threatening diseases associated with atherosclerosis, including surveyed candidate genes for hypertension with rat whole gene myocardial infarction, renal failure and strokes (1-3). In Japan, DNA microarrays using three novel methods. Gene expression where general medical care should be sufficient to treat analyses were conducted as follows: Method 1, three types of hypertension, more than 300,000 patients per year die from spontaneously hypertensive rat (SHR) substrains, SHR, stroke- diseases that are related to hypertension (4,5). Clarification of prone SHR (SHRSP) and malignant type of SHRSP (M-SHRSP) the genetic nature and more effective care for hypertension were used and compared to normotensive Wistar Kyoto rats; are required. Method 2, the expressed genes between rats of different ages There are a number of methods for investigating the genetic were compared for different blood pressures; and Method 3, nature of hypertension.
    [Show full text]
  • Supplementary Table I. Morpholino Oligonucleotides and Primer Sequences Used in This Study
    Supplementary Table I. Morpholino oligonucleotides and primer sequences used in this study Oligonucleotide Name Accession Sequence Morpholinos tlr5a AY389449 5'-AAAGTGTATGTAGCTGCCATTCTGG tlr5b AY389450 5'-TGAATGTATATCCCATTCTGTGAGC myd88 AY388401 5'-TAGCAAAACCTCTGTTATCCAGCGA myd88 5bp mismatch AY388401 5'-TAcCAtAACCTgTGTTATCgAGgGA standard control morpholino 5'-CCTCTTACCTCAGTTACAATTTATA qRT-PCR ppial-qP1-Fw AY391451 5’- ACACTGAAACACGGAGGCAAAG ppial-qP2-Rev 5’- CATCCACAACCTTCCCGAACAC irak3-qP1-Fw CK026195 5’- TGAGGTCTACTGTGGACGATGG irak3-qP2-Rev 5’- ATGTTAGGATGCTGGTTGAGTTGG tlr5a-qP1-Fw AY389449 5’-ATTCTGGTGGTGCTTGTTGTAG tlr5a-qP2-Rev 5’-ACGAGGTAACTTCTGTTCTCAATG tlr5b-qP3-Fw AY389450 5’-GCGTTGTTGAAGAGGCTGGAC tlr5b-qP4-Rev 5’-TTCTGGATGGCCACTTCTCATATTGG mmp9-qP3-Fw NM_213123 5’-CATTAAAGATGCCCTGATGTATCCC mmp9-qP4-Rev 5’-AGTGGTGGTCCGTGGTTGAG il1b-qP1-Fw NM_212844 5’-GAACAGAATGAAGCACATCAAACC il1b-qP2-Rev 5’-ACGGCACTGAATCCACCAC il8-qP1-Fw XM_001342570 5’-TGTGTTATTGTTTTCCTGGCATTTC il8-qP2-Rev 5’-GCGACAGCGTGGATCTACAG ifn1-qP3-Fw NM_207640 5’- TTAATACACGCAAAGATGAGAACTC ifn1-qP4-Rev 5’- GCCAAGCCATTCGCAAGTAG tnfa-qP5-Fw NM_212829 5’- AGACCTTAGACTGGAGAGATGAC tnfa-qP6-Rev 5’- CAAAGACACCTGGCTGTAGAC cxcl-C1c-qP1-Fw NM_001115060 5’- GGCATTCACACCCAAAGCG cxcl-C1c-qP2_Rev 5’- GCGAGCACGATTCACGAGAG * In situ ccl-C5a-Fw NM_001082906 5’- CATCACTAGGAAAGGATTGAAC ccl-C5a-Rev-T7 5’- TAATACGACTCACTATAGGGGATGTCAAAGACTTTATTCAC cxcl-C1c-Fw NM_001115060 5’- GTTAAACATAAATAACACCGACTC cxcl-C1c-Rev-T7 5’- TAATACGACTCACTATAGGGACACCCTATAAAACTGAGTA irak3-Fw CK026195 5’- CAGTGAGAGAGGCATGAAACATC
    [Show full text]