DOCSLIB.ORG

Oncorhynchus Mykiss) After Yersinia Ruckeri Infection Gokhlesh Kumar1* , Karin Hummel2, Ebrahim Razzazi‑Fazeli2 and Mansour El‑Matbouli1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oncorhynchus Mykiss) After Yersinia Ruckeri Infection Gokhlesh Kumar1* , Karin Hummel2, Ebrahim Razzazi‑Fazeli2 and Mansour El‑Matbouli1 Kumar et al. Vet Res (2019) 50:54 https://doi.org/10.1186/s13567-019-0673-8 RESEARCH ARTICLE Open Access Modulation of posterior intestinal mucosal proteome in rainbow trout (Oncorhynchus mykiss) after Yersinia ruckeri infection Gokhlesh Kumar1* , Karin Hummel2, Ebrahim Razzazi‑Fazeli2 and Mansour El‑Matbouli1 Abstract Yersinia ruckeri is the causative agent of enteric redmouth disease in salmonids. In fsh, the intestine represents an important site of nutrient uptake, host–pathogen interactions, and defense. The posterior intestine can be infamed, reddened, and flled with an opaque, yellowish fuid during Y. ruckeri infection. Herein, we report an investigation on the proteome alteration in the posterior intestinal mucosa of rainbow trout (Oncorhynchus mykiss) after exposure to Y. ruckeri. The intestinal mucosal proteins were identifed and quantifed by a shotgun proteomic approach by applying data‑independent quantifcation with sequential windowed acquisition of all theoretical mass spectra (SWATH). A total of 437 proteins were found to be diferentially up‑ or downregulated in the posterior intestine. Gene ontology of upregulated proteins pointed to their involvement into exopeptidase, endopeptidase, and hydrolase activities, while the downregulated proteins were involved in lipid metabolism, actin binding, and translation processes. Additionally, upregulated proteins were predicted to be involved in lysosome, oxidative phosphorylation, and metabolic pathways, while downregulated proteins were implicated in focal adhesion, regulation of actin cytoskeleton, protein digestion and absorption pathways. This study showed that Y. ruckeri infection can alter protein abundance involved in serine‑ type carboxypeptidase, cysteine and aspartic‑type endopeptidases, metallopeptidases, antioxidant defense, calcium ion binding, glycolytic and carbohydrate metabolic processes in the proteome of the intestinal mucosa of rainbow trout. Introduction in their posterior intestines [4]. Y. ruckeri appeared to Enteric redmouth disease (ERM) is one of the major dis- adhere or invade gills and gut tissue of rainbow trout [3, eases of mainly salmonid fsh. It was frst described in 5]. Y. ruckeri can also be seen in the lumen of the intes- the 1950s in rainbow trout (Oncorhynchus mykiss) in the tine, adhering to mucus and invading villi within 30 min Hagerman Valley of Idaho, USA. Te disease is caused after exposure and can be detected 7 days post-exposure by Yersinia ruckeri, a Gram-negative rod shaped entero- (dpe) in the liver, spleen, brain, and heart [6]. bacterium, and prevalent in Europe, North and South Te strains of Y. ruckeri have been classifed on the America, Australia, South Africa, the Middle East, and basis of biotypes, serotypes (O1, O2, O3, and O4), and China [1, 2]. Te signs of the disease include exophthal- outer-membrane protein types [7]. Te majority of epizo- mia, subcutaneous hemorrhages, and splenomegaly [1]. otics in salmonids are caused by the motile serotype O1a In most cases, the intestine is infamed, reddened, and [1]. Tere are two biotypes of Y. ruckeri; biotype 1 is posi- flled with an opaque, yellowish fuid [1, 3]. In rainbow tive for motility and lipase secretion, whereas biotype 2 trout, up to 25% of infected fsh could carry Y. ruckeri is negative for both tests [8]. Te outbreaks of ERM were recorded in biotype 1-vaccinated salmonids and the iso- lates associated with these outbreaks were identifed as Y. *Correspondence: [email protected] ruckeri biotype 2 [9–12]. 1 Clinical Division of Fish Medicine, University of Veterinary Medicine, In fsh, the gastrointestinal (GI) tract is a multifunc- Vienna, Austria Full list of author information is available at the end of the article tional organ, which serves a diverse range of functions © The Author(s) 2019. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat iveco mmons .org/licen ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creat iveco mmons .org/ publi cdoma in/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Kumar et al. Vet Res (2019) 50:54 Page 2 of 14 from nutrient absorption to ionic and osmotic regula- recovered from the head kidney and confrmed using the tion and even air breathing [13–19]. Gut epithelial cells MONO-Yr kit (Bionor, Skien, Norway) or PCR [31]. No are protected by a mucus layer, which creates a physical morbid and moribund fsh were sampled for the study. and chemical barrier against an intruder and acts as an Te fsh were maintained in starvation 48 h before the important mechanism of innate defense that maintains sampling. Nine fsh from each group were sampled at tissue homeostasis [20]. Te GI tract is continuously 3, 9, and 28 dpe. Te posterior intestine of each sample challenged with food antigens as well as pathogens enter- was dissected and placed in cold sterile PBS (Sigma- ing the body via feed and water intake, and acts as the Aldrich, Neustadt, Germany). Te intestine was opened frst line of defense against pathogen attachment and along the mesenteric border and washed three times with invasion [20–22]. Te posterior portion of the GI tract cold sterile PBS containing a cocktail of mammalian pro- is a site where uptake of macromolecules and foreign tease inhibitors (Sigma-Aldrich) to remove digesta and antigens occurs, which leads to antigen uptake and pro- fecal matter. Intestinal mucosa was scraped with a ster- cessing as well as the initiation of a systemic immune ile large scalpel blade. Each sample was divided into two response [20, 23]. Te disease has been of a major con- parts, one immediately snap-frozen in liquid nitrogen for cern in salmonids, which infuences the physiological proteomic analysis, and one fxed in RNALater (Sigma- response of fsh. Rainbow trout is highly susceptible to Aldrich) for molecular analysis and stored at −80 °C. ERM [1]. Te efect of natural herbal products on growth performance, hematological and biochemical values and Protein extraction resistance to Y. ruckeri infection was studied as a feed additives for rainbow trout [24, 25]. Equal amounts (30 mg) of nine individual intestinal In ERM, hyperemia and hemorrhages throughout the mucosal samples from each group were pooled randomly intestinal mucosa in rainbow trout have been observed as three pools of three samples each in order to mini- [1]. Te intestinal response of rainbow trout has been mize the efects of individual variation. It refers to N = 3 mainly studied at the transcription level, especially for the biological replicates per time point (3, 9 and 28 regarding immune gene expression [26–29]. It is still dpe) and per exposed group (control, Y. ruckeri biotype largely unknown how the gut mucosal proteome of the 1 and biotype 2). Each pool was ground using a sterilized rainbow trout responds to alternations in the luminal mortar and pestle in the presence of liquid nitrogen to a environment triggered by Y. ruckeri. Terefore, in the fne powder, which was then mixed with 800 μL of pre- current study, we aimed to evaluate the possible efects cooled denaturing lysis bufer (7 M urea, 2 M thiourea, of Y. ruckeri exposure on the modulation of the proteome 4% CHAPS, and 1% DTT) containing mammalian pro- profle in the posterior intestine of rainbow trout. In tease inhibitor cocktail (Sigma-Aldrich). Te samples order to meet this aim, we applied a label-free shotgun were subjected to ultrasonic disruption for 10 cycles of proteomic approach. 10 s pulse-on and 30 s pulse-of. Te samples were then centrifuged at 12 000 rpm for 20 min at 4 °C to remove Materials and methods any cellular debris. Te supernatant was collected. Te protein content was measured using the Pierce 660 nm Collecting posterior intestine samples Protein Assay (Termo Scientifc, Vienna, Austria). Te details of the experimental setup have been described in our previous study [30]. Briefy, specifc pathogen free Protein digestion rainbow trout (15 ± 1 cm) were allocated to 9 aquaria, 18 fsh per aquarium. In order to monitor the efect of Te protein digestion was performed following a stand- Y. ruckeri exposure, the following three treatments were ard enhanced, flter-aided sample preparation protocol given in parallel—Treatment 1: an exposure with biotype (FASP) [32]. Briefy, after washing, proteins were reduced 1 (CSF007–82), Treatment 2: an exposure with biotype 2 and alkylated. On-flter digestion was performed with (A7959–11), and Treatment 3: a mock exposure to sterile 1.2 µg Trypsin/Lys-C mix (Promega, Madison, USA) for tryptic soya broth. In both the test groups, the fsh were 14 h at 37 °C. Digested peptides were recovered, dried, 6 challenged by bath exposing to 2 × 10 colony forming and redissolved in 0.1% aqueous trifuoroacetic acid. units (CFU) of Y. ruckeri biotype 1 (CSF007-82) and Y. After desalting and sample cleanup by C18 ZipTips ruckeri biotype 2 (A7959-11) strains for 2 h. Te fsh were (Sigma-Aldrich), all samples were spiked with standard- maintained in a fow-through system supplied with UV- ized indexed retention time reference peptides for facili- treated ground water at 19 ± 1 °C, monitored daily, and tation of retention time alignment (iRT kit, Biognosys, morbid, moribund, and dead fsh were taken out imme- Switzerland). For each liquid chromatography (LC)–mass diately from the aquaria. Te mortality of fsh was only spectrometer (MS) analysis, 3 µg of digested protein was considered to be caused by Y. ruckeri if the bacteria were loaded onto the LC column. Kumar et al. Vet Res (2019) 50:54 Page 3 of 14 Microfow high‑performance liquid search, and 0.0011 Da in MS and 0.01 Da in MSMS mode chromatography electrospray‑ionisation for the fnal search.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Proteome Analysis Reveals a Role of Rainbow Trout Lymphoid Organs During Yersinia Ruckeri Infection Process
    www.nature.com/scientificreports Correction: Author Correction OPEN Proteome analysis reveals a role of rainbow trout lymphoid organs during Yersinia ruckeri infection Received: 14 February 2018 Accepted: 30 August 2018 process Published online: 18 September 2018 Gokhlesh Kumar 1, Karin Hummel2, Katharina Noebauer2, Timothy J. Welch3, Ebrahim Razzazi-Fazeli2 & Mansour El-Matbouli1 Yersinia ruckeri is the causative agent of enteric redmouth disease in salmonids. Head kidney and spleen are major lymphoid organs of the teleost fsh where antigen presentation and immune defense against microbes take place. We investigated proteome alteration in head kidney and spleen of the rainbow trout following Y. ruckeri strains infection. Organs were analyzed after 3, 9 and 28 days post exposure with a shotgun proteomic approach. GO annotation and protein-protein interaction were predicted using bioinformatic tools. Thirty four proteins from head kidney and 85 proteins from spleen were found to be diferentially expressed in rainbow trout during the Y. ruckeri infection process. These included lysosomal, antioxidant, metalloproteinase, cytoskeleton, tetraspanin, cathepsin B and c-type lectin receptor proteins. The fndings of this study regarding the immune response at the protein level ofer new insight into the systemic response to Y. ruckeri infection in rainbow trout. This proteomic data facilitate a better understanding of host-pathogen interactions and response of fsh against Y. ruckeri biotype 1 and 2 strains. Protein-protein interaction analysis predicts carbon metabolism, ribosome and phagosome pathways in spleen of infected fsh, which might be useful in understanding biological processes and further studies in the direction of pathways. Enteric redmouth disease (ERM) causes signifcant economic losses in salmonids worldwide.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • BMC Veterinary Research Biomed Central
    BMC Veterinary Research BioMed Central Methodology article Open Access Loop-mediated isothermal amplification as an emerging technology for detection of Yersinia ruckeri the causative agent of enteric red mouth disease in fish Mona Saleh1, Hatem Soliman1,2 and Mansour El-Matbouli*1 Address: 1Clinic for Fish and Reptiles, Faculty of Veterinary Medicine, University of Munich, Germany, Kaulbachstr.37, 80539 Munich, Germany and 2Veterinary Serum and Vaccine Research Institute, El-Sekka El-Beda St., P.O. Box 131, Abbasia, Cairo, Egypt Email: Mona Saleh - [email protected]; Hatem Soliman - [email protected]; Mansour El-Matbouli* - El- [email protected] * Corresponding author Published: 12 August 2008 Received: 29 May 2008 Accepted: 12 August 2008 BMC Veterinary Research 2008, 4:31 doi:10.1186/1746-6148-4-31 This article is available from: http://www.biomedcentral.com/1746-6148/4/31 © 2008 Saleh et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Enteric Redmouth (ERM) disease also known as Yersiniosis is a contagious disease affecting salmonids, mainly rainbow trout. The causative agent is the gram-negative bacterium Yersinia ruckeri. The disease can be diagnosed by isolation and identification of the causative agent, or detection of the Pathogen using fluorescent antibody tests, ELISA and PCR assays. These diagnostic methods are laborious, time consuming and need well trained personnel. Results: A loop-mediated isothermal amplification (LAMP) assay was developed and evaluated for detection of Y.
    [Show full text]
  • IHC Test Menu
    Immunohistochemistry Test Menu A Alpha fetoprotein [I AFP] CD99 Ewings sarcoma PNET [I CD99] Anaplastic lymphoma kinase -1 [I ALK] CD103 Integrin alpha E [I CD103] Androgen receptor [I ANDRO]* CD117 C-Kit, myeloid, mast cells, GIST [I CD117] Annexin A1, hairy cell, B cell lymphoma [I ANXA1] CD138 plasma cells, subset epithelial cells [I CD138] Anti-Arginase-1 [I ARGINASE] CD163 histiocytes [I CD163] CDK4 cyclin-depdendent kinase-4, clone DCS-31 [I CDK4] B CDX2 colorectal carcinoma [I CDX2] BCL2 follicular lymphoma, apoptosis inhibiting protein [I BCL2] Chromogranin A [I CHROGRAN] BCL6 follicle center B-cell [I BCL6] CMYC C-MYC oncoprotein [I CMYC] BER EP4 Epithelial antigen [I BER EP4] Collagen IV, basement membrane protein [I CLLGIV] BRAF [I V600E] Cyclin D1/PRAD1 mantle cell lymphoma [I CYCLIN] Cytokeratin 5/6, squamous, mesothelial [I CK5/6] C Cytokeratin 7, 54kD [I CK7] CA 19-9 pancreas, liver, ovary, lung tumors [I CA19 9] Cytokeratin 7/8 CAM5.2 [I CAM 5.2] CA 125 epitheliod malignancies ovary, breast [I CA125] Cytokeratin 8, 35BH11 [I CK8] Calcitonin [I CALCT] Cytokeratin 8/18, adenocarcinoma [I CK8/18] Caldesmon, smooth muscle [I CALDSM] Cytokeratin 19 [I CK19] Calretinin; Calcium binding protein [I CALRT] Cytokeratin 20 [I CK20] CAM 5.2 Cytokeratin 7/Cytokeratin 8 [I CAM 5.2] Cytokeratin cocktail, PAN (AE1/AE3) [I AE1/AE3] Carcinoembryonic antigen (CEA) [I CEA] Cytokeratin high molecular weight; 34BE12 [I CK HMW] Cathepsin D, breast carcinoma [I CATHD] Cytomegalovirus [I CMV] CD1a cortical thymocyctes, Langerhans cells [I CD1a]
    [Show full text]
  • This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research
    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Al Ahdal, Hadil Title: Investigating the role of miR-21 in adult neurogenesis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. Investigating the role of miR-21 in adult neurogenesis Hadil Mohammad Al Ahdal Faculty of Health Sciences Bristol Medical School A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School 64,598 words Abstract MicroRNAs (miRNAs) are a class of small non-coding RNAs that act as post- transcriptional regulators and play important roles in neurodegenerative diseases and brain disorders (Nelson et al.
    [Show full text]
  • Immunohistochemistry Stain Offerings
    immunohistochemistry stain offerings TRUSTED PATHOLOGISTS. INVALUABLE ANSWERS.™ MARCHMAY 20172021 www.aruplab.com/ap-ihcaruplab.com/ap-ihc InformationInformation in this brochurein this brochure is current is current as of as May of March 2021. 2017. All content All content is subject is subject to tochange. change. Please contactPlease ARUPcontact ClientARUP Services Client Services at 800-522-2787 at (800) 522-2787 with any with questions any questions or concerns.or concerns. ARUP LABORATORIES As a nonprofit, academic institution of the University of Utah and its Department We believe in of Pathology, ARUP believes in collaborating, sharing and contributing to laboratory science in ways that benefit our clients and their patients. collaborating, Our test menu is one of the broadest in the industry, encompassing more sharing and than 3,000 tests, including highly specialized and esoteric assays. We offer comprehensive testing in the areas of genetics, molecular oncology, pediatrics, contributing pain management, and more. to laboratory ARUP’s clients include many of the nation’s university teaching hospitals and children’s hospitals, as well as multihospital groups, major commercial science in ways laboratories, and group purchasing organizations. We believe that healthcare should be delivered as close to the patient as possible, which is why we support that provide our clients’ efforts to be the principal healthcare provider in the communities they serve by offering highly complex assays and accompanying consultative support. the best value Offering analytics, consulting, and decision support services, ARUP provides for the patient. clients with the utilization management tools necessary to prosper in this time of value-based care.
    [Show full text]
  • 1 Infectious Pancreatic Necrosis Virus Arun K
    1 Infectious Pancreatic Necrosis Virus ARUN K. DHAR,1,2* SCOTT LAPATRA,3 ANDREW ORRY4 AND F.C. THOMas ALLNUTT1 1BrioBiotech LLC, Glenelg, Maryland, USA; 2Aquaculture Pathology Laboratory, School of Animal and Comparative Biomedical Sciences, The University of Arizona, Tucson, Arizona, USA; 3Clear Springs Foods, Buhl, Idaho, USA; 4Molsoft, San Diego, California, USA 1.1 Introduction and as a genome-linked protein, VPg, via guany- lylation of VP1 (Fig. 1.1 and Table 1.1). Infectious pancreatic necrosis virus (IPNV), the aetio- Aquabirnaviruses have broad host ranges and logical agent of infectious pancreatic necrosis (IPN), differ in their optimal replication temperatures. is a double-stranded RNA (dsRNA) virus in the fam- They consist of four serogroups A, B, C and D ily Birnaviridae (Leong et al., 2000; ICTV, 2014). (Dixon et al., 2008), but most belong to serogroup The four genera in this family include Aquabirnavirus, A, which is divided into serotypes A1–A9.The A1 Avibirnavirus, Blosnavirus and Entomobirnavirus serotype contains most of the US isolates (reference (Delmas et al., 2005), and they infect vertebrates and strain West Buxton), serotypes A2–A5 are primar- invertebrates. Aquabirnavirus infects aquatic species ily European isolates (reference strains, Ab and (fish, molluscs and crustaceans) and has three spe- Hecht) and serotypes A6–A9 include isolates from cies: IPNV, Yellowtail ascites virus and Tellina virus. Canada (reference strains C1, C2, C3 and Jasper). IPNV, which infects salmonids, is the type species. The IPNV genome consists of two dsRNAs, segments A and B (Fig. 1.1; Leong et al., 2000). Segment A 1.1.1 IPNV morphogenesis has ~ 3100 bp and contains two partially overlap- ping open reading frames (ORFs).
    [Show full text]
  • A Review of Fish Vaccine Development Strategies: Conventional Methods and Modern Biotechnological Approaches
    microorganisms Review A Review of Fish Vaccine Development Strategies: Conventional Methods and Modern Biotechnological Approaches Jie Ma 1,2 , Timothy J. Bruce 1,2 , Evan M. Jones 1,2 and Kenneth D. Cain 1,2,* 1 Department of Fish and Wildlife Sciences, College of Natural Resources, University of Idaho, Moscow, ID 83844, USA; [email protected] (J.M.); [email protected] (T.J.B.); [email protected] (E.M.J.) 2 Aquaculture Research Institute, University of Idaho, Moscow, ID 83844, USA * Correspondence: [email protected] Received: 25 October 2019; Accepted: 14 November 2019; Published: 16 November 2019 Abstract: Fish immunization has been carried out for over 50 years and is generally accepted as an effective method for preventing a wide range of bacterial and viral diseases. Vaccination efforts contribute to environmental, social, and economic sustainability in global aquaculture. Most licensed fish vaccines have traditionally been inactivated microorganisms that were formulated with adjuvants and delivered through immersion or injection routes. Live vaccines are more efficacious, as they mimic natural pathogen infection and generate a strong antibody response, thus having a greater potential to be administered via oral or immersion routes. Modern vaccine technology has targeted specific pathogen components, and vaccines developed using such approaches may include subunit, or recombinant, DNA/RNA particle vaccines. These advanced technologies have been developed globally and appear to induce greater levels of immunity than traditional fish vaccines. Advanced technologies have shown great promise for the future of aquaculture vaccines and will provide health benefits and enhanced economic potential for producers. This review describes the use of conventional aquaculture vaccines and provides an overview of current molecular approaches and strategies that are promising for new aquaculture vaccine development.
    [Show full text]
  • Calbindin-D28k and Its Role in Apoptosis: Inhibition of Caspase-3 Activity and Interaction with Pro-Caspase-3 Investigated by In-Situ FRET Microscopy
    Dissertation Aus dem Physiologischen Institut Lehrstuhl: Physiologie – Zelluläre Physiologie (Biomedizinisches Zentrum München) der Ludwig-Maximilians-Universität München Vorstand: Prof. Dr. Claudia Veigel Calbindin-D28k and its role in apoptosis: Inhibition of Caspase-3 activity and interaction with Pro-Caspase-3 investigated by in-situ FRET microscopy. Dissertation zum Erwerb des Doktorgrades der Medizin an der Medizinischen Fakultät der Ludwig-Maximilians-Universität zu München vorgelegt von Johannes Lohmeier aus Bong Town, Liberia 2018 Mit Genehmigung der Medizinischen Fakultät der Universität München Berichterstatter: Prof. Dr. Michael Meyer Prof. Dr. Alexander Faussner Mitberichterstatter: Prof. Dr. Nikolaus Plesnila Prof. Dr. Dr. Bernd Sutor Dekan: Prof. Dr. med. dent. Reinhard Hickel Tag der mündlichen Prüfung: 14.06.2018 Eidesstattliche Versicherung Lohmeier, Johannes Name, Vorname Ich erkläre hiermit an Eides statt, dass ich die vorliegende Dissertation mit dem Thema Calbindin-D28k and its role in apoptosis: Inhibition of Caspase-3 activity and interaction with Pro-Caspase-3 investigated by in-situ FRET microscopy. selbständig verfasst, mich außer der angegebenen keiner weiteren Hilfsmittel bedient und alle Erkenntnisse, die aus dem Schrifttum ganz oder annähernd übernommen sind, als solche kenntlich gemacht und nach ihrer Herkunft unter Bezeichnung der Fundstelle einzeln nachgewiesen habe. Ich erkläre des Weiteren, dass die hier vorgelegte Dissertation nicht in gleicher oder in ähnlicher Form bei einer anderen Stelle zur Erlangung
    [Show full text]
  • Deliverable D3.1
    AQUAEXCEL 262336– Deliverable D3.1 AQUAEXCEL Aquaculture Infrastructures for Excellence in European Fish Research Project number: 262336 Combination of CP & CSA Seventh Framework Programme Capacities Deliverable 3.1 Sanitary prescriptions and procedures for transfer, and safety standards Due date of deliverable: M12 Actual submission date: M13 Start date of the project: March 1st, 2011 Duration: 48 months Organisation name of lead contractor: ULPGC Revision: Gunnar Senneset Project co-funded by the European Commission within the Seventh Framework Programme (2007-2013) Dissemination Level PU Public PP Restricted to other programme participants (including the Commission Services) RE Restricted to a group specified by the consortium (including the Commission Services) CO Confidential, only for members of the consortium (including the Commission Services) Page 1 of 122 AQUAEXCEL 262336– Deliverable D3.1 Table of contents Glossary 5 Summary 6 Introduction 7 CHAPTER I I.- Fish diseases: Diagnosis and surveillance 9 I.1.- Exotic diseases according to Directive 2006/88 EC 12 I.1.1.- Epizootic haematopoietic necrosis 12 I.1.2.- Epizootic ulcerative syndrome 13 I.2.- Non-exotic diseases according to Directive 2006/88 EC 14 I.2.1.- Infectious haematopoietic necrosis 14 I.2.2.- Infectious salmon anaemia 16 I.2.3.- Koi herpes virus disease 18 I.2.4.- Viral haemorrhagic septicaemia 20 I.3.- Other important diseases of interest for the AQUAEXCEL Project 22 I.3.1.- Other viral diseases of interest for AQUAEXCEL 22 I.3.1.1.- Nodavirosis 22 I.3.1.2.- Red sea bream iridoviral disease 23 I.3.1.3.- Infectious pancreatic necrosis 24 I.3.1.4.- Spring viraemia of carp 25 I.3.2.- Other bacterial diseases of interest for AQUAEXCEL 26 I.3.2.1.
    [Show full text]
  • Chemical Agent and Antibodies B-Raf Inhibitor RAF265
    Supplemental Materials and Methods: Chemical agent and antibodies B-Raf inhibitor RAF265 [5-(2-(5-(trifluromethyl)-1H-imidazol-2-yl)pyridin-4-yloxy)-N-(4-trifluoromethyl)phenyl-1-methyl-1H-benzp{D, }imidazol-2- amine] was kindly provided by Novartis Pharma AG and dissolved in solvent ethanol:propylene glycol:2.5% tween-80 (percentage 6:23:71) for oral delivery to mice by gavage. Antibodies to phospho-ERK1/2 Thr202/Tyr204(4370), phosphoMEK1/2(2338 and 9121)), phospho-cyclin D1(3300), cyclin D1 (2978), PLK1 (4513) BIM (2933), BAX (2772), BCL2 (2876) were from Cell Signaling Technology. Additional antibodies for phospho-ERK1,2 detection for western blot were from Promega (V803A), and Santa Cruz (E-Y, SC7383). Total ERK antibody for western blot analysis was K-23 from Santa Cruz (SC-94). Ki67 antibody (ab833) was from ABCAM, Mcl1 antibody (559027) was from BD Biosciences, Factor VIII antibody was from Dako (A082), CD31 antibody was from Dianova, (DIA310), and Cot antibody was from Santa Cruz Biotechnology (sc-373677). For the cyclin D1 second antibody staining was with an Alexa Fluor 568 donkey anti-rabbit IgG (Invitrogen, A10042) (1:200 dilution). The pMEK1 fluorescence was developed using the Alexa Fluor 488 chicken anti-rabbit IgG second antibody (1:200 dilution).TUNEL staining kits were from Promega (G2350). Mouse Implant Studies: Biopsy tissues were delivered to research laboratory in ice-cold Dulbecco's Modified Eagle Medium (DMEM) buffer solution. As the tissue mass available from each biopsy was limited, we first passaged the biopsy tissue in Balb/c nu/Foxn1 athymic nude mice (6-8 weeks of age and weighing 22-25g, purchased from Harlan Sprague Dawley, USA) to increase the volume of tumor for further implantation.
    [Show full text]