Role and Specificity of LGI4-ADAM22 Interactions in Peripheral Nerve Myelination Linde Kegel
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Human ADAM12 Quantikine ELISA
Quantikine® ELISA Human ADAM12 Immunoassay Catalog Number DAD120 For the quantitative determination of A Disintegrin And Metalloproteinase domain- containing protein 12 (ADAM12) concentrations in cell culture supernates, serum, plasma, and urine. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION .....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ...................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE .................................................................................................................................2 TECHNICAL HINTS .................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ...................................................................................................3 OTHER SUPPLIES REQUIRED .............................................................................................................................................3 PRECAUTIONS .........................................................................................................................................................................4 -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Conservation and Divergence of ADAM Family Proteins in the Xenopus Genome
Wei et al. BMC Evolutionary Biology 2010, 10:211 http://www.biomedcentral.com/1471-2148/10/211 RESEARCH ARTICLE Open Access ConservationResearch article and divergence of ADAM family proteins in the Xenopus genome Shuo Wei*1, Charles A Whittaker2, Guofeng Xu1, Lance C Bridges1,3, Anoop Shah1, Judith M White1 and Douglas W DeSimone1 Abstract Background: Members of the disintegrin metalloproteinase (ADAM) family play important roles in cellular and developmental processes through their functions as proteases and/or binding partners for other proteins. The amphibian Xenopus has long been used as a model for early vertebrate development, but genome-wide analyses for large gene families were not possible until the recent completion of the X. tropicalis genome sequence and the availability of large scale expression sequence tag (EST) databases. In this study we carried out a systematic analysis of the X. tropicalis genome and uncovered several interesting features of ADAM genes in this species. Results: Based on the X. tropicalis genome sequence and EST databases, we identified Xenopus orthologues of mammalian ADAMs and obtained full-length cDNA clones for these genes. The deduced protein sequences, synteny and exon-intron boundaries are conserved between most human and X. tropicalis orthologues. The alternative splicing patterns of certain Xenopus ADAM genes, such as adams 22 and 28, are similar to those of their mammalian orthologues. However, we were unable to identify an orthologue for ADAM7 or 8. The Xenopus orthologue of ADAM15, an active metalloproteinase in mammals, does not contain the conserved zinc-binding motif and is hence considered proteolytically inactive. We also found evidence for gain of ADAM genes in Xenopus as compared to other species. -
Selective Inhibition of ADAM12 Catalytic Activity Through
Selective inhibition of ADAM12 catalytic activity through engineering of tissue inhibitor of metalloproteinases (TIMP)-2 Marie Kveiborg, Jonas Jacobsen, Meng-Huee Lee, Hideaki Nagase, Ulla M Wewer, Gillian Murphy To cite this version: Marie Kveiborg, Jonas Jacobsen, Meng-Huee Lee, Hideaki Nagase, Ulla M Wewer, et al.. Selective inhibition of ADAM12 catalytic activity through engineering of tissue inhibitor of metalloproteinases (TIMP)-2. Biochemical Journal, Portland Press, 2010, 430 (1), pp.79-86. 10.1042/BJ20100649. hal-00506526 HAL Id: hal-00506526 https://hal.archives-ouvertes.fr/hal-00506526 Submitted on 28 Jul 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Biochemical Journal Immediate Publication. Published on 10 Jun 2010 as manuscript BJ20100649 Selective inhibition of ADAM12 catalytic activity through engineering of tissue inhibitor of metalloproteinases (TIMP)-2 Marie Kveiborg*,§, Jonas Jacobsen*,§, Meng-Huee Lee†, Hideaki Nagase‡, Ulla M. Wewer*,¶, and Gillian Murphy†,¶ *Department of Biomedical Sciences and Biotech Research and Innovation Centre (BRIC), University of Copenhagen, Ole Maaløes Vej 5, 2200 Copenhagen, Denmark †Department of Oncology, Cambridge University, Cancer Research Institute, Li Ka Shing Centre, Cambridge CB2 ORE, UK ‡Kennedy Institute of Rheumatology Division, Faculty of Medicine, Imperial College London, 65 Aspenlea Road, London W6 8LH, UK §,¶These authors contributed equally to the study. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Differential Gene Expression and Functional Analysis Implicate Novel Mechanisms in Enteric Nervous System Precursor Migration and Neuritogenesis
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Biology 298 (2006) 259–271 www.elsevier.com/locate/ydbio Differential gene expression and functional analysis implicate novel mechanisms in enteric nervous system precursor migration and neuritogenesis Bhupinder P.S. Vohra a, Keiji Tsuji b,c, Mayumi Nagashimada b,d, Toshihiro Uesaka b, ⁎ ⁎ Daniel Wind a, Ming Fu a, Jennifer Armon a, Hideki Enomoto b, , Robert O. Heuckeroth a, a Department of Pediatrics and Department of Molecular Biology and Pharmacology, Washington University School of Medicine, 660 S. Euclid Avenue, Box 8208, St. Louis, MO 63110, USA b Laboratory for Neuronal Differentiation and Regeneration, RIKEN Center for Developmental Biology, 2-2-3 Minatojima-minamimachi, Chuo-ku, Kobe, Hyogo 650-0047, Japan c Department of Pediatrics, Kyoto Prefectural University of Medicine, Graduate School of Medical Science, Kamigyo-ku, Kyoto 602-8566, Japan d Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan Received for publication 17 April 2006; revised 17 May 2006; accepted 22 June 2006 Available online 27 June 2006 Abstract Enteric nervous system (ENS) development requires complex interactions between migrating neural-crest-derived cells and the intestinal microenvironment. Although some molecules influencing ENS development are known, many aspects remain poorly understood. To identify additional molecules critical for ENS development, we used DNA microarray, quantitative real-time PCR and in situ hybridization to compare gene expression in E14 and P0 aganglionic or wild type mouse intestine. Eighty-three genes were identified with at least two-fold higher expression in wild type than aganglionic bowel. -
(P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds. -
Comparative Transcriptome Analyses Reveal Genes Associated with SARS-Cov-2 Infection of Human Lung Epithelial Cells
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.24.169268; this version posted June 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Comparative transcriptome analyses reveal genes associated with SARS-CoV-2 infection of human lung epithelial cells Darshan S. Chandrashekar1, *, Upender Manne1,2,#, Sooryanarayana Varambally1,2,3,#* 1Department of Pathology, University of Alabama at Birmingham, Birmingham, AL 2Comprehensive Cancer Center, University of Alabama at Birmingham, Birmingham, AL 3Institute of Informatics, University of Alabama at Birmingham, Birmingham, AL # Share Senior Authorship (UM Email: [email protected]) *Correspondence to: Sooryanarayana Varambally, Ph.D., Molecular and Cellular Pathology, Department of Pathology, Wallace Tumor Institute, 4th floor, 20B, University of Alabama at Birmingham, Birmingham, AL 35233, USA Phone: (205) 996-1654 Email: [email protected] And Darshan S. Chandrashekar Ph.D., Department of Pathology, University of Alabama at Birmingham, Birmingham, AL Email: [email protected] Running Title: SARS-CoV-2 gene signature in infected lung epithelial cells Disclosure of Potential Conflicts of Interest: No potential conflicts of interest were disclosed. Page | 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.24.169268; this version posted June 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: Understanding the molecular mechanism of SARS-CoV-2 infection (the cause of COVID-19) is a scientific priority for 2020. Various research groups are working toward development of vaccines and drugs, and many have published genomic and transcriptomic data related to this viral infection. -
View / Download 3.3 Mb
Identification of Mechanisms and Pathways Involved in MLL2-Mediated Tumorigenesis by Chun-Chi Chang Department of Pathology Duke University Date:_______________________ Approved: ___________________________ Yiping He, Supervisor ___________________________ Salvatore Pizzo ___________________________ Hai Yan Thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in the Department of Pathology in the Graduate School of Duke University 2013 ABSTRACT Identification of Mechanisms and Pathways Involved in MLL2-Mediated Tumorigenesis by Chun-Chi Chang Department of Pathology Duke University Date:_______________________ Approved: ___________________________ Yiping He, Supervisor ___________________________ Salvatore Pizzo ___________________________ Hai Yan An abstract of a thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in the Department of Pathology in the Graduate School of Duke University 2013 Copyright by Chun-Chi Chang 2013 Abstract Myeloid/lymphoid or mixed-lineage leukemia (MLL)-family genes encode histone lysine methyltransferases that play important roles in epigenetic regulation of gene transcription, and these genes are frequently mutated in human cancers. While MLL1 and MLL4 have been the most extensively studied, MLL2 and its homolog MLL3 are not well-understood. Specifically, little is known regarding the extent of global MLL2 involvement in the regulation of gene expression and the mechanism underlying its alterations in mediating tumorigenesis. To study the role of MLL2 in tumorigenesis, we somatically knocked out MLL2 in a colorectal carcinoma cell line, HCT116. We observed that the MLL2 loss of function results in significant reduction of cell growth and multinuclear morphology. We further profiled MLL2 regulated genes and pathways by analyzing gene expression in MLL2 wild-type versus MLL2-null isogenic cell lines. -
Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................ -
Supplementary Table 1
Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7