Neuronal Cytoskeleton in Intellectual Disability: from Systems Biology and Modeling to Therapeutic Opportunities
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. - 
												
												The Wiskott-Aldrich Syndrome: the Actin Cytoskeleton and Immune Cell Function
Disease Markers 29 (2010) 157–175 157 DOI 10.3233/DMA-2010-0735 IOS Press The Wiskott-Aldrich syndrome: The actin cytoskeleton and immune cell function Michael P. Blundella, Austen Wortha,b, Gerben Boumaa and Adrian J. Thrashera,b,∗ aMolecular Immunology Unit, UCL Institute of Child Health, London, UK bDepartment of Immunology, Great Ormond Street Hospital NHS Trust, Great Ormond Street, London, UK Abstract. Wiskott-Aldrich syndrome (WAS) is a rare X-linked recessive primary immunodeficiency characterised by immune dysregulation, microthrombocytopaenia, eczema and lymphoid malignancies. Mutations in the WAS gene can lead to distinct syndrome variations which largely, although not exclusively, depend upon the mutation. Premature termination and deletions abrogate Wiskott-Aldrich syndrome protein (WASp) expression and lead to severe disease (WAS). Missense mutations usually result in reduced protein expression and the phenotypically milder X-linked thrombocytopenia (XLT) or attenuated WAS [1–3]. More recently however novel activating mutations have been described that give rise to X-linked neutropenia (XLN), a third syndrome defined by neutropenia with variable myelodysplasia [4–6]. WASP is key in transducing signals from the cell surface to the actin cytoskeleton, and a lack of WASp results in cytoskeletal defects that compromise multiple aspects of normal cellular activity including proliferation, phagocytosis, immune synapse formation, adhesion and directed migration. Keywords: Wiskott-Aldrich syndrome, actin polymerization, lymphocytes, - 
												
												ACTR2 Antibody / Arp2 (RQ5865)
ACTR2 Antibody / Arp2 (RQ5865) Catalog No. Formulation Size RQ5865 0.5mg/ml if reconstituted with 0.2ml sterile DI water 100 ug Bulk quote request Availability 1-3 business days Species Reactivity Human, Mouse, Rat, Monkey Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit IgG Purity Affinity purified Buffer Lyophilized from 1X PBS with 2% Trehalose and 0.025% sodium azide UniProt P61160 Applications Western blot : 0.5-1ug/ml Immunohistochemistry : 1-2ug/ml Immunofluorescence : 2-4ug/ml Flow cytometry : 1-3ug/million cells Direct ELISA : 0.1-0.5ug/ml Limitations This ACTR2 antibody is available for research use only. IHC staining of FFPE human breast cancer with ACTR2 antibody. HIER: boil tissue sections in pH8 EDTA for 20 min and allow to cool before testing. Immunofluorescent staining of FFPE human A549 cells with ACTR2 antibody (green) and DAPI nuclear stain (blue). HIER: steam section in pH6 citrate buffer for 20 min. Western blot testing of 1) rat kidney, 2) rat spleen, 3) mouse HEPA1-6, 4) mouse SP2/0, 5) monkey COS-7 and human 6) U-87 MG, 7) Jurkat, 8) PC-3 and 9) U-2 OS lysate with ACTR2 antibody. Predicted molecular weight ~45 kDa. Flow cytometry testing of human A431 cells with ACTR2 antibody at 1ug/million cells (blocked with goat sera); Red=cells alone, Green=isotype control, Blue= ACTR2 antibody. Flow cytometry testing of mouse ANA-1 cells with ACTR2 antibody at 1ug/million cells (blocked with goat sera); Red=cells alone, Green=isotype control, Blue= ACTR2 antibody. Description The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. - 
												
												Regulation of Cdc42 and Its Effectors in Epithelial Morphogenesis Franck Pichaud1,2,*, Rhian F
© 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs217869. doi:10.1242/jcs.217869 REVIEW SUBJECT COLLECTION: ADHESION Regulation of Cdc42 and its effectors in epithelial morphogenesis Franck Pichaud1,2,*, Rhian F. Walther1 and Francisca Nunes de Almeida1 ABSTRACT An overview of Cdc42 Cdc42 – a member of the small Rho GTPase family – regulates cell Cdc42 was discovered in yeast and belongs to a large family of small – polarity across organisms from yeast to humans. It is an essential (20 30 kDa) GTP-binding proteins (Adams et al., 1990; Johnson regulator of polarized morphogenesis in epithelial cells, through and Pringle, 1990). It is part of the Ras-homologous Rho subfamily coordination of apical membrane morphogenesis, lumen formation and of GTPases, of which there are 20 members in humans, including junction maturation. In parallel, work in yeast and Caenorhabditis elegans the RhoA and Rac GTPases, (Hall, 2012). Rho, Rac and Cdc42 has provided important clues as to how this molecular switch can homologues are found in all eukaryotes, except for plants, which do generate and regulate polarity through localized activation or inhibition, not have a clear homologue for Cdc42. Together, the function of and cytoskeleton regulation. Recent studies have revealed how Rho GTPases influences most, if not all, cellular processes. important and complex these regulations can be during epithelial In the early 1990s, seminal work from Alan Hall and his morphogenesis. This complexity is mirrored by the fact that Cdc42 can collaborators identified Rho, Rac and Cdc42 as main regulators of exert its function through many effector proteins. - 
												
												Table 2. Significant
Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S. - 
												
												ARHGEF7 (B-PIX) Is Required for the Maintenance of Podocyte Architecture and Glomerular Function
BASIC RESEARCH www.jasn.org ARHGEF7 (b-PIX) Is Required for the Maintenance of Podocyte Architecture and Glomerular Function Jun Matsuda, Mirela Maier, Lamine Aoudjit, Cindy Baldwin, and Tomoko Takano Division of Nephrology, McGill University Health Centre, Montreal, Quebec, Canada ABSTRACT Background Previous studies showed that Cdc42, a member of the prototypical Rho family of small GTPases and a regulator of the actin cytoskeleton, is critical for the normal development and health of podocytes. However, upstream regulatory mechanisms for Cdc42 activity in podocytes are largely unknown. Methods We used a proximity-based ligation assay, BioID, to identify guanine nucleotide exchange fac- tors that activate Cdc42 in immortalized human podocytes. We generated podocyte-specificARHGEF7 (commonly known as b-PIX) knockout mice by crossing b-PIX floxed mice with Podocin-Cre mice. Using shRNA, we established cultured mouse podocytes with b-PIX knockdown and their controls. Results We identified b-PIX as a predominant guanine nucleotide exchange factor that interacts with Cdc42 in human podocytes. Podocyte-specific b-PIX knockout mice developed progressive proteinuria and kidney failure with global or segmental glomerulosclerosis in adulthood. Glomerular podocyte density gradually decreased in podocyte-specific b-PIX knockout mice, indicating podocyte loss. Compared with controls, glomeruli from podocyte-specific b-PIX knockout mice and cultured mouse podocytes with b-PIX knockdown exhibited significant reduction in Cdc42 activity. Loss of b-PIX promoted podocyte apoptosis, which was mediated by the reduced activity of the prosurvival transcriptional regulator Yes-associated protein. Conclusions These findings indicate that b-PIX is required for the maintenance of podocyte architecture and glomerular function via Cdc42 and its downstream Yes-associated protein activities. - 
												
												The Atypical Guanine-Nucleotide Exchange Factor, Dock7, Negatively Regulates Schwann Cell Differentiation and Myelination
The Journal of Neuroscience, August 31, 2011 • 31(35):12579–12592 • 12579 Cellular/Molecular The Atypical Guanine-Nucleotide Exchange Factor, Dock7, Negatively Regulates Schwann Cell Differentiation and Myelination Junji Yamauchi,1,3,5 Yuki Miyamoto,1 Hajime Hamasaki,1,3 Atsushi Sanbe,1 Shinji Kusakawa,1 Akane Nakamura,2 Hideki Tsumura,2 Masahiro Maeda,4 Noriko Nemoto,6 Katsumasa Kawahara,5 Tomohiro Torii,1 and Akito Tanoue1 1Department of Pharmacology and 2Laboratory Animal Resource Facility, National Research Institute for Child Health and Development, Setagaya, Tokyo 157-8535, Japan, 3Department of Biological Sciences, Tokyo Institute of Technology, Midori, Yokohama 226-8501, Japan, 4IBL, Ltd., Fujioka, Gumma 375-0005, Japan, and 5Department of Physiology and 6Bioimaging Research Center, Kitasato University School of Medicine, Sagamihara, Kanagawa 252-0374, Japan In development of the peripheral nervous system, Schwann cells proliferate, migrate, and ultimately differentiate to form myelin sheath. In all of the myelination stages, Schwann cells continuously undergo morphological changes; however, little is known about their underlying molecular mechanisms. We previously cloned the dock7 gene encoding the atypical Rho family guanine-nucleotide exchange factor (GEF) and reported the positive role of Dock7, the target Rho GTPases Rac/Cdc42, and the downstream c-Jun N-terminal kinase in Schwann cell migration (Yamauchi et al., 2008). We investigated the role of Dock7 in Schwann cell differentiation and myelination. Knockdown of Dock7 by the specific small interfering (si)RNA in primary Schwann cells promotes dibutyryl cAMP-induced morpholog- ical differentiation, indicating the negative role of Dock7 in Schwann cell differentiation. It also results in a shorter duration of activation of Rac/Cdc42 and JNK, which is the negative regulator of myelination, and the earlier activation of Rho and Rho-kinase, which is the positive regulator of myelination. - 
												
												A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. - 
												
												Cdc42 and Rac1 Activity Is Reduced in Human Pheochromocytoma and Correlates with FARP1 and ARHGEF1 Expression
234 P Croisé et al. Rho-GTPase activity in human 23:4 281–293 Research pheochromocytoma Cdc42 and Rac1 activity is reduced in human pheochromocytoma and correlates with FARP1 and ARHGEF1 expression Pauline Croisé1, Sébastien Houy1, Mathieu Gand1, Joël Lanoix2, Valérie Calco1, Petra Tóth1, Laurent Brunaud3, Sandra Lomazzi4, Eustache Paramithiotis2, Daniel Chelsky2, Stéphane Ory1,* and Stéphane Gasman1,* Correspondence 1Institut des Neurosciences Cellulaires et Intégratives (INCI), CNRS UPR 3212, Strasbourg, France should be addressed 2Caprion Proteome, Inc., Montréal, Québec, Canada to S Ory or S Gasman 3Service de Chirurgie Digestive, Hépato-bilaire et Endocrinienne, CHRU Nancy, Hôpitaux de Brabois, Email Vandoeuvre les Nancy, France [email protected] or 4Centre de Ressources Biologiques (CRB), CHRU Nancy, Hôpitaux de Brabois, Vandoeuvres les Nancy, France [email protected] *(S Ory and S Gasman contributed equally to this work) Abstract Among small GTPases from the Rho family, Cdc42, Rac, and Rho are well known to mediate Key Words a large variety of cellular processes linked with cancer biology through their ability to cycle f Rho-GTPases between an inactive (GDP-bound) and an active (GTP-bound) state. Guanine nucleotide f pheochromocytoma exchange factors (GEFs) stimulate the exchange of GDP for GTP to generate the activated f mass spectrometry form, whereas the GTPase-activating proteins (GAPs) catalyze GTP hydrolysis, leading to f Rho-GEF Endocrine-Related Cancer Endocrine-Related the inactivated form. Modulation of Rho GTPase activity following altered expression of Rho-GEFs and/or Rho-GAPs has already been reported in various human tumors. However, nothing is known about the Rho GTPase activity or the expression of their regulators in human pheochromocytomas, a neuroendocrine tumor (NET) arising from chromaffin cells of the adrenal medulla. - 
												
												Focus on Cdc42 in Breast Cancer: New Insights, Target Therapy Development and Non-Coding Rnas
Review Focus on Cdc42 in Breast Cancer: New Insights, Target Therapy Development and Non-Coding RNAs Yu Zhang †, Jun Li †, Xing-Ning Lai, Xue-Qiao Jiao, Jun-Ping Xiong and Li-Xia Xiong * Department of Pathophysiology, Jiangxi Province Key Laboratory of Tumor Pathogenesis and Molecular Pathology, Medical College, Nanchang University, 461 Bayi Road, Nanchang 330006, China; [email protected] (Y.Z.); [email protected] (J.L.); [email protected] (X.-N.L.); [email protected] (X.-Q.J.); [email protected] (J.-P.X.) * Correspondence: [email protected]; Tel.: +86-791-8636-0556 † These authors contributed equally to this work. Received: 30 December 2018; Accepted: 8 February 2019; Published: 11 February 2019 Abstract: Breast cancer is the most common malignant tumors in females. Although the conventional treatment has demonstrated a certain effect, some limitations still exist. The Rho guanosine triphosphatase (GTPase) Cdc42 (Cell division control protein 42 homolog) is often upregulated by some cell surface receptors and oncogenes in breast cancer. Cdc42 switches from inactive guanosine diphosphate (GDP)-bound to active GTP-bound though guanine-nucleotide- exchange factors (GEFs), results in activation of signaling cascades that regulate various cellular processes such as cytoskeletal changes, proliferation and polarity establishment. Targeting Cdc42 also provides a strategy for precise breast cancer therapy. In addition, Cdc42 is a potential target for several types of non-coding RNAs including microRNAs and lncRNAs. These non-coding RNAs is extensively involved in Cdc42-induced tumor processes, while many of them are aberrantly expressed. Here, we focus on the role of Cdc42 in cell morphogenesis, proliferation, motility, angiogenesis and survival, introduce the Cdc42-targeted non-coding RNAs, as well as present current development of effective Cdc42-targeted inhibitors in breast cancer. - 
												
												CRAVAT 4: Cancer-Related Analysis of Variants Toolkit David L
Cancer Focus on Computer Resources Research CRAVAT 4: Cancer-Related Analysis of Variants Toolkit David L. Masica1,2, Christopher Douville1,2, Collin Tokheim1,2, Rohit Bhattacharya2,3, RyangGuk Kim4, Kyle Moad4, Michael C. Ryan4, and Rachel Karchin1,2,5 Abstract Cancer sequencing studies are increasingly comprehensive and level interpretation, including joint prioritization of all nonsilent well powered, returning long lists of somatic mutations that can be mutation consequence types, and structural and mechanistic visu- difficult to sort and interpret. Diligent analysis and quality control alization. Results from CRAVAT submissions are explored in an can require multiple computational tools of distinct utility and interactive, user-friendly web environment with dynamic filtering producing disparate output, creating additional challenges for the and sorting designed to highlight the most informative mutations, investigator. The Cancer-Related Analysis of Variants Toolkit (CRA- even in the context of very large studies. CRAVAT can be run on a VAT) is an evolving suite of informatics tools for mutation inter- public web portal, in the cloud, or downloaded for local use, and is pretation that includes mutation mapping and quality control, easily integrated with other methods for cancer omics analysis. impact prediction and extensive annotation, gene- and mutation- Cancer Res; 77(21); e35–38. Ó2017 AACR. Background quickly returning mutation interpretations in an interactive and user-friendly web environment for sorting, visualizing, and An investigator's work is far from over when results are returned inferring mechanism. CRAVAT (see Supplementary Video) is from the sequencing center. Depending on the service, genetic suitable for large studies (e.g., full-exome and large cohorts) mutation calls can require additional mapping to include all and small studies (e.g., gene panel or single patient), performs relevant RNA transcripts or correct protein sequences. - 
												
												KIF1A-Related Autosomal Dominant Spastic Paraplegias (SPG30) in Russian Families G
Rudenskaya et al. BMC Neurology (2020) 20:290 https://doi.org/10.1186/s12883-020-01872-4 RESEARCH ARTICLE Open Access KIF1A-related autosomal dominant spastic paraplegias (SPG30) in Russian families G. E. Rudenskaya1 , V. A. Kadnikova1* , O. P. Ryzhkova1 , L. A. Bessonova1, E. L. Dadali1 , D. S. Guseva1 , T. V. Markova1 , D. N. Khmelkova2 and A. V. Polyakov1 Abstract Background: Spastic paraplegia type 30 (SPG30) caused by KIF1A mutations was first reported in 2011 and was initially considered a very rare autosomal recessive (AR) form. In the last years, thanks to the development of massive parallel sequencing, SPG30 proved to be a rather common autosomal dominant (AD) form of familial or sporadic spastic paraplegia (SPG),, with a wide range of phenotypes: pure and complicated. The aim of our study is to detect AD SPG30 cases and to examine their molecular and clinical characteristics for the first time in the Russian population. Methods: Clinical, genealogical and molecular methods were used. Molecular methods included massive parallel sequencing (MPS) of custom panel ‘spastic paraplegias’ with 62 target genes complemented by familial Sanger sequencing. One case was detected by the whole -exome sequencing. Results: AD SPG30 was detected in 10 unrelated families, making it the 3rd (8.4%) most common SPG form in the cohort of 118 families. No AR SPG30 cases were detected. In total, 9 heterozygous KIF1A mutations were detected, with 4 novel and 5 known mutations. All the mutations were located within KIF1A motor domain. Six cases had pure phenotypes, of which 5 were familial, where 2 familial cases demonstrated incomplete penetrance, early onset and slow relatively benign SPG course.