DOCSLIB.ORG

Serum Response Factor Is Essential for Maintenance of Podocyte Structure and Function

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

BRIEF COMMUNICATION www.jasn.org Serum Response Factor Is Essential for Maintenance of Podocyte Structure and Function Bing Guo,1,2 Qing Lyu,1 Orazio J. Slivano,1 Ronald Dirkx,1 Christine K. Christie,1 Jan Czyzyk,3 Aram F. Hezel,4 Ali G. Gharavi,5 Eric M. Small,1 and Joseph M. Miano1 1Aab Cardiovascular Research Institute, University of Rochester School of Medicine and Dentistry, Rochester, New York; 2Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; 3Department of Pathology and Laboratory Medicine and 4James P. Wilmot Cancer Center, University of Rochester School of Medicine and Dentistry, Rochester, New York; and 5Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, New York ABSTRACT Podocytes contain an intricate actin cytoskeleton that is essential for the specialized SRF is expressed in podocytes of the function of this cell type in renal filtration. Serum response factor (SRF) is a master adult mouse and human kidney (Figure transcription factor for the actin cytoskeleton, but the in vivo expression and function 1A), with onset of expression in mice of SRF in podocytes are unknown. We found that SRF protein colocalizes with podo- occurring between embryonic day 18.5 cyte markers in human and mouse kidneys. Compared with littermate controls, mice in and postnatal day 0 (Supplemental Fig- which the Srf gene was conditionally inactivated with NPHS2-Cre exhibited early post- ure 1A). A genetic cross to inactivate Srf natal proteinuria, hypoalbuminemia, and azotemia. Histologic changes in the mutant in podocytes (Figure 1B) yielded an mice included glomerular capillary dilation and mild glomerulosclerosis, with reduced expected Mendelian ratio of pups (Sup- expression of multiple canonical podocyte markers. We also noted tubular dilation, cell plemental Figure 1B) with normal proliferation, and protein casts as well as reactive changes in mesangial cells and in- glomerular structure (Supplemental terstitial inflammation. Ultrastructure analysis disclosed foot process effacement with Figure 1C). Furthermore, quantitative loss of slit diaphragms. To ascertain the importance of SRF cofactors in podocyte func- immunofluorescence microscopy (IFM) tion, we disabled the myocardin-related transcription factor A and B genes. Although showed no change in the expression of loss of either SRF cofactor alone had no observable effect in the kidney, deficiency of SRF in podocytes of newborn, podocyte- both recapitulated the Srf-null phenotype. These results establish a vital role for SRF specific Srf KO mice (Supplemental Fig- and two SRF cofactors in the maintenance of podocyte structure and function. ure 1, D and E). Together, these results suggest that SRF plays little, if any, role in J Am Soc Nephrol 29: 416–422, 2018. doi: https://doi.org/10.1681/ASN.2017050473 glomerulogenesis during embryonic de- velopment. Asignificant reduction of SRF/WT1- positive cells was observed in Srf KO mice Podocytes are terminally differentiated Podocyte-specificknockout(KO)ofSRF- between 3 and 6 weeks after birth (Figure cells of the glomerulus with elaborate ex- dependent cytoskeletal-associated genes, 1, C and D, Supplemental Figure 2). Al- tensions of the cell body that terminate as such as Tln1,6 Cfl1,7 Itgb1,8 and Tjp1,9 re- though Srf KO mice were indistinguishable interdigitating foot processes separated sults in defective glomerular function. SRF by slit diaphragms essential for selective is regulated by PRKDC,10 a kinase that has filtration at the glomerular filtration been implicated as a susceptibility gene for Received May 1, 2017. Accepted October 11, 2017. barrier. adriamycin-induced nephropathy,11 and Maintenance of podocyte structure and INF2, which has mutations that contribute Published online ahead of print. Publication date function is dependent on a complex actin to FSGS.12 However, the specificroleof available at www.jasn.org. cytoskeleton.1 Serum response factor SRF in the kidney and particularly, within Correspondence: Dr. Joseph M. Miano, Aab (SRF) is a transcription factor that podocytes is ill defined. Here, evidence is Cardiovascular Research Institute, University of Rochester School of Medicine and Dentistry, 601 binds a DNA cis-acting element known provided in support of an essential role of Elmwood Avenue, Rochester, NY 14642. Email: j.m. as a CArG box.2 Conserved CArG boxes SRF and two of its cofactors in maintaining [email protected] are adjacent to thousands of genes, includ- the structure and function of podocytes in Copyright © 2018 by the American Society of – ing numerous cytoskeletal genes.3 5 mice. Nephrology 416 ISSN : 1046-6673/2902-416 J Am Soc Nephrol 29: 416–422, 2018 www.jasn.org BRIEF COMMUNICATION Significance statement The structure and function of podocytes are dependent on an intricate actin cytoskele- ton. Serum response factor (SRF) is a mas- ter regulator of the actin cytoskeleton; however, there is little information about SRFinpodocytebiology.Podocyte-specific knockout of Srf in mice results in foot pro- cess effacement and renal failure, leading to early death. Combined genetic in- activation of the SRF cofactors Mkl1/Mkl2 phenocopies the Srf knockout. Cultured podocytes with reduced SRF exhibit de- fects in the actin cytoskeleton and dys- regulated expression of several genes, including those necessary for a functional actin cytoskeleton. SRF and MKL1/MKL2 arecriticalforpodocytestructureand normal renal function. Future work should evaluate these factors in human renal disease and interrogate target genes essential for podocyte homeostasis. Quantitative histopathology established progressive tubular dilation, protein cast formation, and glomerular capil- lary dilation in Srf KO mice (Figure 2, FandG).Lotus tetragonolobus lectin staining indicated dilation of both prox- imal and distal tubules (Supplemental Figure 3). Occasional instances of glo- merulosclerosis were observed at 6 weeks of age with little to no interstitial fibrosis (Supplemental Figure 4), likely due to the rapid onset of kidney failure. IFM of Srf KO mice showed lower expression and irregular distribution of several po- docyte markers, including a–Actinin-4, Synaptopodin, Podocin, and Nephrin (Figure 3, A–C). Furthermore, upregu- lation of smooth muscle a-actin and Figure 1. Generation of podocyte-specific Srf KO mice. (A) IFM of sections of human and vWF was seen in Srf KO glomeruli (Sup- mouse kidney shows SRF expression in both podocytes and nonpodocytes. Podocytes plemental Figure 5, A and B), suggestive were identified by immunolabeling of Synaptopodin or WT1. Note that efforts to reliably of reactive changes in mesangial cells show WT1 in human podocytes were unsuccessful. (B) General strategy for generating and glomerular capillary endothelial fi podocyte-speci c Srf KO mice. (C) Representative images of control and mutant glomeruli cells, respectively. Srf KO mice also ex- immunolabeled with anti-WT1 (podocyte marker) and anti-SRF antibodies (Supplemental fi Figure 2 shows single-channel images). (D) Quantitative IFM of control and mutant glo- hibited an in ltration of CD45-positive fl meruli (n=15) shows 44.5%, 68.8%, and 62.2% reductions of SRF+/WT1+ podocytes at 3, 4, in ammatory cells within the tubuloin- and 6 weeks, respectively. Scale bars, 50 mminA,upperpanel;20mm in A, lower panel and terstitium and Ki67 staining in tubular C. ***P,0.001. epithelial cells; no such findings were evident in control mice or within the from littermate controls at birth, they leukocyturia (Figure 2, C and D) as well as glomerulus of Srf KO mice (Supplemen- exhibited a notable decrease in body size elevated serum creatinine and BUN, with tal Figure 5, C–E). The presence of (Figure 2A) and body weight (Figure 2B) concomitant hypoalbuminemia (Figure inflammatory cells and proliferative tu- at 6 weeks of age. Srf KOs also displayed 2E). Death occurred by 7 weeks of age bular epithelial cells of Srf KO mice increased urinary protein, hematuria, and in both male and female Srf KO mice. likely represents a secondary response to J Am Soc Nephrol 29: 416–422, 2018 Podocyte-Specific Srf Knockout 417 BRIEF COMMUNICATION www.jasn.org Figure 2. Postnatal nephropathy and renal failure in podocyte-specific Srf KO mice. (A and B) Decreased body size and body weight in Srf KO mice compared with control mice at 6 weeks of age (n$5 age-matched male mice). (C) Coomassie Blue staining of urine samples shows massive proteinuria in 3-week-old mutant mice. (D) Dipstick analysis indicates increased urinary protein (left panel), red blood cells (RBCs; center panel), and white blood cells (WBCs; right panel) of mutant mice between 3 and 6 weeks of age (n$7). (E) Serum analysis reveals elevated creatinine (left panel) and BUN (center panel) and decreased albumin (right panel) in 6-week-old Srf KO mice (n$5). (F) He- matoxylin and Eosin staining of kidneys at 6 weeks of age. Note dilated tubules (arrowhead), glomerular capillary dilation (asterisk), and cast formation (arrow) in Srf KO kidneys (n$3). (G) Quantitative measures of dilated tubules, protein casts, and glomerular capillary dilation in control versus Srf KO kidneys at 3, 4, and 6 weeks of age (n$30 fields of view in three or more mice per condition). Scale bars, 100 mmin F, top panel; 40 mm in F, middle panel; 20 mminF,bottompanel.*P,0.05; **P,0.01; ***P,0.001. 418 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 416–422, 2018 www.jasn.org BRIEF COMMUNICATION Figure 3. Podocyte marker expression and ultrastructural abnormalities in Srf KO mice. (A–C) IFM shows diminished and punctate staining of (A) a–Actinin-4, (B) Synaptopodin and Podocin, and (C) Nephrin in mutant mice (n=3) at 4 and 6 weeks of age. (D and E) Representative (D) scanning electron microscopy (SEM) and (E) transmission electron microscopy (TEM) of control and Srf KO kidneys (n=2 each for control and mutant). Note (D, lower panel) foot process effacement and (E, bottom panel) loss of slit diaphragms in Srf KO.
Recommended publications
  • List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene

    List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene

    List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0
  • SETD1B-Associated Neurodevelopmental Disorder

    SETD1B-Associated Neurodevelopmental Disorder

    Genotype- phenotype correlations J Med Genet: first published as 10.1136/jmedgenet-2019-106756 on 16 June 2020. Downloaded from Original research SETD1B- associated neurodevelopmental disorder Alexandra Roston ,1 Dan Evans,2 Harinder Gill,1,3 Margaret McKinnon,1 Bertrand Isidor,4 Benjamin Cogné ,4,5 Jill Mwenifumbo,1,6 Clara van Karnebeek,7,8 Jianghong An,9 Steven J M Jones,9 Matthew Farrer,2 Michelle Demos,10 Mary Connolly,10 William T Gibson ,1 CAUSES Study, EPGEN Study ► Additional material is ABSTRACT same gene allows causal inference for those geno- published online only. To view Background Dysfunction of histone methyltransferases type–phenotype correlations. This is especially true please visit the journal online (http:// dx. doi. org/ 10. 1136/ and chromatin modifiers has been implicated in complex when perturbation of the general biological process jmedgenet- 2019- 106756). neurodevelopmental syndromes and cancers. SETD1B has, in similar contexts, been shown reproducibly encodes a lysine- specific methyltransferase that assists to result in similar phenotypes. For numbered affiliations see in transcriptional activation of genes by depositing Individual case reports have appeared in the end of article. H3K4 methyl marks. Previous reports of patients with literature describing neurodevelopmental delays rare variants in SETD1B describe a distinctive phenotype associated with rare coding variants in SETD1B, Correspondence to Dr Alexandra Roston, that includes seizures, global developmental delay and and with hemizygosity for SETD1B due to CNVs. Department of Medical intellectual disability. Here we show that pathogenic variants within Genetics, The University of Methods Two of the patients described herein were SETD1B contribute to a conserved phenotype that British Columbia, Vancouver, BC identified via genome-wide and exome-wide testing, includes intellectual disability and childhood- onset, V6T 1Z4, Canada; with microarray and research- based exome, through treatment- refractory seizures.
  • MRTF: Basic Biology and Role in Kidney Disease

    MRTF: Basic Biology and Role in Kidney Disease

    International Journal of Molecular Sciences Review MRTF: Basic Biology and Role in Kidney Disease Maria Zena Miranda 1, Zsuzsanna Lichner 1, Katalin Szászi 1,2 and András Kapus 1,2,3,* 1 Keenan Research Centre for Biomedical Science of the St. Michael’s Hospital, Toronto, ON M5B 1W8, Canada; [email protected] (M.Z.M.); [email protected] (Z.L.); [email protected] (K.S.) 2 Department of Surgery, University of Toronto, Toronto, ON M5T 1P5, Canada 3 Department of Biochemistry, University of Toronto, Toronto, ON M5S 1A8, Canada * Correspondence: [email protected] Abstract: A lesser known but crucially important downstream effect of Rho family GTPases is the regulation of gene expression. This major role is mediated via the cytoskeleton, the organization of which dictates the nucleocytoplasmic shuttling of a set of transcription factors. Central among these is myocardin-related transcription factor (MRTF), which upon actin polymerization translocates to the nucleus and binds to its cognate partner, serum response factor (SRF). The MRTF/SRF complex then drives a large cohort of genes involved in cytoskeleton remodeling, contractility, extracellular matrix organization and many other processes. Accordingly, MRTF, activated by a variety of mechanical and chemical stimuli, affects a plethora of functions with physiological and pathological relevance. These include cell motility, development, metabolism and thus metastasis formation, inflammatory responses and—predominantly-organ fibrosis. The aim of this review is twofold: to provide an up- to-date summary about the basic biology and regulation of this versatile transcriptional coactivator; and to highlight its principal involvement in the pathobiology of kidney disease.
  • Gene Expression During Normal and FSHD Myogenesis Tsumagari Et Al

    Gene Expression During Normal and FSHD Myogenesis Tsumagari Et Al

    Gene expression during normal and FSHD myogenesis Tsumagari et al. Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 (27 September 2011) Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 RESEARCHARTICLE Open Access Gene expression during normal and FSHD myogenesis Koji Tsumagari1, Shao-Chi Chang1, Michelle Lacey2,3, Carl Baribault2,3, Sridar V Chittur4, Janet Sowden5, Rabi Tawil5, Gregory E Crawford6 and Melanie Ehrlich1,3* Abstract Background: Facioscapulohumeral muscular dystrophy (FSHD) is a dominant disease linked to contraction of an array of tandem 3.3-kb repeats (D4Z4) at 4q35. Within each repeat unit is a gene, DUX4, that can encode a protein containing two homeodomains. A DUX4 transcript derived from the last repeat unit in a contracted array is associated with pathogenesis but it is unclear how. Methods: Using exon-based microarrays, the expression profiles of myogenic precursor cells were determined. Both undifferentiated myoblasts and myoblasts differentiated to myotubes derived from FSHD patients and controls were studied after immunocytochemical verification of the quality of the cultures. To further our understanding of FSHD and normal myogenesis, the expression profiles obtained were compared to those of 19 non-muscle cell types analyzed by identical methods. Results: Many of the ~17,000 examined genes were differentially expressed (> 2-fold, p < 0.01) in control myoblasts or myotubes vs. non-muscle cells (2185 and 3006, respectively) or in FSHD vs. control myoblasts or myotubes (295 and 797, respectively). Surprisingly, despite the morphologically normal differentiation of FSHD myoblasts to myotubes, most of the disease-related dysregulation was seen as dampening of normal myogenesis- specific expression changes, including in genes for muscle structure, mitochondrial function, stress responses, and signal transduction.
  • Oligogenic Inheritance of Congenital Heart Disease Involving a NKX2-5 Modifier

    Oligogenic Inheritance of Congenital Heart Disease Involving a NKX2-5 Modifier

    bioRxiv preprint doi: https://doi.org/10.1101/266726; this version posted February 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Title: Oligogenic inheritance of congenital heart disease involving a NKX2-5 modifier Short Title: Oligogenic congenital heart disease Authors: Casey A. Gifford1,2, Sanjeev S. Ranade1,2, Ryan Samarakoon1,2, Hazel T. Salunga1,2, T. Yvanka de Soysa1,2, Yu Huang1, Ping Zhou1, Aryé Elfenbein1,2, Stacia K. Wyman1†, Yen Kim Bui1,2, Kimberly R. Cordes Metzler1,2, Philip Ursell3, Kathryn N. Ivey1,2,4§ and Deepak Srivastava1,2,4,5,* Affiliations: 1 Gladstone Institute of Cardiovascular Disease, San Francisco, CA 94158, USA 2 Roddenberry Center for Stem Cell Biology and Medicine at Gladstone, San Francisco, CA 94158, USA Departments of 3 Pathology, 4 Pediatrics, and 5 Biochemistry and Biophysics, University of California, San Francisco, San Francisco, CA 94143, USA † Current address: Innovative Genomics Institute, Berkeley, CA 94704 § Current address: Tenaya Therapeutics, South San Francisco, CA 94080 *Corresponding author: Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/266726; this version posted February 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract Complex genetic inheritance is thought to underlie many human diseases, yet experimental proof of this model has been elusive.
  • A Set of Regulatory Genes Co-Expressed in Embryonic Human Brain Is Implicated in Disrupted Speech Development

    A Set of Regulatory Genes Co-Expressed in Embryonic Human Brain Is Implicated in Disrupted Speech Development

    Molecular Psychiatry https://doi.org/10.1038/s41380-018-0020-x ARTICLE A set of regulatory genes co-expressed in embryonic human brain is implicated in disrupted speech development 1 1 1 2 3 Else Eising ● Amaia Carrion-Castillo ● Arianna Vino ● Edythe A. Strand ● Kathy J. Jakielski ● 4,5 6 7 8 9 Thomas S. Scerri ● Michael S. Hildebrand ● Richard Webster ● Alan Ma ● Bernard Mazoyer ● 1,10 4,5 6,11 6,12 13 Clyde Francks ● Melanie Bahlo ● Ingrid E. Scheffer ● Angela T. Morgan ● Lawrence D. Shriberg ● Simon E. Fisher 1,10 Received: 22 September 2017 / Revised: 3 December 2017 / Accepted: 2 January 2018 © The Author(s) 2018. This article is published with open access Abstract Genetic investigations of people with impaired development of spoken language provide windows into key aspects of human biology. Over 15 years after FOXP2 was identified, most speech and language impairments remain unexplained at the molecular level. We sequenced whole genomes of nineteen unrelated individuals diagnosed with childhood apraxia of speech, a rare disorder enriched for causative mutations of large effect. Where DNA was available from unaffected parents, CHD3 SETD1A WDR5 fi 1234567890();,: we discovered de novo mutations, implicating genes, including , and . In other probands, we identi ed novel loss-of-function variants affecting KAT6A, SETBP1, ZFHX4, TNRC6B and MKL2, regulatory genes with links to neurodevelopment. Several of the new candidates interact with each other or with known speech-related genes. Moreover, they show significant clustering within a single co-expression module of genes highly expressed during early human brain development. This study highlights gene regulatory pathways in the developing brain that may contribute to acquisition of proficient speech.
  • Substrate Stiffness-Dependent Regulation of the SRF−Mkl1 Co-Activator Complex Requires the Inner Nuclear Membrane Protein Emerin Margaret K

    Substrate Stiffness-Dependent Regulation of the SRF−Mkl1 Co-Activator Complex Requires the Inner Nuclear Membrane Protein Emerin Margaret K

    © 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 2111-2118 doi:10.1242/jcs.197517 SHORT REPORT Substrate stiffness-dependent regulation of the SRF−Mkl1 co-activator complex requires the inner nuclear membrane protein Emerin Margaret K. Willer and Christopher W. Carroll* ABSTRACT transcription is thought to underlie persistent myofibroblast The complex comprising serum response factor (SRF) and activation (Zhou et al., 2013). Thus, determining how mechanical − megakaryoblastic leukemia 1 protein (Mkl1) promotes myofibroblast cues modulate SRF Mkl1-dependent gene expression is critical to differentiation during wound healing. SRF−Mkl1 is sensitive to the understand wound healing and pathologies caused by altered ECM mechanical properties of the extracellular environment; but how cells mechanics. sense and transduce mechanical cues to modulate SRF−Mkl1- The nuclear lamina is a network of nuclear envelope-associated dependent gene expression is not well understood. Here, we intermediate filaments and their associated proteins. Recently, the demonstrate that the nuclear lamina-associated inner nuclear nuclear lamina proteins Lamins A/C and Emerin were shown to − membrane protein Emerin stimulates SRF−Mkl1-dependent gene promote SRF Mkl1-dependent transcription (Ho et al., 2014). activity in a substrate stiffness-dependent manner. Specifically, Actin-generated forces regulate Lamins A/C and Emerin (Buxboim Emerin was required for Mkl1 nuclear accumulation and maximal et al., 2014; Guilluy et al., 2014; Swift et al., 2013), but whether the − SRF−Mkl1-dependent gene expression in response to serum nuclear lamina contributes to the mechanical control of SRF Mkl1- stimulation of cells grown on stiff substrates but was dispensable on dependent gene expression has not been tested.
  • UC San Diego UC San Diego Electronic Theses and Dissertations

    UC San Diego UC San Diego Electronic Theses and Dissertations

    UC San Diego UC San Diego Electronic Theses and Dissertations Title Regulation of gene expression programs by serum response factor and megakaryoblastic leukemia 1/2 in macrophages Permalink https://escholarship.org/uc/item/8cc7d0t0 Author Sullivan, Amy Lynn Publication Date 2009 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Regulation of Gene Expression Programs by Serum Response Factor and Megakaryoblastic Leukemia 1/2 in Macrophages A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Amy Lynn Sullivan Committee in charge: Professor Christopher K. Glass, Chair Professor Stephen M. Hedrick Professor Marc R. Montminy Professor Nicholas J. Webster Professor Joseph L. Witztum 2009 Copyright Amy Lynn Sullivan, 2009 All rights reserved. The Dissertation of Amy Lynn Sullivan is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Chair University of California, San Diego 2009 iii DEDICATION To my husband, Shane, for putting up with me through all of the long hours, last minute late nights, and for not letting me quit no matter how many times my projects fell apart. To my son, Tyler, for always making me smile and for making every day an adventure. To my gifted colleagues, for all of the thought-provoking discussions, technical help and moral support through the roller- coaster ride that has been my graduate career. To my family and friends, for all of your love and support. I couldn’t have done it without you! iv EPIGRAPH If at first you don’t succeed, try, try, again.
  • Inter-Chromosomal Variation in the Pattern of Human Population Genetic Structure Tesfaye M

    Inter-Chromosomal Variation in the Pattern of Human Population Genetic Structure Tesfaye M

    PRIMARY RESEARCH Inter-chromosomal variation in the pattern of human population genetic structure Tesfaye M. Baye* Cincinnati Children’s Hospital Medical Center, Division of Asthma Research, Department of Pediatrics, University of Cincinnati, 3333 Burnet Avenue, Cincinnati, OH 45229, USA *Correspondence to: Tel: þ1 513 803 2766; Fax: þ1 513 636 1657; E-mail: [email protected] Date received (in revised form): 1st March 2011 Abstract Emerging technologies now make it possible to genotype hundreds of thousands of genetic variations in individuals, across the genome. The study of loci at finer scales will facilitate the understanding of genetic variation at genomic and geographic levels. We examined global and chromosomal variations across HapMap populations using 3.7 million single nucleotide polymorphisms to search for the most stratified genomic regions of human populations and linked these regions to ontological annotation and functional network analysis. To achieve this, we used five complementary statistical and genetic network procedures: principal component (PC), cluster, discriminant, fix- ation index (FST) and network/pathway analyses. At the global level, the first two PC scores were sufficient to account for major population structure; however, chromosomal level analysis detected subtle forms of population structure within continental populations, and as many as 31 PCs were required to classify individuals into homo- geneous groups. Using recommended population ancestry differentiation measures, a total of 126 regions of the genome were catalogued. Gene ontology and networks analyses revealed that these regions included the genes encoding oculocutaneous albinism II (OCA2), hect domain and RLD 2 (HERC2), ectodysplasin A receptor (EDAR) and solute carrier family 45, member 2 (SLC45A2).
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024

    Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024

    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
  • Download 20190410); Fragmentation for 20 S

    Download 20190410); Fragmentation for 20 S

    ARTICLE https://doi.org/10.1038/s41467-020-17387-y OPEN Multi-layered proteomic analyses decode compositional and functional effects of cancer mutations on kinase complexes ✉ Martin Mehnert 1 , Rodolfo Ciuffa1, Fabian Frommelt 1, Federico Uliana1, Audrey van Drogen1, ✉ ✉ Kilian Ruminski1,3, Matthias Gstaiger1 & Ruedi Aebersold 1,2 fi 1234567890():,; Rapidly increasing availability of genomic data and ensuing identi cation of disease asso- ciated mutations allows for an unbiased insight into genetic drivers of disease development. However, determination of molecular mechanisms by which individual genomic changes affect biochemical processes remains a major challenge. Here, we develop a multilayered proteomic workflow to explore how genetic lesions modulate the proteome and are trans- lated into molecular phenotypes. Using this workflow we determine how expression of a panel of disease-associated mutations in the Dyrk2 protein kinase alter the composition, topology and activity of this kinase complex as well as the phosphoproteomic state of the cell. The data show that altered protein-protein interactions caused by the mutations are asso- ciated with topological changes and affected phosphorylation of known cancer driver pro- teins, thus linking Dyrk2 mutations with cancer-related biochemical processes. Overall, we discover multiple mutation-specific functionally relevant changes, thus highlighting the extensive plasticity of molecular responses to genetic lesions. 1 Department of Biology, Institute of Molecular Systems Biology, ETH Zurich,
  • Supplementary Tables S1-S3

    Supplementary Tables S1-S3

    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)