The Myocardin Family of Transcriptional Coactivators: Versatile Regulators of Cell Growth, Migration, and Myogenesis

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW The myocardin family of transcriptional coactivators: versatile regulators of cell growth, migration, and myogenesis G.C. Teg Pipes, Esther E. Creemers, and Eric N. Olson1 Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA The association of transcriptional coactivators with se- gene regulation and expands the regulatory potential of quence-specific DNA-binding proteins provides versatil- individual cis-regulatory elements. ity and specificity to gene regulation and expands the The regulation of serum response factor (SRF) and its regulatory potential of individual cis-regulatory DNA se- target genes provides a classic example of the diversity of quences. Members of the myocardin family of coactiva- genes controlled by a single DNA-binding protein and tors activate genes involved in cell proliferation, migra- the importance of cofactor interactions in the control of tion, and myogenesis by associating with serum re- gene expression (Shore and Sharrocks 1995). Among the sponse factor (SRF). The partnership of myocardin family many target genes of SRF are genes involved in cell pro- members and SRF also controls genes encoding compo- liferation and muscle differentiation, which represent nents of the actin cytoskeleton and confers responsive- opposing programs of gene expression: Muscle genes are ness to extracellular growth signals and intracellular repressed by growth factor signals and generally do not changes in the cytoskeleton, thereby creating a tran- become activated until myoblasts exit the cell cycle. The scriptional–cytoskeletal regulatory circuit. These func- ability of SRF to regulate different sets of downstream tions are reflected in defects in smooth muscle differen- effector genes depends on its association with positive tiation and function in mice with mutations in myocar- and negative cofactors (Treisman 1994; Shore and Shar- din family members. This article reviews the functions rocks 1995). SRF thereby serves as a platform to interpret and mechanisms of action of the myocardin family of cell identity and signaling by engaging various partners. coactivators and the physiological significance of tran- The recent discovery and mechanistic dissection of the scriptional coactivation in the context of signal-depen- myocardin family of transcriptional coactivators (Wang dent and cell-type-specific gene regulation. et al. 2001, 2002), which regulate SRF activity during cell growth, migration, and myogenesis, have provided new insights into the mechanism of action of SRF, as well as The instructions for gene expression are “hard wired” the roles of coactivators in the control of gene expression into DNA sequence in the form of cis-regulatory ele- in general. This article reviews the functions and mecha- ments that bind sequence-specific transcription factors nisms of action of the myocardin family of coactivators and confer specialized patterns of gene expression and considers their activities in the broader context of (Howard and Davidson 2004). However, the binding of signal-dependent and cell-type-specific gene regulation. transcription factors to their cognate sites is often insuf- ficient to account for the patterns of expression of their target genes. Indeed, it is not uncommon for a transcrip- SRF and MADS-box transcription factors tion factor to control genes with distinct or even mutu- ally exclusive expression patterns. Many transcription SRF belongs to the MADS (MCM1, Agamous, Deficiens, factors are also relatively weak transcriptional activators SRF) family of transcription factors, which share homol- and function by recruiting coactivators (or corepressors) ogy in a 57-amino-acid MADS-box that mediates ho- that do not bind DNA directly but regulate transcription modimerization and DNA binding to a dyad symmetri- in a DNA sequence-specific manner by associating with cal A + T-rich DNA consensus sequence (Shore and DNA-bound factors (Spiegelman and Heinrich 2004). Sharrocks 1995). There are numerous MADS-box pro- Thus, the association of DNA-binding proteins with ac- teins in plants, but SRF and the four members of the cessory factors provides specificity and versatility to myocyte enhancer factor-2 (MEF2) family (MEF2A, MEFB, MEFC, and MEFD) are the only MADS-box pro- teins found in metazoans (Black and Olson 1998). The [Keywords: Myocardin; MRTF; coactivator; smooth muscle; SRF] crystal structures of SRF and MEF2 have revealed com- 1Corresponding author. E-MAIL [email protected]; FAX (214) 648-1196. monalities in their modes of DNA binding (Pellegrini et Article is online at http://www.genesdev.org/cgi/doi/10.1101/gad.1428006. al. 1995; Santelli and Richmond 2000), which are re- GENES & DEVELOPMENT 20:1545–1556 © 2006 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/06; www.genesdev.org 1545 Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Pipes et al. flected in the similar sequences of their binding sites: consensus CArG-box from the c-fos promoter results in CC(A/T)6GG (known as a CArG-box) for SRF and widespread (i.e., non-muscle-specific) expression (Haut- CTA(A/T)4TAG for MEF2. mann et al. 1998; Chang et al. 2001). Thus, it appears The conserved N-terminal region of the MADS-box that cell growth genes are “constitutive” SRF targets, forms an ␣-helical structure, which becomes oriented in their expression driven by a perfect consensus CArG-box an antiparallel manner within homodimers to form a that binds SRF with high affinity, while some myogenic bipartite DNA-binding domain. An N-terminal exten- SRF targets have only nonconsensus CArG-boxes that sion of the MADS-box in SRF makes critical base con- require coactivation, enhancement, or reinforcement of tacts in the minor groove that stabilize DNA binding. A SRF binding to activate their expression in muscle cells. domain C-terminal to the DNA-binding region is ori- ented away from DNA and is important for homodimer- ization and interaction with accessory factors. SRF, like SRF loss-of-function phenotypes other MADS-box transcription factors, interacts with a Experiments in cultured cells using dominant-negative diverse array of transcriptional regulators to generate tis- SRF mutants or siRNA to down-regulate SRF expression sue-specific and signal-responsive patterns of gene ex- have revealed essential roles for SRF in serum-dependent pression (Messenguy and Dubois 2003). The SRF MADS- cell growth and skeletal muscle differentiation (Soulez et box induces an unusual degree of bending of the double al. 1996; Wei et al. 1998; Kaplan-Albuquerque et al. helix, likely creating a unique shape that facilitates as- 2005). A dominant-negative SRF mutant also blocks dif- sociation with other components of the transcriptional ferentiation of coronary smooth muscle cells (SMCs) in regulatory complex (West and Sharrocks 1997). the proepicardial organ of chick embryos (Landerholm et Approximately 160 genes have been estimated to be al. 1999) and disrupts skeletal and cardiac muscle differ- direct transcriptional targets of SRF, and about half of entiation in transgenic mice (Zhang et al. 2001). these have been experimentally validated (Sun et al. A homozygous Srf-null mutation in mice results in 2006a). The majority of SRF target genes are involved in lethality at gastrulation (Arsenian et al. 1998). SRF regu- cell growth, migration, cytoskeletal organization, and lates genes involved in cell migration and adhesion, pro- myogenesis. The prototypical SRF target gene involved cesses required for gastrulation. ES cells lacking SRF also in cell growth, c-fos, is controlled by a single CArG-box, display defects in spreading, adhesion, and migration referred to as a serum response element (SRE), that acts that correlate with abnormalities in actin stress fibers in concert with surrounding cis-regulatory elements in and loss of expression of genes encoding stress fiber com- the promoter (Norman et al. 1988). The first descriptions ponents including vinculin, talin, and a subset of actin of SRF-dependent enhancers of muscle gene expression isoforms, which are directly regulated by SRF (Schratt et described duplicated CArG-boxes that functioned coop- al. 2002). SRF has also been shown to regulate cell sur- eratively to activate transcription (Miwa and Kedes vival during development via its control of the anti-ap- 1987; Chow and Schwartz 1990). These initial observa- optotic Bcl-2 gene (Schratt et al. 2004). tions led to the working hypothesis that SRF-dependent The early lethality of Srf-null mice precludes an analy- genes involved in cell growth are controlled by single sis of the potential roles of SRF in muscle development. CArG-boxes, while SRF-dependent muscle genes are However, conditional deletion of Srf from the cardiac controlled by duplicated CArG-boxes. However, recent muscle lineage results in mid-gestation lethality, accom- genome-wide curation of all SRF target genes and the panied by disruption of sarcomeric structure and abnor- CArG-boxes that control their expression reveals dupli- malities in muscle gene regulation (Miano et al. 2004; cated CArG-boxes near the start of transcription of most Parlakian et al. 2004; Niu et al. 2005). Smooth muscle SRF target genes (see Supplemental Material in Sun et al. deletion of Srf also results in a reduced number of differ- 2006a). Some CArG-box-dependent muscle genes are
Recommended publications
  • Inhibitor of Differentiation 4 (ID4) Represses Myoepithelial Differentiation Of

    Inhibitor of Differentiation 4 (ID4) Represses Myoepithelial Differentiation Of

    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.06.026963; this version posted April 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Inhibitor of Differentiation 4 (ID4) represses myoepithelial differentiation of 2 mammary stem cells through its interaction with HEB 3 Holly Holliday1,2, Daniel Roden1,2, Simon Junankar1,2, Sunny Z. Wu1,2, Laura A. 4 Baker1,2, Christoph Krisp3,4, Chia-Ling Chan1, Andrea McFarland1, Joanna N. Skhinas1, 5 Thomas R. Cox1,2, Bhupinder Pal5, Nicholas Huntington6, Christopher J. Ormandy1,2, 6 Jason S. Carroll7, Jane Visvader5, Mark P. Molloy3, Alexander Swarbrick1,2 7 1. The Kinghorn Cancer Centre, Garvan Institute of Medical Research, Sydney, 8 NSW 2010, Australia 9 2. St Vincent's Clinical School, Faculty of Medicine, UNSW Sydney, Sydney, NSW 10 2010, Australia 11 3. Australian Proteome Analysis Facility, Macquarie University, Sydney, NSW 12 2109, Australia 13 4. Institute of Clinical Chemistry and Laboratory Medicine, Mass Spectrometric 14 Proteomics, University Medical Center Hamburg-Eppendorf, Hamburg 20251, 15 Germany 16 5. ACRF Stem Cells and Cancer Division, The Walter and Eliza Hall Institute of 17 Medical Research, Parkville, Victoria 3052, Australia 18 6. Biomedicine Discovery Institute, Department of Biochemistry and Molecular 19 Biology, Monash University, Clayton, VIC 3168, Australia 20 7. Cancer Research UK Cambridge Institute, University of Cambridge, Robinson 21 Way, Cambridge CB2 0RE, UK 22 bioRxiv preprint doi: https://doi.org/10.1101/2020.04.06.026963; this version posted April 6, 2020.
  • Expression of Oncogenes ELK1 and ELK3 in Cancer

    Expression of Oncogenes ELK1 and ELK3 in Cancer

    Review Article Annals of Colorectal Cancer Research Published: 11 Nov, 2019 Expression of Oncogenes ELK1 and ELK3 in Cancer Akhlaq Ahmad and Asif Hayat* College of Chemistry, Fuzhou University, China Abstract Cancer is the uncontrolled growth of abnormal cells anywhere in a body, ELK1 and ELK3 is a member of the Ets-domain transcription factor family and the TCF (Ternary Complex Factor) subfamily. Proteins in this subfamily regulate transcription when recruited by SRF (Serum Response Factor) to bind to serum response elements. ELK1 and ELK3 transcription factors are known as oncogenes. Both transcription factors are proliferated in a different of type of cancer. Herein, we summarized the expression of transcription factor ELK1 and ELK3 in cancer cells. Keywords: ETS; ELK1; ELK3; Transcription factor; Cancer Introduction The ETS, a transcription factor of E twenty-six family based on a dominant ETS amino acids that integrated with a ~10-basepair element arrange in highly mid core sequence 5′-GGA(A/T)-3′ [1-2]. The secular family alter enormous 28/29 members which has been assigned in human and mouse and similarly the family description are further sub-divided into nine sub-families according to their homology and domain factor [3]. More importantly, one of the subfamily members such as ELK (ETS-like) adequate an N-terminal ETS DNA-binding domain along with a B-box domain that transmit the response of serum factor upon the formation of ternary complex and therefore manifested as ternary complex factors [4]. Further the ELK sub-divided into Elk1, Elk3 (Net, Erp or Sap2) and Elk4 (Sap1) proteins [3,4], which simulated varied proportional of potential protein- protein interactions [4,5].
  • Interaction and Functional Cooperation of the Cancer-Amplified Transcriptional Coactivator Activating Signal Cointegrator-2 and E2F-1 in Cell Proliferation

    Interaction and Functional Cooperation of the Cancer-Amplified Transcriptional Coactivator Activating Signal Cointegrator-2 and E2F-1 in Cell Proliferation

    948 Vol. 1, 948–958, November 2003 Molecular Cancer Research Interaction and Functional Cooperation of the Cancer-Amplified Transcriptional Coactivator Activating Signal Cointegrator-2 and E2F-1 in Cell Proliferation Hee Jeong Kong,1 Hyun Jung Yu,2 SunHwa Hong,2 Min Jung Park,2 Young Hyun Choi,3 Won Gun An,4 Jae Woon Lee,5 and JaeHun Cheong2 1Laboratory of Molecular Growth Regulation, National Institute of Health, Bethesda, MD; 2Department of Molecular Biology, Pusan National University, Busan, Republic of Korea; 3Department of Biochemistry, College of Oriental Medicine, Dong-Eui University, Busan, Republic of Korea; 4Department of Biology, Kyungpook National University, DaeGu, Republic of Korea; and 5Department of Medicine/Endocrinology, Baylor College of Medicine Houston, TX. Abstract structure and recruitment of a transcription initiation complex Activating signal cointegrator-2 (ASC-2), a novel coac- containing RNA polymerase II to the promoter (1). Recent tivator, is amplified in several cancer cells and known to studies have shown that DNA-bound transcriptional activator interact with mitogenic transcription factors, including proteins accomplish these two tasks with the assistance of a serum response factor, activating protein-1, and nuclear class of proteins called transcriptional coactivators (2, 3). They factor-KB, suggesting the physiological role of ASC-2 in may be thought of as adaptors or components in a signaling the promotion of cell proliferation. Here, we show that pathway that transmits transcriptional activation signals from the expression pattern of ASC-2 was correlated with that DNA-bound activator proteins to the chromatin and transcrip- of E2F-1 for protein increases at G1 and S phase.
  • MKL1 (C) Antibody, Rabbit Polyclonal

    MKL1 (C) Antibody, Rabbit Polyclonal

    Order: (888)-282-5810 (Phone) (818)-707-0392 (Fax) [email protected] Web: www.Abiocode.com MKL1 (C) Antibody, Rabbit Polyclonal Cat#: R2403-2 Lot#: Refer to vial Quantity: 100 ul Application: WB Predicted I Observed M.W.: 99 I 140 kDa Uniprot ID: Q969V6 Background: MKL/myocardin-like protein 1 (MKL1) is a transcriptional coactivator of serum response factor (SRF) with the potential to modulate SRF target genes. MKL1 suppresses TNF-induced cell death by inhibiting activation of caspases; its transcriptional activity is indispensable for the antiapoptotic function. MKL1 may up-regulate antiapoptotic molecules, which in turn inhibit caspase activation. Other Names: MKL/myocardin-like protein 1, Megakaryoblastic leukemia 1 protein, Megakaryocytic acute leukemia protein, Myocardin-related transcription factor A, MRTF-A, KIAA1438, MAL Source and Purity: Rabbit polyclonal antibodies were produced by immunizing animals with a GST-fusion protein containing the C-terminal region of human MKL1. Antibodies were purified by affinity purification using immunogen. Storage Buffer and Condition: Supplied in 1 x PBS (pH 7.4), 100 ug/ml BSA, 40% Glycerol, 0.01% NaN3. Store at -20 °C. Stable for 6 months from date of receipt. Species Specificity: Human Tested Applications: WB: 1:1,000-1:3,000 (detect endogenous protein*) *: The apparent protein size on WB may be different from the calculated M.W. due to modifications. For research use only. Not for therapeutic or diagnostic purposes. Abiocode, Inc., 29397 Agoura Rd., Ste 106, Agoura Hills, CA 91301 Order: (888)-282-5810 (Phone) (818)-707-0392 (Fax) [email protected] Web: www.Abiocode.com Product Data: kDa A B 250 150 100 75 50 37 Fig 1.
  • Dermo-1: a Novel Twist-Related Bhlh Protein Expressed in The

    Dermo-1: a Novel Twist-Related Bhlh Protein Expressed in The

    DEVELOPMENTAL BIOLOGY 172, 280±292 (1995) Dermo-1: A Novel Twist-Related bHLH Protein View metadata,Expressed citation and similar in papers the at core.ac.uk Developing Dermis brought to you by CORE provided by Elsevier - Publisher Connector Li Li, Peter Cserjesi,1 and Eric N. Olson2 Department of Biochemistry and Molecular Biology, Box 117, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 Transcription factors belonging to the basic helix±loop±helix (bHLH) family have been shown to control differentiation of a variety of cell types. Tissue-speci®c bHLH proteins dimerize preferentially with ubiquitous bHLH proteins to form heterodimers that bind the E-box consensus sequence (CANNTG) in the control regions of target genes. Using the yeast two-hybrid system to screen for tissue-speci®c bHLH proteins, which dimerize with the ubiquitous bHLH protein E12, we cloned a novel bHLH protein, named Dermo-1. Within its bHLH region, Dermo-1 shares extensive homology with members of the twist family of bHLH proteins, which are expressed in embryonic mesoderm. During mouse embryogenesis, Dermo- 1 showed an expression pattern similar to, but distinct from, that of mouse twist. Dermo-1 was expressed at a low level in the sclerotome and dermatome of the somites, and in the limb buds at Day 10.5 post coitum (p.c.), and accumulated predominantly in the dermatome, prevertebrae, and the derivatives of the branchial arches by Day 13.5 p.c. As differentiation of prechondrial cells proceeded, Dermo-1 expression became restricted to the perichondrium. Expression of Dermo-1 increased continuously in the dermis through Day 17.5 p.c.
  • The Title of the Dissertation

    The Title of the Dissertation

    UNIVERSITY OF CALIFORNIA SAN DIEGO Novel network-based integrated analyses of multi-omics data reveal new insights into CD8+ T cell differentiation and mouse embryogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Kai Zhang Committee in charge: Professor Wei Wang, Chair Professor Pavel Arkadjevich Pevzner, Co-Chair Professor Vineet Bafna Professor Cornelis Murre Professor Bing Ren 2018 Copyright Kai Zhang, 2018 All rights reserved. The dissertation of Kai Zhang is approved, and it is accept- able in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California San Diego 2018 iii EPIGRAPH The only true wisdom is in knowing you know nothing. —Socrates iv TABLE OF CONTENTS Signature Page ....................................... iii Epigraph ........................................... iv Table of Contents ...................................... v List of Figures ........................................ viii List of Tables ........................................ ix Acknowledgements ..................................... x Vita ............................................. xi Abstract of the Dissertation ................................. xii Chapter 1 General introduction ............................ 1 1.1 The applications of graph theory in bioinformatics ......... 1 1.2 Leveraging graphs to conduct integrated analyses .......... 4 1.3 References .............................. 6 Chapter 2 Systematic
  • Ubiquitin-Mediated Control of ETS Transcription Factors: Roles in Cancer and Development

    Ubiquitin-Mediated Control of ETS Transcription Factors: Roles in Cancer and Development

    International Journal of Molecular Sciences Review Ubiquitin-Mediated Control of ETS Transcription Factors: Roles in Cancer and Development Charles Ducker * and Peter E. Shaw * Queen’s Medical Centre, School of Life Sciences, University of Nottingham, Nottingham NG7 2UH, UK * Correspondence: [email protected] (C.D.); [email protected] (P.E.S.) Abstract: Genome expansion, whole genome and gene duplication events during metazoan evolution produced an extensive family of ETS genes whose members express transcription factors with a conserved winged helix-turn-helix DNA-binding domain. Unravelling their biological roles has proved challenging with functional redundancy manifest in overlapping expression patterns, a common consensus DNA-binding motif and responsiveness to mitogen-activated protein kinase signalling. Key determinants of the cellular repertoire of ETS proteins are their stability and turnover, controlled largely by the actions of selective E3 ubiquitin ligases and deubiquitinases. Here we discuss the known relationships between ETS proteins and enzymes that determine their ubiquitin status, their integration with other developmental signal transduction pathways and how suppression of ETS protein ubiquitination contributes to the malignant cell phenotype in multiple cancers. Keywords: E3 ligase complex; deubiquitinase; gene fusions; mitogens; phosphorylation; DNA damage 1. Introduction Citation: Ducker, C.; Shaw, P.E. Cell growth, proliferation and differentiation are complex, concerted processes that Ubiquitin-Mediated Control of ETS Transcription Factors: Roles in Cancer rely on careful regulation of gene expression. Control over gene expression is maintained and Development. Int. J. Mol. Sci. through signalling pathways that respond to external cellular stimuli, such as growth 2021, 22, 5119. https://doi.org/ factors, cytokines and chemokines, that invoke expression profiles commensurate with 10.3390/ijms22105119 diverse cellular outcomes.
  • Wide-Scale Analysis of Human Functional Transcription Factor

    Wide-Scale Analysis of Human Functional Transcription Factor

    Wide-Scale Analysis of Human Functional Transcription Factor Binding Reveals a Strong Bias towards the Transcription Start Site Yuval Tabach1,2, Ran Brosh2, Yossi Buganim2, Anat Reiner1, Or Zuk1, Assif Yitzhaky1, Mark Koudritsky1, Varda Rotter2 and Eytan Domany1,* 1Departments of Physics of Complex Systems and 2Molecular Cell Biology, The Weizmann Institute of Science, Rehovot 76100, Israel *Corresponding author. Email: [email protected] Tel: +972-8-9343964 Fax: +972-8- 9344109 Running title: Binding Sites Location Bias Keywords: Transcription factor binding sites, location bias, cell cycle, NF-kB, promoter, Gene Ontology, TATA, myocardin 1 Summary Background: Elucidating basic principles that underlie regulation of gene expression by transcription factors (TFs) is a central challenge of the post-genomic era. Transcription factors regulate expression by binding to specific DNA sequences; such a binding event is functional when it affects gene expression. Functionality of a binding site is reflected in conservation of the binding sequence during evolution and in over represented binding in gene groups with coherent biological functions. Functionality is governed by several parameters such as the TF- DNA binding strength, distance of the binding site from the transcription start site (TSS), DNA packing, and more. Understanding how these parameters control functionality of different TFs in different biological contexts is an essential step towards identifying functional TF binding sites, a must for understanding regulation of transcription. Methodology/Principal Findings: We introduce a novel method to screen the promoters of a set of genes with shared biological function, against a precompiled library of motifs, and find those motifs which are statistically over-represented in the gene set.
  • SETD1B-Associated Neurodevelopmental Disorder

    SETD1B-Associated Neurodevelopmental Disorder

    Genotype- phenotype correlations J Med Genet: first published as 10.1136/jmedgenet-2019-106756 on 16 June 2020. Downloaded from Original research SETD1B- associated neurodevelopmental disorder Alexandra Roston ,1 Dan Evans,2 Harinder Gill,1,3 Margaret McKinnon,1 Bertrand Isidor,4 Benjamin Cogné ,4,5 Jill Mwenifumbo,1,6 Clara van Karnebeek,7,8 Jianghong An,9 Steven J M Jones,9 Matthew Farrer,2 Michelle Demos,10 Mary Connolly,10 William T Gibson ,1 CAUSES Study, EPGEN Study ► Additional material is ABSTRACT same gene allows causal inference for those geno- published online only. To view Background Dysfunction of histone methyltransferases type–phenotype correlations. This is especially true please visit the journal online (http:// dx. doi. org/ 10. 1136/ and chromatin modifiers has been implicated in complex when perturbation of the general biological process jmedgenet- 2019- 106756). neurodevelopmental syndromes and cancers. SETD1B has, in similar contexts, been shown reproducibly encodes a lysine- specific methyltransferase that assists to result in similar phenotypes. For numbered affiliations see in transcriptional activation of genes by depositing Individual case reports have appeared in the end of article. H3K4 methyl marks. Previous reports of patients with literature describing neurodevelopmental delays rare variants in SETD1B describe a distinctive phenotype associated with rare coding variants in SETD1B, Correspondence to Dr Alexandra Roston, that includes seizures, global developmental delay and and with hemizygosity for SETD1B due to CNVs. Department of Medical intellectual disability. Here we show that pathogenic variants within Genetics, The University of Methods Two of the patients described herein were SETD1B contribute to a conserved phenotype that British Columbia, Vancouver, BC identified via genome-wide and exome-wide testing, includes intellectual disability and childhood- onset, V6T 1Z4, Canada; with microarray and research- based exome, through treatment- refractory seizures.
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1

    The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1

    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
  • Co-Occupancy by Multiple Cardiac Transcription Factors Identifies

    Co-Occupancy by Multiple Cardiac Transcription Factors Identifies

    Co-occupancy by multiple cardiac transcription factors identifies transcriptional enhancers active in heart Aibin Hea,b,1, Sek Won Konga,b,c,1, Qing Maa,b, and William T. Pua,b,2 aDepartment of Cardiology and cChildren’s Hospital Informatics Program, Children’s Hospital Boston, Boston, MA 02115; and bHarvard Stem Cell Institute, Harvard University, Cambridge, MA 02138 Edited by Eric N. Olson, University of Texas Southwestern, Dallas, TX, and approved February 23, 2011 (received for review November 12, 2010) Identification of genomic regions that control tissue-specific gene study of a handful of model genes (e.g., refs. 7–10), it has not been expression is currently problematic. ChIP and high-throughput se- evaluated using unbiased, genome-wide approaches. quencing (ChIP-seq) of enhancer-associated proteins such as p300 In this study, we used a modified ChIP-seq approach to define identifies some but not all enhancers active in a tissue. Here we genome wide the binding sites of these cardiac TFs (1). We show that co-occupancy of a chromatin region by multiple tran- provide unbiased support for collaborative TF interactions in scription factors (TFs) identifies a distinct set of enhancers. GATA- driving cardiac gene expression and use this principle to show that chromatin co-occupancy by multiple TFs identifies enhancers binding protein 4 (GATA4), NK2 transcription factor-related, lo- with cardiac activity in vivo. The majority of these multiple TF- cus 5 (NKX2-5), T-box 5 (TBX5), serum response factor (SRF), and “ binding loci (MTL) enhancers were distinct from p300-bound myocyte-enhancer factor 2A (MEF2A), here referred to as cardiac enhancers in location and functional properties.
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line