Biophysical Investigation of the Dual Binding Surfaces of Human Transcription Factors FOXO4 and P53
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
FOX) Proteins in Osteosarcoma Wentao Zhang1*, Ning Duan1*, Tao Song1, Zhong Li1, Caiguo Zhang2, Xun Chen1
Journal of Cancer 2017, Vol. 8 1619 Ivyspring International Publisher Journal of Cancer 2017; 8(9): 1619-1628. doi: 10.7150/jca.18778 Review The Emerging Roles of Forkhead Box (FOX) Proteins in Osteosarcoma Wentao Zhang1*, Ning Duan1*, Tao Song1, Zhong Li1, Caiguo Zhang2, Xun Chen1 1. Department of Orthopaedics, Xi'an Hong-Hui Hospital affiliated to medical college of Xi'an Jiaotong University, Xi'an, Shaanxi, China, 710054; 2. Department of Dermatology, University of Colorado Anschutz Medical Campus, Aurora, CO, USA. * These authors contributed equally to this work. Corresponding authors: [email protected]; [email protected] © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2016.12.15; Accepted: 2017.02.27; Published: 2017.06.03 Abstract Osteosarcoma is the most common bone cancer primarily occurring in children and young adults. Over the past few years, the deregulation of a superfamily transcription factors, known as forkhead box (FOX) proteins, has been demonstrated to contribute to the pathogenesis of osteosarcoma. Molecular mechanism studies have demonstrated that FOX family proteins participate in a variety of signaling pathways and that their expression can be regulated by multiple factors. The dysfunction of FOX genes can alter osteosarcoma cell differentiation, metastasis and progression. In this review, we summarized the evidence that FOX genes play direct or indirect roles in the development and progression of osteosarcoma, and evaluated the emerging role of FOX proteins as targets for therapeutic intervention. -
The Genetic Network of Forkhead Gene Family in Development of Brown Planthoppers
biology Article The Genetic Network of Forkhead Gene Family in Development of Brown Planthoppers Hai-Yan Lin 1,2, Cheng-Qi Zhu 1,2, Hou-Hong Zhang 2, Zhi-Cheng Shen 2, Chuan-Xi Zhang 2,3 and Yu-Xuan Ye 1,2,* 1 The Rural Development Academy, Zhejiang University, Hangzhou 310058, China; [email protected] (H.-Y.L.); [email protected] (C.-Q.Z.) 2 Institute of Insect Sciences, Zhejiang University, Hangzhou 310058, China; [email protected] (H.-H.Z.); [email protected] (Z.-C.S.); [email protected] (C.-X.Z.) 3 State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Institute of Plant Virology, Ningbo University, Ningbo 315211, China * Correspondence: [email protected] Simple Summary: Forkhead (Fox) genes encode a family of transcription factors defined by a ‘winged helix’ DNA-binding domain and play important roles in regulating the expression of genes involved in cell growth, proliferation, differentiation and longevity. However, we still lack a comprehensive understanding of the Fox gene family in animals. Here, we take an integrated study, which combines genomics, transcriptomics and phenomics, to construct the Fox gene genetic network in the brown planthopper, Nilaparvata lugens, a major rice pest. We show that FoxG, FoxQ, FoxA, FoxN1, FoxN2 and their potential target genes are indispensable for embryogenesis; FoxC, FoxJ1 and FoxP have complementary effects on late embryogenesis; FoxA, FoxNl and FoxQ are pleiotropism and also essential for nymph molting; FoxT belongs to a novel insect-specific Fox subfamily; and FoxL2 and FoxO are involved in the development of eggshells and wings, respectively. -
The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells. -
Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C
Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation -
Anti-Carcinogenic Glucosinolates in Cruciferous Vegetables and Their Antagonistic Effects on Prevention of Cancers
molecules Review Anti-Carcinogenic Glucosinolates in Cruciferous Vegetables and Their Antagonistic Effects on Prevention of Cancers Prabhakaran Soundararajan and Jung Sun Kim * Genomics Division, Department of Agricultural Bio-Resources, National Institute of Agricultural Sciences, Rural Development Administration, Wansan-gu, Jeonju 54874, Korea; [email protected] * Correspondence: [email protected] Academic Editor: Gautam Sethi Received: 15 October 2018; Accepted: 13 November 2018; Published: 15 November 2018 Abstract: Glucosinolates (GSL) are naturally occurring β-D-thioglucosides found across the cruciferous vegetables. Core structure formation and side-chain modifications lead to the synthesis of more than 200 types of GSLs in Brassicaceae. Isothiocyanates (ITCs) are chemoprotectives produced as the hydrolyzed product of GSLs by enzyme myrosinase. Benzyl isothiocyanate (BITC), phenethyl isothiocyanate (PEITC) and sulforaphane ([1-isothioyanato-4-(methyl-sulfinyl) butane], SFN) are potential ITCs with efficient therapeutic properties. Beneficial role of BITC, PEITC and SFN was widely studied against various cancers such as breast, brain, blood, bone, colon, gastric, liver, lung, oral, pancreatic, prostate and so forth. Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor limits the tumor progression. Induction of ARE (antioxidant responsive element) and ROS (reactive oxygen species) mediated pathway by Nrf2 controls the activity of nuclear factor-kappaB (NF-κB). NF-κB has a double edged role in the immune system. NF-κB induced during inflammatory is essential for an acute immune process. Meanwhile, hyper activation of NF-κB transcription factors was witnessed in the tumor cells. Antagonistic activity of BITC, PEITC and SFN against cancer was related with the direct/indirect interaction with Nrf2 and NF-κB protein. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
The Forkhead-Box Family of Transcription Factors: Key Molecular Players in Colorectal Cancer Pathogenesis Paul Laissue
Laissue Molecular Cancer (2019) 18:5 https://doi.org/10.1186/s12943-019-0938-x REVIEW Open Access The forkhead-box family of transcription factors: key molecular players in colorectal cancer pathogenesis Paul Laissue Abstract Colorectal cancer (CRC) is the third most commonly occurring cancer worldwide and the fourth most frequent cause of death having an oncological origin. It has been found that transcription factors (TF) dysregulation, leading to the significant expression modifications of genes, is a widely distributed phenomenon regarding human malignant neoplasias. These changes are key determinants regarding tumour’s behaviour as they contribute to cell differentiation/proliferation, migration and metastasis, as well as resistance to chemotherapeutic agents. The forkhead box (FOX) transcription factor family consists of an evolutionarily conserved group of transcriptional regulators engaged in numerous functions during development and adult life. Their dysfunction has been associated with human diseases. Several FOX gene subgroup transcriptional disturbances, affecting numerous complex molecular cascades, have been linked to a wide range of cancer types highlighting their potential usefulness as molecular biomarkers. At least 14 FOX subgroups have been related to CRC pathogenesis, thereby underlining their role for diagnosis, prognosis and treatment purposes. This manuscript aims to provide, for the first time, a comprehensive review of FOX genes’ roles during CRC pathogenesis. The molecular and functional characteristics of most relevant FOX molecules (FOXO, FOXM1, FOXP3) have been described within the context of CRC biology, including their usefulness regarding diagnosis and prognosis. Potential CRC therapeutics (including genome-editing approaches) involving FOX regulation have also been included. Taken together, the information provided here should enable a better understanding of FOX genes’ function in CRC pathogenesis for basic science researchers and clinicians. -
Forkhead Transcription Factors and Ageing
Oncogene (2008) 27, 2351–2363 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW Forkhead transcription factors and ageing L Partridge1 and JC Bru¨ ning2 1Institute of Healthy Ageing, GEE, London, UK; 2Department of Mouse Genetics and Metabolism, Institute for Genetics University of Cologne, Cologne, Germany Mutations in single genes and environmental interventions Forkhead transcription factors are turning out to play can extend healthy lifespan in laboratory model organi- a key role in invertebrate models ofextension ofhealthy sms. Some of the mechanisms involved show evolutionary lifespan by single-gene mutations, and evidence is conservation, opening the way to using simpler inverte- mounting for their importance in mammals. Forkheads brates to understand human ageing. Forkhead transcrip- can also play a role in extension oflifespanby dietary tion factors have been found to play a key role in lifespan restriction, an environmental intervention that also extension by alterations in the insulin/IGF pathway and extends lifespan in diverse organisms (Kennedy et al., by dietary restriction. Interventions that extend lifespan 2007). Here, we discuss these findings and their have also been found to delay or ameliorate the impact of implications. The forkhead family of transcription ageing-related pathology and disease, including cancer. factors is characterized by a type of DNA-binding Understanding the mode of action of forkheads in this domain known as the forkhead box (FOX) (Weigel and context will illuminate the mechanisms by which ageing Jackle, 1990). They are also called winged helix acts as a risk factor for ageing-related disease, and could transcription factors because of the crystal structure lead to the development of a broad-spectrum, preventative ofthe FOX, ofwhich the forkheadscontain a medicine for the diseases of ageing. -
Gene Regulation Strategies Underlying Skeletal Muscle Atrophy in Cancer Cachexia
Campus de Botucatu Gene Regulation Strategies Underlying Skeletal Muscle Atrophy in Cancer Cachexia Geysson Javier Fernandez Garcia BOTUCATU – SP 2018 UNIVERSIDADE ESTADUAL PAULISTA “Júlio de Mesquita Filho” INSTITUTO DE BIOCIÊNCIAS DE BOTUCATU Gene Regulation Strategies Underlying Skeletal Muscle Atrophy in Cancer Cachexia M.Sc. GEYSSON JAVIER FERNANDEZ GARCIA Thesis advisor: Prof. Dr. ROBSON F. CARVALHO Thesis presented to the Institute of Biosciences of Botucatu, Sao Paulo State University "Júlio de Mesquita Filho" - UNESP, as a requirement to obtain the PhD Degree in Biological Sciences - Field: Genetics. BOTUCATU – SP 2018 I dedicate this dissertation to the loves of my life: My parents, my brothers and my wife Luz Ochoa, For all the love, affection and encouragement. “Satisfaction of one’s curiosity is one of the greatest sources of happiness in life” Linus Pauling. i Acknowledgements Over the last few years, the journey I have been embarked on was possible thanks to a wonderful crew that provided me of guidance and support not only from an academic point of view but also from a more family-oriented perspective. Therefore, I am using this opportunity to express my deepest appreciation to all those who encouraged me and provided me the possibility to complete this thesis. First of all, I am deeply thankful to Brazil because it has welcomed me as another of its citizens and has given me the opportunity to grow, specially to the Foundation for Research Support of the State of São Paulo (FAPESP) for the financial assistance granted (Grants: 2014/13941-0 and 2016/08294-1). To my advisers, the professors Dr. -
Early B Cell Factor 1 Regulates B Cell Gene Networks by Activation, Repression, and Transcription- Independent Poising of Chromatin
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Immunity Resource Early B Cell Factor 1 Regulates B Cell Gene Networks by Activation, Repression, and Transcription- Independent Poising of Chromatin Thomas Treiber,1,3 Elizabeth M. Mandel,1,3 Sebastian Pott,2,3 Ildiko Gyo¨ ry,1,3 Sonja Firner,1 Edison T. Liu,2 and Rudolf Grosschedl1,* 1Max Planck Institute of Immunobiology, Department of Cellular and Molecular Immunology, Stuebeweg 51, 79108 Freiburg, Germany 2Genome Institute of Singapore, Cancer Biology and Pharmacology, 60 Biopolis Street, 138672 Singapore 3These authors contributed equally to this work *Correspondence: [email protected] DOI 10.1016/j.immuni.2010.04.013 SUMMARY (reviewed in Hardy et al., 2007; Murre, 2009). Pre-B cells express the pre-B cell receptor (pre-BCR) and further differentiate into The transcription factor early B cell factor-1 (Ebf1) is immature B cells that have undergone Ig light chain gene rear- a key determinant of B lineage specification and rangement and migrate from the bone marrow to the spleen. differentiation. To gain insight into the molecular Each of these B cell differentiation steps is dependent on basis of Ebf1 function in early-stage B cells, we the coordinated expression of cell-type-specific transcription combined a genome-wide ChIP sequencing analysis factors and activities of signaling pathways (reviewed in Mandel with gain- and loss-of-function transcriptome anal- and Grosschedl, 2010). Genetic ablation and complementation studies have demonstrated key roles for transcription factors yses. Among 565 genes that are occupied and tran- such as Ikaros, Pu.1, E2A, early B cell factor-1 (Ebf1), and scriptionally regulated by Ebf1, we identified large Pax5 (reviewed in Busslinger, 2004; Hagman and Lukin, 2006; sets involved in (pre)-B cell receptor and Akt Singh et al., 2007). -
Up-Regulation of Foxo4 Mediated by Hepatitis B Virus X Protein Confers Resistance to Oxidative Stress-Induced Cell Death
INTERNATIONAL JOURNAL OF MoleCular MEDICine 28: 255-260, 2011 Up-regulation of Foxo4 mediated by hepatitis B virus X protein confers resistance to oxidative stress-induced cell death Ratakorn SRISUTTEE1, SANG SEOK KOH3, EUN HEE PARK1, IL-RAE CHO1, HYE JIN MIN3, BYUNG HAK JHUN2, DAE-YEUL YU4, SUN PARK5, DO YUN PARK6, MI OCK LEE7, DIEGO H. CASTRILLON8, RANDAL N. Johnston9 and YOUNG-Hwa CHUNG1 1WCU Department of Cogno-Mechatronics Engineering and 2Department of Nanomedical Engineering, BK21 Nanofusion Technology Team, Pusan National University, Busan; 3Therapeutic Antibody Research Center and 4Disease Model Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon; 5Department of Microbiology, Ajou University School of Medicine, Suwon; 6Department of Pathology, College of Medicine, Pusan National University, Yangsan; 7College of Pharmacy, Seoul National University, Seoul, Republic of Korea; 8Department of Pathology and Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX, USA; 9Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta, Canada Received January 27, 2011; Accepted March 17, 2011 DOI: 10.3892/ijmm.2011.699 Abstract. The hepatitis B virus X (HBX) protein, a regula- may be a useful target for suppression in the treatment of tory protein of the hepatitis B virus (HBV), has been shown HBV-associated hepatocellular carcinoma cells. to generate reactive oxygen species (ROS) in human liver cell lines; however, the mechanism by which cells protect them- Introduction selves under this oxidative stress is poorly understood. Here, we show that HBX induces the up-regulation of Forkhead box The human hepatitis B virus (HBV) induces acute and class O 4 (Foxo4) not only in Chang cells stably expressing chronic hepatitis and is closely associated with the incidence HBX (Chang-HBX) but also in primary hepatic tissues of human liver cancer (1,2). -
Most Variable Genes and Transcription Factors in Acute Lymphoblastic Leukemia Patients
Interdisciplinary Sciences: Computational Life Sciences https://doi.org/10.1007/s12539-019-00325-y ORIGINAL RESEARCH ARTICLE Most Variable Genes and Transcription Factors in Acute Lymphoblastic Leukemia Patients Anil Kumar Tomar1 · Rahul Agarwal2 · Bishwajit Kundu1 Received: 24 September 2018 / Revised: 21 January 2019 / Accepted: 26 February 2019 © International Association of Scientists in the Interdisciplinary Areas 2019 Abstract Acute lymphoblastic leukemia (ALL) is a hematologic tumor caused by cell cycle aberrations due to accumulating genetic disturbances in the expression of transcription factors (TFs), signaling oncogenes and tumor suppressors. Though survival rate in childhood ALL patients is increased up to 80% with recent medical advances, treatment of adults and childhood relapse cases still remains challenging. Here, we have performed bioinformatics analysis of 207 ALL patients’ mRNA expression data retrieved from the ICGC data portal with an objective to mark out the decisive genes and pathways responsible for ALL pathogenesis and aggression. For analysis, 3361 most variable genes, including 276 transcription factors (out of 16,807 genes) were sorted based on the coefcient of variance. Silhouette width analysis classifed 207 ALL patients into 6 subtypes and heat map analysis suggests a need of large and multicenter dataset for non-overlapping subtype classifcation. Overall, 265 GO terms and 32 KEGG pathways were enriched. The lists were dominated by cancer-associated entries and highlight crucial genes and pathways that can be targeted for designing more specifc ALL therapeutics. Diferential gene expression analysis identifed upregulation of two important genes, JCHAIN and CRLF2 in dead patients’ cohort suggesting their pos- sible involvement in diferent clinical outcomes in ALL patients undergoing the same treatment.