DOCSLIB.ORG

Linkage and Candidate Gene Studies of Autism Spectrum Disorders in European Populations

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Linkage and Candidate Gene Studies of Autism Spectrum Disorders in European Populations Linkage and Candidate Gene Studies of Autism Spectrum Disorders in European Populations Tony P Monaco, Richard Holt, Gabrielle Barnby, Elena Maestrini, Elena Bacchelli, Denise Brocklebank, Ines Sousa, Erik Mulder, Katri Kantojärvi, Irma Järvelä, et al. To cite this version: Tony P Monaco, Richard Holt, Gabrielle Barnby, Elena Maestrini, Elena Bacchelli, et al.. Linkage and Candidate Gene Studies of Autism Spectrum Disorders in European Populations. European Journal of Human Genetics, Nature Publishing Group, 2010, 10.1038/ejhg.2010.69. hal-00533038 HAL Id: hal-00533038 https://hal.archives-ouvertes.fr/hal-00533038 Submitted on 5 Nov 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. 1 Linkage and Candidate Gene Studies of Autism Spectrum Disorders in European 2 Populations 3 Running title: Linkage and association studies of autism 4 R Holt1, G Barnby1, E Maestrini2, E Bacchelli2, D Brocklebank1, I Sousa1, EJ Mulder3 K 5 Kantojärvi4, I Järvelä4, SM Klauck5, F Poustka6, AJ Bailey7, AP Monaco1 and the EU 6 Autism MOLGEN Consortium* 7 8 1 Wellcome Trust Centre for Human Genetics, Roosevelt Drive, Oxford, OX3 7BN, UK 9 2 Dipartimento di Biologia, Università di Bologna, Via Selmi 3, 40126 Bologna, Italy 10 3 University Medical Center Groningen Department of Psychiatry, Child and Adolescent 11 Psychiatry, Hanzeplein 1, entr.29, PO Box 660 9700 AR Groningen, The Netherlands 12 4 Department of Medical Genetics, University of 13 Helsinki, P.O. Box 63, 00014 University of Helsinki, Finland 14 5 Division of Molecular Genome Analysis, German Cancer Research Center, Im 15 Neuenheimer Feld 580, 69120, Heidelberg, Germany 16 6 Department of Child and Adolescent Psychiatry, Psychosomatics and Psychotherapy, 17 Johann Wolfgang Goethe-University, Deutschordenstr. 50, 60528, Frankfurt/Main, 18 Germany 19 7 University Department of Psychiatry, Park Hospital for Children, Oxford, UK 20 21 The corresponding author is Professor Anthony Monaco and his contact details are: 22 Wellcome Trust Centre for Human Genetics 23 Roosevelt Drive 1 24 Oxford OX3 7BN, UK 25 Email: [email protected] 26 Tel: 0044 (0)1865270004 27 Fax: 0044 (0)1865280411 28 29 *Members of the EU Autism MOLGEN Consortium in alphabetical order are: Reija 30 Alen1, Elena Bacchelli2, Anthony Bailey3, Gillian Baird4, Agatino Battaglia5, Catalina 31 Betancur6, Annelies de Bildt7, Francesca Blasi2, Sven Bölte8, Patrick Bolton9, Thomas 32 Bourgeron10, Karen Brøndum-Nielsen11, Simona Carone2, Pauline Chaste10, Andreas 33 Chiocchetti12, Eftichia Duketis13, Christelle Durand10, Herman van Engeland14, Penny 34 Farrar15, Sabine Feineis-Matthews13, Bärbel Felder12, Kostas Francis3, Jeanne 35 Fremolle16, Carina Gillberg17, Christopher Gillberg17, Hany Goubran-Botros10, 36 Demetrious Haracopos11, Evelyn Herbrecht13, Richard Holt15, Gemma Honeyman3, 37 Jasmin Honold13, Renske Houben14, Aislinn Hutchison3, Roberta Igliozzi5, Torben 38 Isager11, Irma Järvelä1, Maria Johansson17, Maretha de Jonge14, Sabine M. Klauck12, 39 Anne Koivisto1, Hanna Komu1, Marion Leboyer18, Ann Le Couteur19, Justin Lowen3, 40 Elena Maestrini2, Carine Mantoulan16, Jonas Melke10, Helen McConachie19, Ruud 41 Minderaa7, Anthony Monaco15, Erik Mulder7, Taina Nieminen-von Wendt1, Ilona 42 Nummela1, Gudrun Nygren17, Geeta Pakalapati12, Katerina Papanikolaou20, Barbara 43 Parrini5, Lennart Pederson11, Liz Pellicano3, Catherine Pienkowski16, Judith Ponsford3, 44 Annemarie Poustka12, Fritz Poustka13, Maria Rastam17, Karola Rehnström1, Katy 45 Renshaw3, Bernadette Rogé16, Dorothea Ruehl13, Michael Rutter4, Susan Sarenius1, 46 Gabriele Schmötzer13, Claudia Schuster12, Henrik Anckarsater17, Raffaella Tancredi5, 2 47 Maïté Tauber16, John Tsiantis20, Nora Uhlig13, Raija Vanhala1, Simon Wallace3, Lennart 48 von Wendt1, Kerstin Wittemeyer3, Tero Ylisaukko-oja1. 49 1 Helsinki University Central Hospital, Helsinki, Finland. 50 2 University of Bologna, Alma Mater Studorium, Bologna, Italy. 51 3 University of Oxford, Department of Psychiatry, Oxford, UK. 52 4 Kings College London, Newcomen Centre, London, UK. 53 5 Stella Maris Clinical Research Institute for Child and Adolescent Neuropsychiatry, 54 Pisa, Italy. 55 6 INSERM U952, CNRS UMR7224, UPMC Univ Paris 06, Paris, France. 56 7 Stichting Universitaire en Algemene Kinder – en Jeugdpsychiatrie Noord – Nederland 57 (Accare) / University Medical Center Groningen, University Center Child and Adolescent 58 Psychiatry Groningen, Groningen, Netherlands. 59 8 Department of Child and Adolescent Psychiatry, Central Institute of Mental Health, 60 Mannheim, Germany. 61 9 Kings College London, Department of Child and Adolescent Psychiatry, London, UK. 62 10 Institut Pasteur, Paris, France. 63 11 Center for Autisme, Herlev, Denmark. 64 12 German Cancer Research Center (DKFZ), Division of Molecular Genome Analysis, 65 Heidelberg, Germany. 66 13 Department of Child and Adolescent Psychiatry, Psychosomatics and Psychotherapy, 67 Johann Wolfgang Goethe-University, Deutschordenstr. 50, 60528, Frankfurt/Main, 68 Germany. 3 69 14 University Medical Centre Utrecht, Department of Child and Adolescent Psychiatry, 70 Utrecht, Netherlands. 71 15 University of Oxford, Wellcome Trust Centre for Human Genetics, Oxford, UK. 72 16 Universite de Toulouse le Mirail. Toulouse, France. 73 17 Goteborg University, Department of Child and Adolescent Psychiatry, Goteborg, 74 Sweden. 75 18 INSERM U955; AP-HP, Henri Mondor-Albert Chenevier Hospital, Department of 76 Psychiatry; Université Paris 12, Faculty of Medicine, Créteil, France. 77 19 University of Newcastle, Department of Child and Adolescent Psychiatry, Sir James 78 Spence Institute, Royal Victoria Infirmary, Newcastle, UK. 79 20 National and Kapodistrian University of Athens, Medical School, Department of Child 80 Psychiatry, Athens, Greece. 81 82 Keywords Autistic disorder, linkage, association, candidate gene 83 84 85 86 87 88 89 90 91 4 92 Abstract 93 Over the past decade, research on the genetic variants underlying susceptibility to autism 94 and autism spectrum disorders has focused on linkage and candidate gene studies. This 95 research has implicated a variety of chromosomal loci and genes. Candidate gene studies 96 have proved particularly intractable, with many studies failing to replicate previously 97 reported associations. Here we investigate previously implicated genomic regions for a 98 role in autism spectrum disorder susceptibility, using four cohorts of European ancestry. 99 Initially, a 384 SNP Illumina GoldenGate® array was used to examine linkage at six 100 previously implicated loci. We identify linkage approaching genome-wide suggestive 101 levels on chromosome 2 (rs2885116, MLOD = 1.89). Association analysis revealed 102 significant associations in MKL2 with ASD (rs756472, P = 4.31 x 10-5) and between 103 SND1 and strict autism (rs1881084, P = 7.76 x 10-5) in the Finnish and Northern Dutch 104 populations, respectively. Subsequently, we used a second 384 SNP Illumina 105 GoldenGate® array to examine association in seven candidate genes and evidence for 106 association was found in RELN (rs362780, P = 0.00165). Further increasing the sample 107 size strengthened the association to RELN (rs362780, P = 0.001) and produced a second 108 significant result in GRIK2 (rs2518261, P = 0.008). Our results strengthen the case for a 109 more detailed study of the role of RELN and GRIK2 in autism susceptibility as well as 110 identifying two new potential candidate genes; MKL2 and SND1. 111 112 113 114 5 115 Introduction 116 Autism, a neuropsychiatric disorder with an onset before three years of age, is 117 characterised by impaired reciprocal communication and social interaction and restricted 118 and stereotyped patterns of interests and behaviour. The definition can be further 119 broadened to include atypical autism, Asperger syndrome and pervasive developmental 120 disorder not otherwise specified (PDD-NOS), to create a class of conditions collectively 121 referred to as Autism Spectrum Disorders (ASDs) (OMIM %209850). 122 ASDs affect approximately 0.6 – 1.2% of the general population (1, 2), with a 123 marked excess of boys to girls of around 4:1 (3, 4). Multiple lines of evidence have shown 124 that autism has a large genetic component. The prevalence of ASDs is increased to 2-8% 125 amongst the siblings of affected individuals (4, 5), and the concordance rates increase from 126 0% in same-sex dizygotic twins to 36-60% in monozygotic pairs (6, 7). Thus the 127 heritability of autism is approximately 90%, making it the most heritable of the childhood 128 onset neuropsychiatric disorders (7). 129 Despite the obvious importance of genetic factors in autism development, the 130 search for the genes underlying susceptibility has met with limited success. A large 131 number of linkage studies have been performed and have identified possible 132 susceptibility loci on multiple chromosomes (8). While there is not total concordance 133 between the different studies, certain regions, such as those on chromosomes 2, 3, 7, 11, 134 16, 17 and 19, have been implicated
Load more

Recommended publications
  • List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
    List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0
    [Show full text]
  • Gene Expression During Normal and FSHD Myogenesis Tsumagari Et Al
    Gene expression during normal and FSHD myogenesis Tsumagari et al. Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 (27 September 2011) Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 RESEARCHARTICLE Open Access Gene expression during normal and FSHD myogenesis Koji Tsumagari1, Shao-Chi Chang1, Michelle Lacey2,3, Carl Baribault2,3, Sridar V Chittur4, Janet Sowden5, Rabi Tawil5, Gregory E Crawford6 and Melanie Ehrlich1,3* Abstract Background: Facioscapulohumeral muscular dystrophy (FSHD) is a dominant disease linked to contraction of an array of tandem 3.3-kb repeats (D4Z4) at 4q35. Within each repeat unit is a gene, DUX4, that can encode a protein containing two homeodomains. A DUX4 transcript derived from the last repeat unit in a contracted array is associated with pathogenesis but it is unclear how. Methods: Using exon-based microarrays, the expression profiles of myogenic precursor cells were determined. Both undifferentiated myoblasts and myoblasts differentiated to myotubes derived from FSHD patients and controls were studied after immunocytochemical verification of the quality of the cultures. To further our understanding of FSHD and normal myogenesis, the expression profiles obtained were compared to those of 19 non-muscle cell types analyzed by identical methods. Results: Many of the ~17,000 examined genes were differentially expressed (> 2-fold, p < 0.01) in control myoblasts or myotubes vs. non-muscle cells (2185 and 3006, respectively) or in FSHD vs. control myoblasts or myotubes (295 and 797, respectively). Surprisingly, despite the morphologically normal differentiation of FSHD myoblasts to myotubes, most of the disease-related dysregulation was seen as dampening of normal myogenesis- specific expression changes, including in genes for muscle structure, mitochondrial function, stress responses, and signal transduction.
    [Show full text]
  • Oligogenic Inheritance of Congenital Heart Disease Involving a NKX2-5 Modifier
    bioRxiv preprint doi: https://doi.org/10.1101/266726; this version posted February 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Title: Oligogenic inheritance of congenital heart disease involving a NKX2-5 modifier Short Title: Oligogenic congenital heart disease Authors: Casey A. Gifford1,2, Sanjeev S. Ranade1,2, Ryan Samarakoon1,2, Hazel T. Salunga1,2, T. Yvanka de Soysa1,2, Yu Huang1, Ping Zhou1, Aryé Elfenbein1,2, Stacia K. Wyman1†, Yen Kim Bui1,2, Kimberly R. Cordes Metzler1,2, Philip Ursell3, Kathryn N. Ivey1,2,4§ and Deepak Srivastava1,2,4,5,* Affiliations: 1 Gladstone Institute of Cardiovascular Disease, San Francisco, CA 94158, USA 2 Roddenberry Center for Stem Cell Biology and Medicine at Gladstone, San Francisco, CA 94158, USA Departments of 3 Pathology, 4 Pediatrics, and 5 Biochemistry and Biophysics, University of California, San Francisco, San Francisco, CA 94143, USA † Current address: Innovative Genomics Institute, Berkeley, CA 94704 § Current address: Tenaya Therapeutics, South San Francisco, CA 94080 *Corresponding author: Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/266726; this version posted February 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract Complex genetic inheritance is thought to underlie many human diseases, yet experimental proof of this model has been elusive.
    [Show full text]
  • A Set of Regulatory Genes Co-Expressed in Embryonic Human Brain Is Implicated in Disrupted Speech Development
    Molecular Psychiatry https://doi.org/10.1038/s41380-018-0020-x ARTICLE A set of regulatory genes co-expressed in embryonic human brain is implicated in disrupted speech development 1 1 1 2 3 Else Eising ● Amaia Carrion-Castillo ● Arianna Vino ● Edythe A. Strand ● Kathy J. Jakielski ● 4,5 6 7 8 9 Thomas S. Scerri ● Michael S. Hildebrand ● Richard Webster ● Alan Ma ● Bernard Mazoyer ● 1,10 4,5 6,11 6,12 13 Clyde Francks ● Melanie Bahlo ● Ingrid E. Scheffer ● Angela T. Morgan ● Lawrence D. Shriberg ● Simon E. Fisher 1,10 Received: 22 September 2017 / Revised: 3 December 2017 / Accepted: 2 January 2018 © The Author(s) 2018. This article is published with open access Abstract Genetic investigations of people with impaired development of spoken language provide windows into key aspects of human biology. Over 15 years after FOXP2 was identified, most speech and language impairments remain unexplained at the molecular level. We sequenced whole genomes of nineteen unrelated individuals diagnosed with childhood apraxia of speech, a rare disorder enriched for causative mutations of large effect. Where DNA was available from unaffected parents, CHD3 SETD1A WDR5 fi 1234567890();,: we discovered de novo mutations, implicating genes, including , and . In other probands, we identi ed novel loss-of-function variants affecting KAT6A, SETBP1, ZFHX4, TNRC6B and MKL2, regulatory genes with links to neurodevelopment. Several of the new candidates interact with each other or with known speech-related genes. Moreover, they show significant clustering within a single co-expression module of genes highly expressed during early human brain development. This study highlights gene regulatory pathways in the developing brain that may contribute to acquisition of proficient speech.
    [Show full text]
  • UC San Diego UC San Diego Electronic Theses and Dissertations
    UC San Diego UC San Diego Electronic Theses and Dissertations Title Regulation of gene expression programs by serum response factor and megakaryoblastic leukemia 1/2 in macrophages Permalink https://escholarship.org/uc/item/8cc7d0t0 Author Sullivan, Amy Lynn Publication Date 2009 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Regulation of Gene Expression Programs by Serum Response Factor and Megakaryoblastic Leukemia 1/2 in Macrophages A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Amy Lynn Sullivan Committee in charge: Professor Christopher K. Glass, Chair Professor Stephen M. Hedrick Professor Marc R. Montminy Professor Nicholas J. Webster Professor Joseph L. Witztum 2009 Copyright Amy Lynn Sullivan, 2009 All rights reserved. The Dissertation of Amy Lynn Sullivan is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Chair University of California, San Diego 2009 iii DEDICATION To my husband, Shane, for putting up with me through all of the long hours, last minute late nights, and for not letting me quit no matter how many times my projects fell apart. To my son, Tyler, for always making me smile and for making every day an adventure. To my gifted colleagues, for all of the thought-provoking discussions, technical help and moral support through the roller- coaster ride that has been my graduate career. To my family and friends, for all of your love and support. I couldn’t have done it without you! iv EPIGRAPH If at first you don’t succeed, try, try, again.
    [Show full text]
  • Inter-Chromosomal Variation in the Pattern of Human Population Genetic Structure Tesfaye M
    PRIMARY RESEARCH Inter-chromosomal variation in the pattern of human population genetic structure Tesfaye M. Baye* Cincinnati Children’s Hospital Medical Center, Division of Asthma Research, Department of Pediatrics, University of Cincinnati, 3333 Burnet Avenue, Cincinnati, OH 45229, USA *Correspondence to: Tel: þ1 513 803 2766; Fax: þ1 513 636 1657; E-mail: [email protected] Date received (in revised form): 1st March 2011 Abstract Emerging technologies now make it possible to genotype hundreds of thousands of genetic variations in individuals, across the genome. The study of loci at finer scales will facilitate the understanding of genetic variation at genomic and geographic levels. We examined global and chromosomal variations across HapMap populations using 3.7 million single nucleotide polymorphisms to search for the most stratified genomic regions of human populations and linked these regions to ontological annotation and functional network analysis. To achieve this, we used five complementary statistical and genetic network procedures: principal component (PC), cluster, discriminant, fix- ation index (FST) and network/pathway analyses. At the global level, the first two PC scores were sufficient to account for major population structure; however, chromosomal level analysis detected subtle forms of population structure within continental populations, and as many as 31 PCs were required to classify individuals into homo- geneous groups. Using recommended population ancestry differentiation measures, a total of 126 regions of the genome were catalogued. Gene ontology and networks analyses revealed that these regions included the genes encoding oculocutaneous albinism II (OCA2), hect domain and RLD 2 (HERC2), ectodysplasin A receptor (EDAR) and solute carrier family 45, member 2 (SLC45A2).
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Download 20190410); Fragmentation for 20 S
    ARTICLE https://doi.org/10.1038/s41467-020-17387-y OPEN Multi-layered proteomic analyses decode compositional and functional effects of cancer mutations on kinase complexes ✉ Martin Mehnert 1 , Rodolfo Ciuffa1, Fabian Frommelt 1, Federico Uliana1, Audrey van Drogen1, ✉ ✉ Kilian Ruminski1,3, Matthias Gstaiger1 & Ruedi Aebersold 1,2 fi 1234567890():,; Rapidly increasing availability of genomic data and ensuing identi cation of disease asso- ciated mutations allows for an unbiased insight into genetic drivers of disease development. However, determination of molecular mechanisms by which individual genomic changes affect biochemical processes remains a major challenge. Here, we develop a multilayered proteomic workflow to explore how genetic lesions modulate the proteome and are trans- lated into molecular phenotypes. Using this workflow we determine how expression of a panel of disease-associated mutations in the Dyrk2 protein kinase alter the composition, topology and activity of this kinase complex as well as the phosphoproteomic state of the cell. The data show that altered protein-protein interactions caused by the mutations are asso- ciated with topological changes and affected phosphorylation of known cancer driver pro- teins, thus linking Dyrk2 mutations with cancer-related biochemical processes. Overall, we discover multiple mutation-specific functionally relevant changes, thus highlighting the extensive plasticity of molecular responses to genetic lesions. 1 Department of Biology, Institute of Molecular Systems Biology, ETH Zurich,
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • MRTFB Suppresses Colorectal Cancer Development Through Regulating SPDL1 and MCAM
    MRTFB suppresses colorectal cancer development through regulating SPDL1 and MCAM Takahiro Kodamaa,b,c, Teresa A. Mariana,b, Hubert Leea, Michiko Kodamaa, Jian Lid, Michael S. Parmacekd, Nancy A. Jenkinsa,e, Neal G. Copelanda,e,1, and Zhubo Weia,b,1 aHouston Methodist Research Institute, Houston Methodist Hospital, Houston, TX 77030; bHouston Methodist Cancer Center, Houston Methodist Hospital, Houston, TX 77030; cDepartment of Gastroenterology and Hepatology, Graduate School of Medicine, Osaka University, 5650871 Suita, Osaka, Japan; dDepartment of Medicine, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; and eGenetics Department, The University of Texas MD Anderson Cancer Center, Houston, TX 77030 Contributed by Neal G. Copeland, October 7, 2019 (sent for review June 18, 2019; reviewed by Masaki Mori and Hiroshi Seno) Myocardin-related transcription factor B (MRTFB) is a candidate tumor- shown to regulate cell cycle progression (9) and HCC xenograft suppressor gene identified in transposon mutagenesis screens of the tumor growth (10). Functional validation using cell culture sys- intestine, liver, and pancreas. Using a combination of cell-based assays, tems have also shown that reduced expression of MRTFB by in vivo tumor xenograft assays, and Mrtfb knockout mice, we demon- RNA interference leads to increased CRC cell invasion (4), strate here that MRTFB is a human and mouse colorectal cancer suggesting its important role in tumor progression. (CRC) tumor suppressor that functions in part by inhibiting cell Based on these results, we decided to conditionally delete invasion and migration. To identify possible MRTFB transcriptional Mrtfb in the mouse intestine to further explore its role in CRC.
    [Show full text]
  • Genetic Modifiers and Rare Mendelian Disease
    G C A T T A C G G C A T genes Review Genetic Modifiers and Rare Mendelian Disease K. M. Tahsin Hassan Rahit 1,2 and Maja Tarailo-Graovac 1,2,* 1 Departments of Biochemistry, Molecular Biology and Medical Genetics, Cumming School of Medicine, University of Calgary, Calgary, AB T2N 4N1, Canada; [email protected] 2 Alberta Children’s Hospital Research Institute, University of Calgary, Calgary, AB T2N 4N1, Canada * Correspondence: [email protected] Received: 24 January 2020; Accepted: 21 February 2020; Published: 25 February 2020 Abstract: Despite advances in high-throughput sequencing that have revolutionized the discovery of gene defects in rare Mendelian diseases, there are still gaps in translating individual genome variation to observed phenotypic outcomes. While we continue to improve genomics approaches to identify primary disease-causing variants, it is evident that no genetic variant acts alone. In other words, some other variants in the genome (genetic modifiers) may alleviate (suppress) or exacerbate (enhance) the severity of the disease, resulting in the variability of phenotypic outcomes. Thus, to truly understand the disease, we need to consider how the disease-causing variants interact with the rest of the genome in an individual. Here, we review the current state-of-the-field in the identification of genetic modifiers in rare Mendelian diseases and discuss the potential for future approaches that could bridge the existing gap. Keywords: genetic modifier; mendelian disease; rare disease; GWAS; genome sequencing; genetic interaction; penetrance; expressivity; phenotypic variability; bioinformatics 1. Introduction Diseases that follow Mendelian patterns of inheritance are known as Mendelian disorders.
    [Show full text]
  • 1 Transcriptomic Responses to Hypoxia in Endometrial and Decidual Stromal Cells 2 3 Kalle T
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.21.885657; this version posted December 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Transcriptomic responses to hypoxia in endometrial and decidual stromal cells 2 3 Kalle T. Rytkönen 1,2,3,4, Taija Heinosalo 1, Mehrad Mahmoudian 2,5, Xinghong Ma 3,4, Antti 4 Perheentupa 1,6, Laura L. Elo 2, Matti Poutanen 1 and Günter P. Wagner 3,4,7,8 5 6 1 Institute of Biomedicine, Research Centre for Integrative Physiology and Pharmacology, 7 University of Turku, Kiinamyllynkatu 10, 20014, Finland 8 2 Turku Bioscience Centre, University of Turku and Åbo Akademi University, Tykistökatu 6, 9 20520, Turku, Finland 10 3 Yale Systems Biology Institute, West Haven, Connecticut 06516, USA 11 4 Department of Ecology and Evolutionary Biology, Yale University, New Haven, CT 06511, 12 USA 13 5 Department of Future Technologies, University of Turku, FI-20014 Turku, Finland 14 6 Department of Obstetrics and Gynecology, Turku University Hospital, Kiinamyllynkatu 4-8, 15 20521, Turku, Finland. 16 7 Department of Obstetrics, Gynecology and Reproductive Sciences, Yale Medical School, New 17 Haven 06510, USA 18 8 Department of Obstetrics and Gynecology, Wayne State University, Detroit, MI- 48201, USA 19 20 Correspondence should be addresses to K T Rytkönen; Email: [email protected]. Address: Institute 21 of Biomedicine, Research Centre for Integrative Physiology and Pharmacology, University of 22 Turku, Kiinamyllynkatu 10, 20014, Finland / Turku Bioscience Centre, University of Turku and 23 Åbo Akademi University, Tykistökatu 6, 20520, Turku, Finland.
    [Show full text]