1 Transcriptomic Responses to Hypoxia in Endometrial and Decidual Stromal Cells 2 3 Kalle T
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
PARSANA-DISSERTATION-2020.Pdf
DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks. -
Basic Helix-Loop-Helix Transcription Factors DEC1 and DEC2 Regulate the Paclitaxel-Induced Apoptotic Pathway of MCF-7 Human Breast Cancer Cells
INTERNATIONAL JOURNAL OF MoleCular MEDICine 27: 491-495, 2011 Basic helix-loop-helix transcription factors DEC1 and DEC2 regulate the paclitaxel-induced apoptotic pathway of MCF-7 human breast cancer cells YUNYAN WU1,2, FUYUKI SATO1, UJJAL KUMAR BHAWAL3, TAKESHI KAWAMOTO4, KATSUMI FUJIMOTO4, MITSUHIDE NOSHIRO4, SATOKO MOROHASHI1, YUKIO KATO4 and HIROSHI KIJIMA1 1Department of Pathology and Bioscience, Hirosaki University Graduate School of Medicine, Hirosaki 036-8562, Japan; 2Department of Pathology, College of Basic Medical Sciences, China Medical University, Shenyang 110001, P.R. China; 3Department of Oral and Maxillofacial Surgery and High-Tech Research Center, Kanagawa Dental College, Yokosuka 238-8580; 4Department of Dental and Medical Biochemistry, Hiroshima University Graduate School of Biomedical Science, Hiroshima 734-8553, Japan Received November 17, 2010; Accepted January 10, 2011 DOI: 10.3892/ijmm.2011.617 Abstract. Differentiated embryonic chondrocyte gene Introduction (DEC) 1 (BHLHE40/Stra13/Sharp2) and DEC2 (BHLHE41/ Sharp1) are basic helix-loop-helix (bHLH) transcription Paclitaxel is an anti-tumor drug that is used against a wide factors that are associated with the regulation of apoptosis, cell variety of solid tumors (1,2) and affects the expression of proliferation and circadian rhythms, as well as malignancy Bcl-2, Bcl-xL and phosphorylated-c-Jun NH2-terminal kinase in various cancers. However, the roles of DEC1 and DEC2 (JNK), and the activation of caspases and poly (ADP-ribose) expression in breast cancer are poorly understood. In this polymerase PARP (3-6), resulting in the induction of apop- study, we sought to examine the roles of DEC1 and DEC2 tosis by p53-dependent or -independent mechanisms (7-9). -
Nuclear and Mitochondrial Genome Defects in Autisms
UC Irvine UC Irvine Previously Published Works Title Nuclear and mitochondrial genome defects in autisms. Permalink https://escholarship.org/uc/item/8vq3278q Journal Annals of the New York Academy of Sciences, 1151(1) ISSN 0077-8923 Authors Smith, Moyra Spence, M Anne Flodman, Pamela Publication Date 2009 DOI 10.1111/j.1749-6632.2008.03571.x License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California THE YEAR IN HUMAN AND MEDICAL GENETICS 2009 Nuclear and Mitochondrial Genome Defects in Autisms Moyra Smith, M. Anne Spence, and Pamela Flodman Department of Pediatrics, University of California, Irvine, California In this review we will evaluate evidence that altered gene dosage and structure im- pacts neurodevelopment and neural connectivity through deleterious effects on synap- tic structure and function, and evidence that the latter are key contributors to the risk for autism. We will review information on alterations of structure of mitochondrial DNA and abnormal mitochondrial function in autism and indications that interactions of the nuclear and mitochondrial genomes may play a role in autism pathogenesis. In a final section we will present data derived using Affymetrixtm SNP 6.0 microar- ray analysis of DNA of a number of subjects and parents recruited to our autism spectrum disorders project. We include data on two sets of monozygotic twins. Col- lectively these data provide additional evidence of nuclear and mitochondrial genome imbalance in autism and evidence of specific candidate genes in autism. We present data on dosage changes in genes that map on the X chromosomes and the Y chro- mosome. -
Molecular Genetic Delineation of 2Q37.3 Deletion in Autism and Osteodystrophy: Report of a Case and of New Markers for Deletion Screening by PCR
UC Irvine UC Irvine Previously Published Works Title Molecular genetic delineation of 2q37.3 deletion in autism and osteodystrophy: report of a case and of new markers for deletion screening by PCR. Permalink https://escholarship.org/uc/item/83f0x61r Journal Cytogenetics and cell genetics, 94(1-2) ISSN 0301-0171 Authors Smith, M Escamilla, JR Filipek, P et al. Publication Date 2001 DOI 10.1159/000048775 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Original Article Cytogenet Cell Genet 94:15–22 (2001) Molecular genetic delineation of 2q37.3 deletion in autism and osteodystrophy: report of a case and of new markers for deletion screening by PCR M. Smith, J.R. Escamilla, P. Filipek, M.E. Bocian, C. Modahl, P. Flodman, and M.A. Spence Department of Pediatrics, University of California, Irvine CA (USA) Abstract. We recently studied a patient who meets criteria us to determine the parental origin of the deletion in our for autistic disorder and has a 2q37 deletion. Molecular cyto- patient. DNA from 8–13 unrelated individuals was used to genetic studies were carried out using DNA isolated from 22 determine heterozygosity estimates for these markers. We re- different 2q37 mapped BACs to more precisely define the view four genes deleted in our patient – genes whose known extent of the chromosome deletion. We also analyzed 2q37 functions and sites of expression in the brain and/or bone make mapped polymorphic markers. In addition DNA sequences of them candidates for involvement in autism and/or the osteo- BACs in the deletion region were scanned to identify microsa- dystrophy observed in patients with 2q37.3 deletions. -
Expression of Oncogenes ELK1 and ELK3 in Cancer
Review Article Annals of Colorectal Cancer Research Published: 11 Nov, 2019 Expression of Oncogenes ELK1 and ELK3 in Cancer Akhlaq Ahmad and Asif Hayat* College of Chemistry, Fuzhou University, China Abstract Cancer is the uncontrolled growth of abnormal cells anywhere in a body, ELK1 and ELK3 is a member of the Ets-domain transcription factor family and the TCF (Ternary Complex Factor) subfamily. Proteins in this subfamily regulate transcription when recruited by SRF (Serum Response Factor) to bind to serum response elements. ELK1 and ELK3 transcription factors are known as oncogenes. Both transcription factors are proliferated in a different of type of cancer. Herein, we summarized the expression of transcription factor ELK1 and ELK3 in cancer cells. Keywords: ETS; ELK1; ELK3; Transcription factor; Cancer Introduction The ETS, a transcription factor of E twenty-six family based on a dominant ETS amino acids that integrated with a ~10-basepair element arrange in highly mid core sequence 5′-GGA(A/T)-3′ [1-2]. The secular family alter enormous 28/29 members which has been assigned in human and mouse and similarly the family description are further sub-divided into nine sub-families according to their homology and domain factor [3]. More importantly, one of the subfamily members such as ELK (ETS-like) adequate an N-terminal ETS DNA-binding domain along with a B-box domain that transmit the response of serum factor upon the formation of ternary complex and therefore manifested as ternary complex factors [4]. Further the ELK sub-divided into Elk1, Elk3 (Net, Erp or Sap2) and Elk4 (Sap1) proteins [3,4], which simulated varied proportional of potential protein- protein interactions [4,5]. -
TRANSCRIPTIONAL REGULATION of Hur in RENAL STRESS
TRANSCRIPTIONAL REGULATION OF HuR IN RENAL STRESS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Sudha Suman Govindaraju Graduate Program in Biochemistry The Ohio State University 2014 Dissertation Committee: Dr. Beth S. Lee, Ph.D., Advisor Dr. Kathleen Boris-Lawrie, Ph.D. Dr. Sissy M. Jhiang, Ph.D. Dr. Arthur R. Strauch, Ph.D Abstract HuR is a ubiquitously expressed RNA-binding protein that affects the post- transcriptional life of thousands of cellular mRNAs by regulating transcript stability and translation. HuR can post-transcriptionally regulate gene expression and modulate cellular responses to stress, differentiation, proliferation, apoptosis, senescence, inflammation, and the immune response. It is an important mediator of survival during cellular stress, but when inappropriately expressed, can promote oncogenic transformation. Not surprisingly, the expression of HuR itself is tightly regulated at multiple transcriptional and post-transcriptional levels. Previous studies demonstrated the existence of two alternate HuR transcripts that differ in their 5’ untranslated regions and have markedly different translatabilities. These forms were also found to be reciprocally expressed following cellular stress in kidney proximal tubule cell lines, and the shorter, more readily translatable variant was shown to be regulated by Smad 1/5/8 pathway and bone morphogenetic protein-7 (BMP-7) signaling. In this study, the factors that promote transcription of the longer alternate form were identified. NF-κB was shown to be important for expression of the long HuR mRNA, as was a newly identified region with potential for binding the Sp/KLF families of transcription factors. -
Analysis of Gene Expression Data for Gene Ontology
ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins. -
Downregulation of Dipeptidyl Peptidase 4 Accelerates Progression to Castration-Resistant Prostate Cancer Joshua W
Published OnlineFirst September 21, 2018; DOI: 10.1158/0008-5472.CAN-18-0687 Cancer Priority Report Research Downregulation of Dipeptidyl Peptidase 4 Accelerates Progression to Castration-Resistant Prostate Cancer Joshua W. Russo1,CeGao2, Swati S. Bhasin2, Olga S. Voznesensky1, Carla Calagua3, Seiji Arai1,4, Peter S. Nelson5, Bruce Montgomery6, Elahe A. Mostaghel5, Eva Corey6, Mary-Ellen Taplin7, Huihui Ye3, Manoj Bhasin2, and Steven P. Balk1 Abstract The standard treatment for metastatic prostate cancer, cleaves dipeptides from multiple growth factors, resulting in androgen deprivation therapy (ADT), is designed to suppress their increased degradation. DPP4 mRNA and protein were androgen receptor (AR) activity. However, men invariably also decreased in clinical CRPC cases, and inhibition of progress to castration-resistant prostate cancer (CRPC), and DPP4 with sitagliptin enhanced the growth of prostate AR reactivation contributes to progression in most cases. To cancer xenografts following castration. Significantly, DPP4 identify mechanisms that may drive CRPC, we examined a inhibitors are frequently used to treat type 2 diabetes as they VCaP prostate cancer xenograft model as tumors progressed increase insulin secretion. Together, these results implicate from initial androgen sensitivity prior to castration to castra- DPP4 as an AR-regulated tumor suppressor gene whose tion resistance and then on to relapse after combined therapy loss enhances growth factor activity and suggest that treat- with further AR-targeted drugs (abiraterone plus enzaluta- ment with DPP4 inhibitors may accelerate emergence of mide). AR activity persisted in castration-resistant and abir- resistance to ADT. aterone/enzalutamide–resistant xenografts and was associated with increased expression of the AR gene and the AR-V7 splice Significance: These findings identify DPP4 as an AR-stim- variant. -
Environmental Influences on Endothelial Gene Expression
ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community. -
List of Genes Associated with Sudden Cardiac Death (Scdgseta) Gene
List of genes associated with sudden cardiac death (SCDgseta) mRNA expression in normal human heart Entrez_I Gene symbol Gene name Uniprot ID Uniprot name fromb D GTEx BioGPS SAGE c d e ATP-binding cassette subfamily B ABCB1 P08183 MDR1_HUMAN 5243 √ √ member 1 ATP-binding cassette subfamily C ABCC9 O60706 ABCC9_HUMAN 10060 √ √ member 9 ACE Angiotensin I–converting enzyme P12821 ACE_HUMAN 1636 √ √ ACE2 Angiotensin I–converting enzyme 2 Q9BYF1 ACE2_HUMAN 59272 √ √ Acetylcholinesterase (Cartwright ACHE P22303 ACES_HUMAN 43 √ √ blood group) ACTC1 Actin, alpha, cardiac muscle 1 P68032 ACTC_HUMAN 70 √ √ ACTN2 Actinin alpha 2 P35609 ACTN2_HUMAN 88 √ √ √ ACTN4 Actinin alpha 4 O43707 ACTN4_HUMAN 81 √ √ √ ADRA2B Adrenoceptor alpha 2B P18089 ADA2B_HUMAN 151 √ √ AGT Angiotensinogen P01019 ANGT_HUMAN 183 √ √ √ AGTR1 Angiotensin II receptor type 1 P30556 AGTR1_HUMAN 185 √ √ AGTR2 Angiotensin II receptor type 2 P50052 AGTR2_HUMAN 186 √ √ AKAP9 A-kinase anchoring protein 9 Q99996 AKAP9_HUMAN 10142 √ √ √ ANK2/ANKB/ANKYRI Ankyrin 2 Q01484 ANK2_HUMAN 287 √ √ √ N B ANKRD1 Ankyrin repeat domain 1 Q15327 ANKR1_HUMAN 27063 √ √ √ ANKRD9 Ankyrin repeat domain 9 Q96BM1 ANKR9_HUMAN 122416 √ √ ARHGAP24 Rho GTPase–activating protein 24 Q8N264 RHG24_HUMAN 83478 √ √ ATPase Na+/K+–transporting ATP1B1 P05026 AT1B1_HUMAN 481 √ √ √ subunit beta 1 ATPase sarcoplasmic/endoplasmic ATP2A2 P16615 AT2A2_HUMAN 488 √ √ √ reticulum Ca2+ transporting 2 AZIN1 Antizyme inhibitor 1 O14977 AZIN1_HUMAN 51582 √ √ √ UDP-GlcNAc: betaGal B3GNT7 beta-1,3-N-acetylglucosaminyltransfe Q8NFL0 -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
C2orf3 (GCFC2) (NM 001201334) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG234563 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Tag: TurboGFP Symbol: GCFC2 Synonyms: C2orf3; DNABF; GCF; TCF9 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone – RG234563 ORF Nucleotide >RG234563 representing NM_001201334 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGAGAGAGAGCGAAGATGACCCTGAGAGTGAGCCTGATGACCATGAAAAGAGAATACCATTTACTC TAAGACCTCAAACACTTAGACAAAGGATGGCTGAGGAATCAATAAGCAGAAATGAAGAAACAAGTGAAGA AAGTCAGGAAGATGAAAAGCAAGATACTTGGGAACAACAGCAAATGAGGAAAGCAGTTAAAATCATAGAG GAAAGAGACATAGATCTTTCCTGTGGCAATGGATCTTCAAAAGTGAAGAAATTTGATACTTCCATTTCAT TTCCGCCAGTAAATTTAGAAATTATAAAGAAGCAATTAAATACTAGATTAACATTACTACAGGAAACTCA CCGCTCACACCTGAGGGAGTATGAAAAATACGTACAAGATGTCAAAAGCTCAAAGAGTACCATCCAGAAC CTAGAGAGTTCATCAAATCAAGCTCTAAATTGTAAATTCTATAAAAGCATGAAAATTTATGTGGAAAATT TAATTGACTGCCTTAATGAAAAGATTATCAACATCCAAGAAATAGAATCATCCATGCATGCACTCCTTTT