A Xenopus Egg Factor with DNA-Binding Properties Characterisuc of Terminus- Specific Telomeric Proteins
Total Page：16
File Type：pdf, Size：1020Kb
Downloaded from genesdev.cshlp.org on October 9, 2021 - Published by Cold Spring Harbor Laboratory Press A Xenopus egg factor with DNA-binding properties characterisuc of terminus- specific telomeric proteins Maria E. Cardenas, 1 Alessandro Bianchi, and Titia de Lange 2 The Rockefeller University, New York, New York 10021-6399 USA We have identified a Xenopus laevis protein factor that specifically recognizes vertebrate telomeric repeats at DNA ends. This factor, called Xenopns telomere end factor (XTEF), is detected predominantly in extracts of Xenopus eggs and ovaries, which are estimated to contain sufficient XTEF to bind -3 x 107 DNA ends. In contrast, XTEF is much less abundant (-90 per cell} in extracts of somatic cell nuclei. Mobility retardation analysis of the XTEF activity in egg extracts indicates that this factor binds the vertebrate telomeric repeat sequence (TTAGGG)2 when present in a single-stranded 3' overhang. Single-stranded 3' extensions of (TTTGGG)2, (AAAGGG)2, (TTACCC)2, or a nonrepetitive sequence fail to bind XTEF efficiently, whereas changes in the double-stranded sequence 5' to the TTAGGG repeat tail are tolerated. TTAGGG repeats are not recognized at internal positions, at a 5' protruding end, or in double-stranded DNA. In addition, the factor does not bind RNA with single-stranded UUAGGG repeats at a 3' end. XTEF-DNA complexes form and are stable in high salt. The DNA-binding properties of XTEF resemble the characteristics of a class of terminus-specific telomere proteins identified previously in hypotrichous ciliates. [Key Words: Xenopus egg; single-stranded DNA-binding activity; telomeric DNA; vertebrate telomeres] Received February 2, 1993; revised version accepted March 15, 1993. Telomeres have at least two activities important for the nal sequences that accompanies chromosomal DNA rep- stability of eukaryotic chromosomes (for review, see Za- lication. kian 1989; Blackburn 1991). First, telomeres must pro- Telomeric DNA is thought to associate with telomere- vide a special strategy for the complete duplication of specific factors to form a protective nucleoprotein com- linear genomes, because replication of linear DNA by plex. The chromatin structure of chromosome ends in conventional DNA polymerases will result in progres- ciliates and Saccharomyces cerevisiae bears evidence of sive loss of terminal sequences (Watson 1972). Such a large telomeric nucleoprotein complex (Blackburn and gradual decline is directly manifested by the ends of bro- Chiou 1981; Gottschling and Cech 1984; Wright et al. ken chromosomes in Drosophila (Biessman and Mason 1992), and a disruption of the telomeric nucleoprotein 1988; Levis 1989). In contrast, natural chromosome ends complex has been proposed to be responsible for the del- are usually stable. Second, telomeres protect chromo- eterious phenotype of mutated telomeric repeats in Tet- some ends from irreversible ligation. Unlike intact te- rahymena (Yu et al. 1990). At present, two classes of lomeres, broken chromosome ends have a strong ten- telomere-binding proteins have been identified. The first dency to fuse (McClintock 1941), perhaps because un- class, exemplified by RAP1 protein in budding yeast, capped DNA ends are subject to DNA repair. consists of factors that bind double-stranded telomeric The telomeres of divergent eukaryotes, such as proto- repeats and do not require the proximity of a DNA end zoa, plants, fungi, and vertebrates contain similar short (Berman et al. 1986; Buchman et al. 1988; Longtine et al. tandem DNA repeats, which usually have clusters of I989; Conrad et al. 1990; Lustig et al. 1990; Sussel and guanine residues in the 3' strand. Telomeric repeats are Shore 1991; Kyrion et al. 1992). Additional candidates for synthesized at least in part by telomerase, a ribonucle- this class of telomere proteins have been identified in oprotein enzyme with a short RNA template that directs slime molds and mammals (Coren et al. 1991; Zhong et the addition of G-rich repeats to the 3' ends of chromo- al. 1992). somes (for review, see Blackburn 1992}. This elongation There is a second class of telomere proteins, whose reaction presumably balances the gradual loss of termi- members specifically bind telomere termini. In the hy- potrichous ciliates Oxytricha and Euplotes, such factors encapsulate the abundant telomeres in macronuclear 1Present address: Section for Genetics, Duke University, Durham, North Carolina 27710 USA. DNA and protect DNA ends from exonuclease action 2Corresponding author. (Lipps et al. 1982; Gottschling and Cech 1984; GENES & DEVELOPMENT 7:883-894 9 1993 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/93 $5.00 883 Downloaded from genesdev.cshlp.org on October 9, 2021 - Published by Cold Spring Harbor Laboratory Press Cardenas et al. Gottschling and Zakian 1986; Price 1990). These telo- mini. We describe a factor from Xenopus laevis eggs that meric proteins associate with the single-stranded telo- binds in vitro to terminal TTAGGG repeats in a 3' over- meric TTTTGGGG repeats that protrude 3' from the hang. chromosome ends in these ciliates, resulting in a tena- cious noncovalent complex that is resistant to high salt (Klobutcher et al. 1981; Gottschling and Zakian 1986; Results Price and Cech 1987; Raghuraman et al. 1989; Price Identification of XTEF in Xenopus egg extracts 1990). Although this terminal complex appears to be a conserved feature of telomere termini in hypotrichous On the assumption that the terminal structure of verte- ciliates (Price 1990; Fang and Cech 1991; Wang et al. brate telomeres features a 3' extension, we synthesized a 1992), telomere capping factors have not been demon- DNA probe [putative telomere end (PTE); see Table 1] strated in other eukaryotes. with two double-stranded TTAGGG repeats and a 3' pro- The telomeres of all vertebrate animals, including trusion of the sequence (TTAGGG)2. At the other end, mammals, reptiles, amphibia, birds, and fish, contain PTE contains a non-TTAGGG duplex region for proper long arrays of tandem TTAGGG repeats in the DNA alignment and a 3' gap to allow labeling with Klenow strand, which runs 3' to the chromosome end [Moyzis et enzyme. Using PTE as a probe and S-100 extract from al. 1988; Meyne et al. 1989; Brown et al. 1990; de Lange Xenopus eggs as a source of DNA-binding factors, we et al. 1990). These repeats are considered sufficient for detect a specific electrophoretic mobility retardation telomere function in vertebrate cells on the basis of their complex that is competed by a 50-fold molar excess of involvement in telomere synthesis in mammalian cells unlabeled PTE (Fig. 1). We refer to this activity as Xeno- (Morin 1989, 1991; Wilkie et al. 1990; Farr et al. 1991) pus telomere end factor (XTEF]. The XTEF complex is and on the basis of the conservation of telomeric DNA. not diminished by the addition of 5 ~g of several types of Although the protein components of vertebrate telom- nonspecific competitor DNAs, including double- eres are as yet undetermined, preliminary observations stranded and single-stranded Escherichia coli DNA, point to the presence of a specialized nucleoprotein com- HeLa cytoplasmic RNA, and yeast tRNA (data not plex. In human interphase nuclei, the telomeric shown). No PTE-binding activity is detected when the TTAGGG repeats are attached to the nuclear matrix, reactions are treated with proteinase K prior to gel elec- suggesting an interaction with nonhistone proteins (de trophoresis (data not shown), indicating that XTEF con- Lange 1992). In addition, we have identified a nuclear tains a proteinaceous component. factor (TRF) in mammalian cell lines that specifically In addition to a specific complex, PTE and other probes binds long arrays of double-stranded TTAGGG repeats used in this study form several complexes that result independent of the proximity of a DNA end (Zhong et al. from nonspecific interactions. These additional com- 1992}. Here, we extend our search for vertebrate telo- plexes are not affected by the addition of a 50-fold molar mere proteins to factors that interact with telomere ter- excess of unlabeled PTE (Fig. 1), and their appearance is Table 1. XTEF binds DNAs with TTAGGG repeats in a 3' overhang DNA a Complexb Competitionc Putativetelomereend AAAACTCGACTTAGGGTTAGGGTTAGGGTTAGGG 3' + + ***TGAGCTGAATCCCAATCCC Random duplex AAAACTCGACTAGTGCATCGACTTAGGGTTAGGG 3' + + ***TGAGCTGATCACGTAGCTG (GGGTTAI2tail AAAACTCGACTTAGGGTTAGGGGGGTTAGGGTTA 3' + + ***TGAGCTGAATCCCAATCCC (AAAGGGJztail AAAACTCGACTTAGGGTTAGGGAAAGGGAAAGGG 3' • • ***TGAGCTGAATCCCAATCCC [TTTGGG)2tail AAAACTCGACTTAGGGTTAGGGTTTGGGTTTGGG 3' • • ***TGAGCTGAATCCCAATCCC (TTACCCJ2tail AAAACTCGACTTAGGGTTAGGGTTACCCTTACCC 3' - - ***TGAGCTGAATCCCAATCCC Randomtail AAAACTCGACTTAGGGTTAGGGTAGTGCATCGAC 3' - - **'TGAGCTGAATCCCAATCCC Duplex{TrAGGG)4 AAAACTCGACTTAGGGTTAGGGTTAGGGTTAGGG 3' - - ***TGAGCTGAATCCCAATCCCAATCCCAATCCC a(, ) Positions of radiolabeled thymidine residues in DNA probes. bDNA probes were tested for complex formation with XTEF by electrophoretic mobility shift assay {see Figs. 2 and 3). [ + ) Efficient XTEF complex formation; (-+) severely reduced complex formation with XTEF; l-I no detectable complex formed. CFor competition analysis, unlabeled DNAs were tested for their ability to compete with the putative telomere end probe for complex formation with XTEF. {+) <5% residual complex at 50-fold molar ratio competitor/probe; (--} 20-50% residual complex at S0-fold molar ratio competitor/probe; {-) >50% residual complex at 50-fold molar ratio competitor/probe.