Using Prophylactics to Improve Resistance Against Enterobacteriaceae in Chickens

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2021

Using prophylactics to improve resistance against Enterobacteriaceae in chickens

Graham Redweik Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd

Recommended Citation Redweik, Graham, "Using prophylactics to improve resistance against Enterobacteriaceae in chickens" (2021). Graduate Theses and Dissertations. 18597. https://lib.dr.iastate.edu/etd/18597

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Using prophylactics to improve resistance against Enterobacteriaceae in chickens

Graham Antony Joseph Redweik

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Microbiology

Program of Study Committee: Melha Mellata, Major Professor Elizabeth Bobeck Susan Lamont Kevin Schalinske Stephan Schmitz-Esser Michael Wannemuehler

The student author, whose presentation of the scholarship herein was approved by the program of study committee, is solely responsible for the content of this thesis. The Graduate College will ensure this thesis is globally accessible and will not permit alterations after a degree is conferred.

Iowa State University

Ames, Iowa

2021

DEDICATION

I would not be where I am without my late grandfather, Bob Dillman. You were, and con- tinue to be, one of my greatest motivators. Thus, this work is in memoriam to you.

iii

TABLE OF CONTENTS

Page

DEDICATION ...... ii

TABLE OF CONTENTS ...... iii

NOMENCLATURE ...... vii

ACKNOWLEDGMENTS ...... xiii

ABSTRACT ...... xv

CHAPTER 1. GENERAL INTRODUCTION ...... 1 Background ...... 1 Host Factors Affecting Intestinal Enterobacteriaceae Colonization in Chickens ...... 3 Live Bacterial Vaccines Improve Chicken Responses against Bacterial Pathogens ...... 6 Probiotics Improve Chicken Health through Numerous Mechanisms ...... 7 Knowledge Gaps and Limitations for Probiotics and Live Bacterial Vaccines in Poultry ...... 9 Summary Statement and Organization for Thesis Research ...... 12 References ...... 13 Figure ...... 23

CHAPTER 2. ORAL TREATMENTS WITH PROBIOTICS AND LIVE SALMONELLA VACCINE INDUCE CHANGES IN GUT NEUROCHEMICALS AND MICROBIOME IN CHICKENS...... 24 Abstract ...... 24 Introduction ...... 25 Materials and Methods ...... 26 Ethics Statement and General Conditions ...... 26 In vivo Experiments ...... 27 Vaccine Preparation and Immunization ...... 27 Sample Collection ...... 28 Ultra-High Pressure Liquid Chromatography ...... 29 DNA Isolation and Microbiome 16S rRNA Sequencing ...... 29 IgA Titers Measured by ELISA ...... 30 Statistical Analysis ...... 31 Results ...... 31 Catecholamine, but Not Serotonin Metabolism, Was Altered in Treatment-Specific Manner...... 31 Ceca Microbiome Diversity Changed by Treatment ...... 32 Specific Microbial Abundances Are Influenced by Live Prophylactics ...... 33 Enterobacteriaceae Antigen-Specific IgA Positively Associated with Enterobacteriaceae Levels ...... 34 Certain Bacteria Positively Correlated with Specific Neurochemical Metabolites ...... 34 Discussion ...... 35 iv

Chicken Ceca Is a Major Site for Neurochemical Metabolism, Although Only Catecholamines Were Affected by Treatments ...... 35 RASV Causes Major Rift in Gut Microbiome Diversity ...... 36 Certain Gut Bacteria Were Correlated with Neurochemical Metabolites ...... 37 Ceca Enterobacteriaceae Levels Associated with Intestinal IgA Levels ...... 39 Conclusion ...... 40 Data availability statement ...... 40 Author Contributions ...... 40 References ...... 41 Figures and Tables ...... 46

CHAPTER 3. EVALUATION OF LIVE BACTERIAL PROPHYLACTICS TO DECREASE INCF PLASMID TRANSFER IN CHICKEN GUT AND ASSOCIATION WITH INTESTINAL SMALL RNAS...... 59 Abstract ...... 59 Introduction ...... 60 Materials and Methods ...... 61 Ethics Statement ...... 61 Experimental Design and Sample Sizes ...... 62 Phenotypic and Genotypic Assays ...... 62 Ceca smRNA Extraction and Quantification ...... 64 Inter-E. coli Conjugation-smRNA Assays ...... 64 RNAHybrid miRNA Target Predictions ...... 65 miRNA RT-qPCR and Mimic in vitro Assays ...... 66 Statistical Analyses and Binary Heatmap Development ...... 66 Results ...... 67 Fecal E. coli from P+V Group Exhibited Absence in IncFIB+ ColV+ Plasmids, Virulence Genes, and Phenotype...... 67 Lack of Large Plasmids in Isolates Is Associated with Decreased Ceca smRNA Concentration ...... 67 Greater Ceca smRNA Concentrations Increased in vitro IncF Plasmid Transfer Between E. coli Mating Pairs ...... 68 Host miRNA Species Predicted to Target pAPEC-O2-R Genes ...... 69 Discussion ...... 69 Data Availability Statement ...... 72 Author Contributions ...... 73 References ...... 73 Figures and Tables ...... 78

CHAPTER 4. PROTECTION AGAINST AVIAN PATHOGENIC ESCHERICHIA COLI AND SALMONELLA KENTUCKY EXHIBITED IN CHICKENS GIVEN BOTH PROBIOTICS AND LIVE SALMONELLA VACCINE ...... 87 Abstract ...... 87 Introduction ...... 88 Materials and Methods ...... 89 Ethics Statement ...... 89 Chicken Treatment Groups ...... 90 v

Bacterial Strains ...... 90 Immunization...... 91 IgY Titers Measured by ELISA ...... 91 Whole-Blood Bactericidal Assay ...... 92 Serum Bactericidal Assay ...... 93 In Vivo Bacterial Challenges ...... 93 Statistical Analysis ...... 94 Results ...... 95 Specific and Nonspecific IgY Responses in Serum ...... 95 Bactericidal Ability Against Multiple APEC Strains In Vitro ...... 95 In Vivo Protection Against APEC Challenge ...... 96 In Vivo Protection Against S. Kentucky CVM29188 ...... 97 Discussion ...... 97 Acknowledgments ...... 101 References ...... 101 Figures and Tables ...... 108

CHAPTER 5. ORAL TREATMENT WITH ILEAL SPORES TRIGGERS IMMUNOMETABOLIC SHIFTS IN CHICKEN GUT...... 116 Abstract ...... 116 Introduction ...... 117 Materials and Methods ...... 119 Ethics Statement ...... 119 Inoculum Preparation ...... 119 16S rRNA Sequencing and Analysis...... 120 Spore Imaging ...... 120 Chicken Treatment ...... 121 PCR ...... 121 Gut Permeability...... 122 Measuring Lengths of Intestinal Segments ...... 122 Scanning Electron Microscopy of the Distal Ileum ...... 122 Analyses of Paraffin-Embedded Ileo-Ceco-Colic Junction ...... 123 Bactericidal Assays Against Salmonella ...... 123 Small Intestinal Total IgA ...... 124 Chicken-Specific Immunometabolic Kinome Peptide Array ...... 124 Statistical Analyses...... 125 Results ...... 126 Chloroform-Treated ISs Enhanced Spore Enrichment ...... 126 SFB Colonize Gut at Much-Earlier Age in SPORE Birds ...... 126 SPORE Birds Had Reduced Weight Gain and Gut Permeability ...... 127 SPORE SISs in vitro Salmonella Killing Was Time-Dependent and IgA Independent .. 128 Several Immune and Metabolic Pathways Were Globally Altered in SPORE Birds ...... 128 Discussion ...... 131 Conclusion ...... 137 Data Availability Statement ...... 137 Author Contributions ...... 138 Acknowledgments ...... 138 vi

References ...... 138 Figures and Tables ...... 145

CHAPTER 6. RESERPINE IMPROVES ENTEROBACTERIACEAE RESISTANCE IN CHICKEN INTESTINE VIA NEURO-IMMUNOMETABOLIC SIGNALING AND MEK1/2 ACTIVATION ...... 156 Abstract ...... 156 Introduction ...... 157 Results ...... 159 Reserpine treatment induces norepinephrine release from intestinal explants and CD4+CD25+ cells...... 159 Reserpine treatment increases Salmonella resistance in ex vivo and in vivo conditions .. 159 Reserpine treatment increases antimicrobial peptide expression while decreasing CTLA-4 expression ...... 160 Reserpine-treated explants undergo massive immunometabolic shifts ...... 160 MEK1/2 signaling plays a central role in reserpine-induced antimicrobial responses .... 162 Discussion ...... 162 Materials and Methods ...... 167 Ethics statement ...... 167 Ceca explant model and treatment ...... 167 Ultra-high pressure liquid chromatography ...... 168 Intestinal lymphocyte extraction and flow cytometry ...... 168 Bactericidal assays against Salmonella ...... 169 In vivo reserpine treatment and Salmonella challenge ...... 169 Intestinal pathology scoring ...... 170 RT-qPCR ...... 170 Chicken-Specific Immunometabolic Kinome Peptide Array ...... 170 Statistical analyses ...... 171 Data Availability Statement ...... 171 Acknowledgements ...... 171 References ...... 172 Figures and Tables ...... 177

CHAPTER 7. GENERAL CONCLUSION ...... 185 Summary ...... 185 Conclusion ...... 190 References ...... 191 vii

NOMENCLATURE

AGR Aminoglycoside resistance

Akt Protein kinase B

AMR Antimicrobial resistance

AMP Antimicrobial peptide

AMPK 5'-adenosine monophosphate-activated protein kinase

AP Alkaline phosphatase

ATP Adenosine trisphosphate

APEC Avian Pathogenic Escherichia coli

BD-12 Beta defensin 12

BD-14 Beta defensin 14

BSA Bovine serum albumin

CAR Chloramphenicol resistance cDNA Clonal DNA

CD4 Cluster of differentiation 4

CD8 Cluster of differentiation 8

CD25 Cluster of differentiation 25

CD28 Cluster of differentiation 28

CFU Colony forming unit

ColV Colicin V

CON Non-treated controls

CO2 Carbon dioxide

CPR Cephalosporin resistance viii

CTLA4 Cytotoxic T lymphocyte antigen 4

DHMA 3,4-dihydroxymandelic acid

DNA Deoxyribonucleic acid

DOPAC 3,4-dihydroxyphenylacetic acid dpi Days post-inoculation dph Days post-hatch dsDNA Double-stranded DNA

EGF Epidermal growth factor

EGFR Epidermal growth factor receptor

ELISA Enzyme linked immunosorbent assay

ExPEC Extraintestinal pathogenic Escherichia coli

FITC-d Fluorescein isothiocyanate dextran

GABA Gamma-aminobutryic acid

GALT Gut associated lymphoid tissue

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GI Gastrointestinal hylF Hemolysin F gene

HDP Host defense peptide

HIF-1α Hypoxia-inducible factor-1α

HVA Homovanillic acid

H&E Hematoxylin and eosin

H+L Heavy and light chain

IgA Immunoglobulin A ix

IgY Immunoglobulin Y

IL-2 Interleukin 2

IL-10 Interleukin 10

IncF Incompatibility plasmid group F

IncI Incompatibility plasmid group I

IncY Incompatibility plasmid group Y

IncN Incompatibility plasmid group N

IroN Salmochelin receptor iss Increased serum survival gene

IutA Aerobactin receptor

JAK Janus kinase

KEGG Kyoto Encyclopedia of Genes and Genomes

L-DOPA L-3,4-dihydroxyphenylalanine

LAB Lactic acid producing bacteria

LB Luria Bertani

LPS Lipopolysaccharide

MAPK Mitogen associated protein kinase

MAPKK Mitogen associated protein kinase kinase

MEK1/2 Mitogen associated protein kinase kinases 1/2

MFE Minimum free energy miRNA MicroRNA mTOR Mammalian target of rapamycin

NAR Nalidixic acid resistance x

NaOH Sodium hydroxide

NF-κB Nuclear factor kappa-light-chain-enhancer of activated B cells

NK Natural killer

NOD Nucleotide-binding oligomerization domain

ON Overnight

OTU Operational taxonomic unit

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PCoA Principial coordinate analysis

PD Phylogenetic diversity

PIIKA2 Platform for Intelligent, Integrated Kinome Analysis, version 2

PI3K Phosphoinositide 3-kinase pmi Phosphomannose isomerase gene

PNPP Para-Nitrophenylphosphate

PRO Probiotics-only group

PRR Pattern recognition receptor

P+V Probiotics + live Salmonella vaccine group

QseC Quorum sensing sensor kinase

RASV Recombinant attenuated Salmonella vaccine

RNA Ribonucleic acid rRNA Ribosomal RNA

RT Room temperature xi

RT-qPCR Reverse transcriptase quantitative PCR

SBM Soybean meal

SCFA Short chain fatty acid

SDS Sodium dodecyl sulfate

SEM Scanning electron microscope

SFB Segmented filamentous bacteria

SISs Small intestinal scrapings smRNA Small RNA

SPORE Ileal spores group

SRA Sequence read archive

STAT Signal transducer and activator of transcription protein

STRING Search Tool for the Retrieval of Interacting Genes/Proteins

SUR Sulfanomide resistance

TAE Tris-acetate-EDTA

TBE Tris-borate-EDTA

TCR T cell receptor

TCR Tetracycline resistance

TC-S Tetracycline-streptomycin

TEM Transmission electron microscope

TLR Toll-like receptor

TH17 T helper 17 cell

TNF Tumor necrosis factor xii

Treg Regulatory T cell

QIIME2 Quantitative Insights into Microbial Ecology, version 2

UHPLC-ED Ultrahigh-performance liquid chromatography with electrochemical detection

VAX Live Salmonella only group

Wnt Wingless-related integration site uidA Beta-glucuronidase gene

5-HIAA 5-hydroxyindoleacetic

xiii

ACKNOWLEDGMENTS

The research presented in this dissertation was made possible through the cumulative support and advice I received from collaborators, faculty, mentors, fellow graduate students, friends, and family, whose encouraging words I appreciate and whose remarkable talents I emu- late. My foremost gratitude goes to my advisor Dr. Melha Mellata, who gave me the tools and unwavering support to become a successful scientist. From where I started my first semester to where I am now, my intellectual and professional growth has been seemingly exponential, and I have you to thank for that. Additionally, I want to thank my current lab members and fellow graduate students Logan Ott and Jared Jochum. You each have so much potential and natural tal- ent in research, and it has truly been a privilege to work alongside you both. Although both previous postdocs have since moved on from the Mellata lab, I want to thank Drs. Angelica Van

Goor and Zachary Stromberg for helping me acclimate into a new lab environment and understand fundamental skills crucial for basic research. More specifically, I want to thank Dr. Strom- berg for his mentorship; you played a large part in my development and served as a role model for the type of researcher I wanted to become. To my undergraduate mentees (Mary Kate Horak,

Ryley Hoven, Sasha Celada, Jack Peterson, Shelby Thomas, Lacy Moon, Mary Horger, Daniel

Burdick): you all made my time at Iowa State so enjoyable and directly contributed to this work, be it through experimental assistance or thoughtful suggestions.

To the faculty and staff in the Iowa State community, I want to primarily thank my POSC committee members (Dr. Michael Wannemuehler, Dr. Stephan Schmitz-Esser, Dr. Susan La- mont, Dr. Elizabeth Bobeck, and Dr. Kevin Schalinske) for all of your advice, criticisms, and suggestions to my thesis work. Your overall input has been greatly appreciated and has drastically improved my development as a scientist. For help with my animal experiments, I want to xiv thank the Laboratory Animal Resources staff, specifically Molly Crabbs and Dean Isaacson for your immense efforts in making these projects as successful as possible. I want to thank Tracey

Stewart at the microscopy facility for your help in collecting TEM and SEM images as well as training me to use those microscopes. Thank you to Dr. Shawn Rigby for your advice in design- ing my flow cytometry experiments and performing the cell sorting. Thank you to the staff at the

DNA facility (Dr. Michael Baker, Tanya Murtha) and Genome Informatic facility (Drs. Andrew

Severin and Maryam Sayadi) for your help in 16S rRNA sequencing and analyses, respectively.

Thank you to Dr. Mark Lyte and Karrie Daniels for your help in neurochemical detection experiments; your collaboration has been incredibly valuable in producing very exciting data for multiple manuscripts. To collaborators Drs. Mike Kogut and Ryan Arsenault, thank you for your crucial help in providing your chicken immunometabolic kinome peptide array expertise for my thesis work. This highly unique technology has opened so many doors for improving our understanding of the biological processes occurring in our studies.

To my closest friends Jeremy Gonzalez, Mary Kate Horak, Jared Jochum, Steven Peters,

Zach Johnson, Maggie Daily, and Lydia Greene, as well as my numerous other friends: I am so grateful for your friendships. Through the highs and lows, you have always been by my side, and

I will always remember that kindness. Finally, this work would not be possible without my par- ents Lora and David Redweik for giving me the motivation to pursue any and all of my aspira- tions. To my older sibling Garrett, I look up to you even still, and I am so lucky to have you as an older brother. Lastly, to my nephew Lennox, although I have spent the vast majority of your life in graduate school, being able to see you during breaks and holidays was always my favorite part of coming home. You mean the world to me. xv

ABSTRACT

Poultry are a critical source of human nutrition, with over 100 million tons of chicken meat being produced globally per year and over 521 million eggs produced in the United States alone. However, poultrylike chickens serve as major reservoirs for bacterial Enterobacteriaceae pathogens like Salmonella and Escherichia coli, which can cause disease in poultry and/or humans via contamination of poultry food products. Furthermore, these Enterobacteriaceae are major reservoirs for antimicrobial resistance (AMR), which is primarily spread through inter- bacterial exchange of large virulence plasmids. Thus, being able to reduce Enterobacteriaceae in poultry and mitigate AMR spread would simultaneously improve poultry and human health.

Prophylactic strategies including probiotics and live Salmonella vaccines have individually demonstrated efficacy in reducing Enterobacteriaceae in poultry. However, whether the combination of these live prophylactics produces even greater success (or failure) has yet to be determined. Furthermore, although many commercial probiotics boast a wide number of benefits to poultry productivity (improved feed conversion, pathogen competitive exclusion, inflammation reduction, etc), they induce poor host antimicrobial responses against enteric pathogens. Further- more, some bacteria like Salmonella actively promote immunotolerance in the chicken gut, which prevents antibacterial host responses and subsequently results in fecal Salmonella shedding and contamination of poultry products. Thus, novel prophylactics which can stimulate host intestinal responses and overcome these immunotolerant mechanisms to clear intestinal Entero- bacteriaceae like Salmonella are needed for poultry. Overall, the objective of these studies was to determine whether prophylactics (i.e., probiotics, live Salmonella vaccine, ileal spores, or reserpine) could mitigate Enterobacteriaceae activities in poultry. xvi

In the first study of this thesis, we explored whether the combinatorial use of a commercial probiotic mix (Gro-2-Max®) and live Salmonella vaccine (Typhimurium strain) in white leghorn chickens would have superior effects against Enterobacteriaceae intestinal colonization.

Birds were received at day-of-hatch and continuously fed probiotics in feed (PRO), orally vaccinated with a live Salmonella vaccine (VAX), given both prophylactics (P+V), or untreated

(CON). Using 16S rRNA sequencing and fecal enumeration on MacConkey agar, Enterobacteri- aceae ceca abundances and fecal shedding were greatest in PRO birds but was significantly reduced upon Salmonella vaccination, regardless of probiotic supplementation. These changes were positively associated with shifts in fermentative bacterial abundances, supporting the “restaurant hypothesis” in which Enterobacteriaceae rely on fermentative microbes for mono- and disaccharide nutrients. Given the relationship between gut bacteria and neurochemical production, we hypothesized these live prophylactics induced changes in intestinal neurochemistry.

Measuring neurochemical levels via UHPLC-ED, prophylactic treatments induced unique changes in catecholamine metabolism in the chicken intestine. Furthermore, these changes were positively correlated with intestinal bacteria like Enterobacteriaceae and Akkermansia muciniphila. Overall, these live prophylactics induce changes in both neurochemical metabolism and microbial abundances in the chicken intestine, which likely contributed to the loss of Enterobac- teriaceae upon Salmonella vaccination.

In the second study to determine if these live prophylactics affected E. coli virulence potential from the intestine, a reservoir for pathogens like avian pathogenic E. coli (APEC), ~100

E. coli colonies from each group were isolated and individually screened them for siderophore production, antibiotic resistance, and genotype via PCR. Uniquely, P+V isolates produced significantly less siderophores, were more susceptible to the antibiotics tetracycline and streptomycin, xvii and lacked several APEC virulence factors (iutA¸ iss, hylfA) compared to isolates from all other treatment groups. This loss of virulence potential in P+V E. coli was associated with the absence of IncF and ColV plasmids as well as a loss of total average plasmids per isolate, suggesting that intestinal plasmid transfer may have been reduced in P+V birds. En route to identifying a factor responsible for this observation, ceca mucus total small RNA (smRNA) levels were lowest in

P+V birds versus all other groups. Hypothesizing that smRNA concentration was positively associated with IncF plasmid transfer, greater smRNA levels increased IncF plasmid-mediated

AMR transfer in vitro, regardless of treatment group. Furthermore, using predictive hybridization analyses, multiple chicken microRNAs (miRNAs), a subset of smRNAs, were aligned with plasmidic genes associated with pilus assembly and plasmid transfer, suggesting that certain smR-

NAs may drive plasmid transfer. These data identify the combination of probiotics and live Sal- monella vaccine as a unique in vivo strategy to mitigate intestinal IncF plasmid transfer and spread of AMR and virulence genes via a smRNA-dependent mechanism.

Although Enterobacteriaceae are mainly associated with the intestinal tract, certain members like APEC can bypass host barriers and enter the bloodstream, resulting in avian colibacillosis and high mortality. In the third study, to determine if these live prophylactics affect

APEC resistance, blood from P+V birds exhibited greater bactericidal responses against APEC versus CON. However, these responses were independent of IgY antibody response, suggesting that killing from innate immune cells were stimulated upon P+V treatment. Using an airsac-challenge model for APEC in vivo infection, P+V treatment reduced colibacillosis lesions as well as

APEC enumeration in the blood compared to CON birds. Overall, in addition to intestinal Enter- xviii obacteriaceae resistance, P+V treatment induces extraintestinal protection against APEC infection, meaning that these orally-delivered prophylactics can confer benefits outside of the chicken intestine.

Given that probiotics poorly induce poor immunological responses in the chicken intestine, in the fourth study day-old white leghorn chicks were inoculated with a single dose of ileal spores (SPORE) and compared them to untreated controls (CON). Using scanning electron microscopy (SEM) SPORE treatment hastened the rate and consistency of SFB attachment in the ileum, with birds as young as 4 days old exhibiting SFB colonization. Using FITC-dextran to measure gut permeability, SPORE birds exhibited reduced gut leakiness versus CON. To determine immunometabolic shifts in the ileum, the chicken kinome peptide array was used to measure global changes in phosphorylation networks. Generally, SPORE treatment induced drastic shifts in host immunometabolism. Furthermore, these changes were associated with Salmonella resistance, as TH17 cell differentiation was positively associated with in vitro killing of several

Salmonella serovars. Overall, we find that a single dose of an ileal spore inoculum was sufficient to induce drastic changes in intestinal immunometabolism and may be an effective strategy to increase Salmonella resistance.

In the final study, to investigate the role of the neuroimmunological axis in Salmonella resistance, we developed an ex vivo ceca explant model to use reserpine, which induces intracellular catecholamine release, as a novel prophylactic. As expected, reserpine treatment induces norepinephrine release from chicken ceca explants and regulatory T cells (Tregs). Furthermore, media supernatants from explant cultures treated with reserpine induced increased antimicrobial responses as well as Salmonella killing compared to untreated explants. Using an in vivo chal- xix lenge model, oral reserpine treatment increased total Enterobacteriaceae and Salmonella Typhi- murium resistance in young birds. Using the immunometabolic kinome peptide array, changes in

T cell receptor, epidermal growth factor (EGF), and mTOR signaling were all induced by reserpine treatment. More specifically, EGF receptor (EGFR), the mTOR protein, and the MAPKK

MEK2 were all differentially phosphorylated. Using various ligands and inhibitors to determine the role of these pathways, norepinephrine stimulated Salmonella killing in a dose-dependent mechanism. Furthermore, inhibition of beta-adrenergic receptors as well as recombinant EGF suppressed reserpine-induced Salmonella resistance. Furthermore, explant treatment with rapamycin, an mTOR inhibitor, increased Salmonella killing similar to reserpine treatment. Lastly, we found that MEK1/2 signaling was central to antimicrobial responses induced by these neuro- immunometabolic pathways. Overall, this demonstrates a fundamental role for the neuroimmunological axis in Salmonella killing and suggests that reserpine could be a novel prophylactic to improve Salmonella resistance in young birds.

The studies described in this dissertation identify multiple prophylactics which improve

Enterobacteriaceae resistance in poultry. Future studies are needed to determine whether these strategies can be used in combination as well as changes in specific factors alone (ex: shifts in the gut microbiota and neurochemicals) are sufficient to induce anti-Enterobacteriaceae responses.

CHAPTER 1. GENERAL INTRODUCTION

Modified from a manuscript published in Frontiers in Veterinary Science

Live Bacterial Prophylactics in Modern Poultry

Graham A.J. Redweika,b, Jared Jochuma,b, and Melha Mellataa,b

aDepartment of Food Science and Human Nutrition, Iowa State University, Ames, IA, USA bInterdepartmental Microbiology Graduate Program, Iowa State University, Ames, IA, USA

Background

Poultry like layers and broilers are some of the most critical food animals, with over 100 million tons of chicken meat being produced globally per year (1) and 521 million eggs produced in the United States (2). Over the years, poultry have been domesticated to maximize particular functions like meat and egg production. Although selecting for greater weight gain and egg-laying rates has improved poultry productivity, specific selection for bacterial disease resistance has not been pursued as diligently. This is problematic, as poultry are becoming increasingly at-risk for bacterial infections given the push for cage-free and antibiotic free rearing (3). Furthermore, poultry serve as major reservoirs for bacterial pathogens, which can cause diseases in poultry and humans via contamination of poultry food products. Some of the most dangerous pathogens that threaten human and poultry health (i.e., Salmonella enterica and Escherichia coli) are members of the bacterial gram-negative family Enterobacteriaceae, which constitute a significant reservoir of antimicrobial resistance (AMR) genes (4). Thus, being able to reduce pathogenic and

AMR Enterobacteriaceae in poultry would simultaneously improve poultry productivity as well as human health. 2

Non-typhoidal Salmonella enterica are the causal agents of salmonellosis, a form of gastrointestinal enteritis in humans, and S. enterica is one of the most prominent foodborne pathogens globally (5,6). Notably, the chicken gut is a reservoir for non-typhoidal Salmonella colonization and dissemination (7). Broad host Salmonella serovars can persist for weeks in the chicken gut by restructuring the host microenvironment to become more immunotolerant via an increase in regulatory T cells (Tregs), which suppress inflammatory responses that would otherwise clear Salmonella from the intestine (8, 9). Birds that exhibit this “persister” phenotype serve as asymptomatic shedders of Salmonella, resulting in the fecal spread of Salmonella onto poultry products like meat and eggs (10, 11). Because the persistence of Salmonella in the chicken gut is asymptomatic, it is challenging to distinguish Salmonella-infected birds from those who are non-infected, which poses a major problem for poultry producers. Thus, a prophylactic strategy that can proactively prevent or reduce Salmonella in the gut is ideal for mitigating poultry product contamination.

E. coli is major pathogen for chicken and another potential etiological foodborne pathogen of the Enterobacteriaceae family that spreads from chickens to humans (12). Similar to Sal- monella, non-pathogenic and pathogenic E. coli alike colonize the chicken gut asymptomatically, constituting a major member of the commensal microbiota in birds (13, 14). However, fecal contamination of poultry products can facilitate E. coli infection in chicken and zoonosis potential from chickens to humans. These virulent E. coli isolates from poultry are typically categorized in the extraintestinal pathogenic E. coli (ExPEC) pathotype and cause highly-lethal human patholo- gies like sepsis, urinary tract infections, and meningitis (15). A subset of ExPEC, avian pathogenic E. coli (APEC) share several virulence traits found in human ExPEC isolates but infect birds, causing septicemia, airsacculitis, and pericarditis, collectively known as colibacillosis (15). 3

To initiate this pathogenesis in poultry, APEC from feces becomes aerosolized and inhaled by these birds, translocating across the lung epithelium to thereafter invade host tissues via blood circulation (15-17). Both human and avian ExPEC cause high mortality rates in humans and poultry, respectively, making them a major threat to both human and animal health (15). Thus, a treatment strategy that can reduce both intestinal E. coli and risk of colibacillosis in poultry would be extremely useful to mitigate diseases.

As mentioned above, AMR in pathogenic Enterobacteriaceae is a major concern, due to the inability to treat bacterial infections with antibiotics, which would be devastating to poultry and human health (18). Notably, non-typhoidal Salmonella and ExPEC are major reservoirs for

AMR genes, typically being carried on large and mobile virulence plasmids (19, 20). These plasmids are often horizontally transferred between pathogenic and commensal Enterobacteriaceae by conjugation, and both Salmonella and APEC can serve as plasmid donors (20, 21). This conjugal transfer of AMR and virulence factors to other bacteria directly contributes to the emergence of AMR bacterial pathogens, which threatens poultry and human health alike (22). Im- portantly, this transfer occurs primarily in the intestinal tract, more specifically the mucus layer

(23). Thus, treatments directed for the intestinal tract which can boost resistance to pathogenic and AMR Enterobacteriaceae are crucial for optimizing both poultry health and food safety for human consumers.

Host Factors Affecting Intestinal Enterobacteriaceae Colonization in Chickens

Although Enterobacteriaceae like E. coli and Salmonella are commonly viewed as harmful bacteria, they generally reside as non-pathological commensals in the chicken intestine (8, 13,

14). Several factors may contribute to this asymptomatic colonization. Like mammals, chickens 4 express Toll-like receptor 4 (TLR4), which detects the highly conserved lipid A motif in lipopolysaccharide (LPS), the major component of the gram-negative bacterial envelope. Mammalian

TLR4 activation can occur via MyD88-dependent or independent pathways (24). However, chickens lack an ortholog for TRAM, the adaptor protein necessary for MyD88-independent

TLR4 activation (25). Thus, chicken TLR4 activation is entirely MyD88-dependent, and this likely contributes to the poor LPS sensistivity by chicken TLR4 compared to its mammalian counterpart (25). Overall, this implies that chickens are innately less responsive to intestinal Sal- monella and other gram-negative bacteria of the Enterobacteriaceae family.

Another major difference between mammals and chickens is the anatomy of their respective intestinal tracts (see Figure 1-1). The mammalian stomach, which under homeostatic conditions is maintained at a very low pH (< 4), functions to store and digest solid foods simultaneously. Conversely, the chicken gastrointestinal (GI) tract does not possess a traditional stomach and instead uses a crop and gizzard to facilitate food storage and mechanical breakdown, respectively. Additionally, the avian proventiculus, a homolog of the mammalian stomach, is located between the crop and gizzard. Although the proventiculus secretes hydrocholoric acid and digestive enzymes into the lumen, intestinal contents quickly pass through this region into the gizzard, suggesting that exposure to these chemicals is relatively brief compared to the mammalian stomach. This is an important distinction, as chronic exposure to low pH can stimulate Enterobacteri- aceae growth (26). Enterobacteriaceae passing through the chicken intestine may not proliferate to the same extent as in mammals given they are not exposed to the same acidic conditions.

Thus, these bacteria may be less likely to be detected by the chicken immune system and, subsequently, avoid inflammatory responses which might impede their intestinal colonization. 5

In mammals, the stomach passes material directly to the small intestine, which is the primary site for digestive enzyme activity and nutrient absorption, and it is organized by duodenum, jejunum, and ileum. Luminal contents are then passed to the large intestine, comprised of a relatively small cecum proximal to the colon. Although chickens possess a similar small intestinal organization, the large intestine is notably different in which they possess two large ceca con- nected by the ileo-ceco-colonic junction. Furthermore, the avian colon is much smaller relative to the mammalian colon (Figure 1-1), making the chicken ceca the primary site for fermentation in the intestine versus the colon, which is the primary site for fermentation in mammals (27, 28).

Given the ceca primarily function to store digesta to facilitate bacterial fermentation, the avian ceca are much better suited to promote Enterobacteriaceae colonization, which feed off the mono- and disaccharide by-products of bacterial fermentation (29), versus the mammalian cecum.

The immunological organization in the GI tract is vastly different between birds and mammals. Similar to mammals, chickens have gut-associated lymphoid tissues (GALT), including Peyer’s patches (30) and ceca tonsils (31) which function to sample luminal bacteria and develop adaptive immune responses (32). However, one glaring difference is that birds lack encap- sulated lymph nodes, which are highly complex in their structural organization and contribute to highly-efficient adaptive immune responses against bacterial pathogens (33, 34). Mesenteric lymph nodes in mammals play a crucial role in resistance against Enterobacteriaceae like Sal- monella (35, 36). Thus, the absence of these lymph nodes in chickens may contribute to the inad- equate clearance of Salmonella and potentially other Enterobacteriaceae in poultry via an inability to produce sufficient adaptive, inflammatory responses against these bacteria. 6

Overall, these differences between birds and mammals demonstrate how the physiological peculiarities of the chicken intestine and immune system may facilitate the retention of intestinal Enterobacteriaceae. Thus, targeting these elements (i.e., reducing fermentative bacteria in the ceca, increasing inflammatory responses) through exogenous strategies that overcome these host physiological barriers would theoretically reduce these bacteria. Among the methods currently used to promote productivity in poultry include use of live bacterial vaccines, or attenuated bacteria primarily used to immunize animals against its wild-type pathogen (37), and probiotics, which are live, non-attenuated microbes that confer health benefits to the animal host (38).

Importantly, both have shown to improve chicken responses against bacterial pathogens and confer numerous other health benefits, as will be briefly reviewed below.

Live Bacterial Vaccines Improve Chicken Responses against Bacterial Pathogens

Several commercial live bacterial vaccines, including Pasteurella multocida, Myco- plasma gallisepticum, E. coli, and Salmonella, are available for poultry (see Supplemental File).

However, only live vaccines for E. coli and Salmonella are delivered orally and will therefore be the only vaccines further discussed. The only live E. coli vaccine on the market is Poulvac® E. coli, an O78 lipopolysaccharide (LPS) serotype with aroA (3-phosphoshikimate 1-carboxyvi- nyltransferase) deletion for metabolic attenuation. This vaccine is primarily used to increase protection against APEC, which causes colibacillosis and is a major driver of carcass condemnation in commercial poultry (15). Several studies have shown the success of Poulvac® E. coli against

O78 E. coli challenges (39, 40). However, Poulvac® E. coli does not confer protection against other APEC serotypes like O1 (40), suggesting its protection is primarily-mediated by the O78 7

LPS antigen. There is no evidence that Poulvac® E. coli can protect against several APEC serotypes, a major limitation for its applicability given the high levels of antigenic variability among

APEC strains (41). Furthermore, there is no evidence Poulvac® E. coli can protect against enteric

Salmonella colonization in chickens. Thus, a prophylactic strategy which can simultaneously protect against APEC and Salmonella would be incredibly useful for the poultry industry.

In contrast, there are multiple commercial live Salmonella vaccines available for poultry like Megan® Vac-1, Poulvac® ST (both S. Typhimurium), and Gallivac® SE (S. Enteritidis). All of these oral vaccines induced in vivo broad protection against intestinal colonization by other

Salmonella serovars (42-45). Furthermore, live S. Typhimurium vaccines demonstrated cross- reactive potential against other Enterobacteriaceae like E. coli (46-48). These findings suggest live Salmonella vaccines may improve protection against Salmonella and E. coli intestinal colonization in chickens, which would be extremely useful and economical for the poultry industry.

Probiotics Improve Chicken Health through Numerous Mechanisms

Probiotics are widely used in poultry industry due to their wide range of health benefits, increase in animal productivity, and ease of supplementation in feed. Several microorganisms are used as probiotics, including lactic acid-producing bacteria (LAB; Lactobacillus, Enterococcus,

Pediococcus, etc), spore-forming bacteria (ex: Bacillus subtilis, Bacillus amyloliquefaciens), and yeast (ex: Saccharomyces spp.). LAB are categorized by their ability to produce lactic acid, an organic acid that can directly inhibit pathogenic bacterial growth by pH reduction (49). Lactic acid can also be converted by fermenting intestinal microbes into short chain fatty acids (SCFAs) like butyrate (50), which can then be used by the host to promote intestinal homeostasis via Treg differentiation and increased bactericidal responses in intestinal macrophages (51-53). LAB also secrete digestive enzymes like amylases and proteases to improve feed conversion in poultry 8

(54). Furthermore, commercial poultry probiotics solely containing LAB demonstrate efficacious decreases in Salmonella (55-57) and E. coli (58, 59). However, the mechanisms (be it direct via competitive exclusion or indirect via host stimulation) for in vivo reductions of these Enterobac- teriaceae are unclear.

Similar to LAB, Bacillus spp. secrete a wide array of digestive enzymes and antimicrobial compounds to improve feed efficiency and competitively exclude bacterial pathogens (59-

62). One notable characteristic of Bacillus spp. is their ability to form endospores, which helps protect the organisms from the harmful conditions of the gastrointestinal tract and improves shelf-life for commercial distribution. Commercial Bacillus probiotics have demonstrated a capacity to reduce Salmonella (63) and pathogenic E. coli (64, 65) in poultry. Notably, the latter study found this reduction in E. coli was related to shifts in the gut microbiome, suggesting that

Bacillus can indirectly influence Enterobacteriaceae colonization by inducing population shifts in commensal microbes (65).

Yeasts are eukaryotic organisms that include Saccharomyces cerevisiae (i.e., baker’s yeast) and, similar to LAB and Bacillus spp., secrete antimicrobial factors (66, 67). Additionally,

S. cerevisiae indirectly improve the production of SCFAs via shifts in the intestinal microbiota

(68, 69). However, these microorganisms are typically added into multispecies commercial products like Lavipan® and Gro-2-Max®, making it hard to determine individual contributions of yeast in studies using these probiotic products. However, broilers administered with S. cerevisiae alone at 0.5 g/kg feed reduced intestinal E. coli levels (70), suggesting yeasts have some capacity to reduce Enterobacteriaceae in poultry. Overall, these studies provide support for how probiotics are a feasible strategy for reducing pathogenic Enterobacteriaceae in poultry.

Knowledge Gaps and Limitations for Probiotics and Live Bacterial Vaccines in Poultry

Although probiotics and live bacterial vaccines are combinatorially used in commercial poultry, very little is known about how these combinations might improve or inhibit specific host functions. Most studies evaluate probiotic and live vaccine-efficacy by comparing mono-treated animals versus non-treated controls. While this experimental design is a crucial first-step in identifying the usefulness of an individual prophylactic, this format is not representative of natural commercial conditions and rather ignores the impact other vaccines, probiotics, feed, etc may have on the animals’ response to that prophylactic of-interest. This is of extreme importance, as commercial farms routinely use a wide repertoire of prophylactics (live, inactivated, subunit, etc) on their poultry without knowing how they might improve or nullify each other’s effects.

Probiotics are widely reported to serve as biological vaccine adjuvants (71). However, few studies regarding poultry have investigated the role of probiotics in vaccine-responsiveness.

For example, efficacy and weight gain of a live recombinant Campylobacter vaccine was drastically-improved in broilers which were also given Anaerosporobacter mobilis as a probiotic (72).

The protection against the eukaryotic pathogen Eimeria was highest when a live coccidiosis vaccine was combined with probiotics (73). Additionally, the commercial probiotic Cylactin® also may be a useful vaccine adjuvant, as combining this product with the live Salmonella vaccine

Gallivac® SE increased Salmonella-specific IgA in layers (74). Although these studies support that probiotics enhance vaccine efficacy, it is also feasible that probiotics could exclude live bacterial vaccines from the chicken intestine through the same competitive exclusion mechanisms they use against their non-attenuated, pathogenic counterparts. Thus, understanding the interactions between probiotics and live bacterial vaccines is crucial for determining whether these products should be used together in commercial poultry. 10

Furthermore, the vast majority of studies investigating orally-delivered, live prophylactics in poultry typically focus on parameters like feed intake and conversion, microbiome changes, pathogen resistance, and basic immunological measures like antibody response. How- ever, there are several other mechanisms in which these live microbes could be affecting the host. Gut bacteria play a major role in the maturation of the enteric nervous system (75) and mediate animal behavior via the gut-brain-microbiota axis (76-78). These interactions can be driven by the ability of probiotic microbes (ex: Lactobacillus and Saccharomyces) as well as pathogens like Salmonella and E. coli to directly synthesize and respond-to neurochemicals through a bidi- rectional communication network called microbial endocrinology (79-81). Animal models have demonstrated the ability for probiotics like Lactobacillus and Bifidobacterium (82) as well as C. perfringens (83) to modulate behavior, although only the latter has been shown in chickens.

Thus, it is essential to consider the impact live prophylactics may have on neurochemical metabolism in poultry, as this approach may identify novel, microbial endocrinology-based mechanisms of pathogen resistance. Furthermore, given the impact of neuroimmune communication in intestinal colonization of bacterial pathogens (84), using treatments targeting this pathway may be a feasible strategy for reducing Enterobacteriaceae colonization in poultry.

As mentioned earlier, most studies evaluating these orally-delivered probiotics and live bacterial vaccines look specifically at the intestine for determination of improved health outcomes, given this is physiologically where these live prophylactics would interact with the host. However, similar to the gut-brain-microbiota axis, gut microbes like probiotics can influence other extraintestinal host responses via direct translocation or release of bacterial products into circulation (85). For example, in a biological stressor’s accompaniment, probiotics induce changes in circulatory soluble pattern recognition receptors (PRRs) like haptoglobin, 11 ceruloplasmin, and C-reactive protein in poultry (86-88). Furthermore, probiotics like

Lactobacillus plantarum and Nissle 1917, an E. coli probiotic typically used in humans, increased extraintestinal resistance to APEC in vivo (89, 90). Thus, although these live prophylactics may be given orally, they may induce several changes in host immune responses outside the gut.

Although probiotics have become an integral supplement for poultry (91-93), their use has several limitations. One major caveat of using probiotics is that to maintain efficacy, they must be given frequently to maintain an effect on the host (94). Additionally, although

Enterobacteriaceae like E. coli and Salmonella are major carriers of AMR (95-98), probiotic bacteria have also demonstrated an ability to carry AMR plasmids (99), potentiating them as another reservoir for AMR in poultry. Finally, although probiotics are widely-reported to activate the avian immune response, the usefulness of this probiotic-stimulated immunity against intestinal pathogens is debatable. For example, L. plantarum increased intestinal expression of

TLR4, a host membrane-associated PRR that detects bacterial LPS (100, 101). However, TLR4 expression had no subsequent effect on Salmonella Enteritidis shedding in challenged birds

(102). Furthermore, Enterococcus faecium-treated birds challenged with the foodborne pathogen

Campylobacter jejuni exhibited increased TLR4 and TLR21 ceca expression, but this did not affct C. jejuni load compared to no-treatment controls (103). These findings suggest that although probiotics may increase expression of particular immune receptors, they do not sufficienctly activate the host innate immune system to combat bacterial pathogens. Thus, identifying prophylactics that could avoid these limitations and induce potent, antibacterial immune responses would be useful for the poultry industry. 12

Although not particularly-great at stimulating antibacterial inflammatory responses in the gut, probiotics are well-known for reducing excessive inflammation in the gastrointestinal tract

(104), which would otherwise negatively impact productivity (105, 106) and interfere with normal host processes to clear intestinal Enterobacteriaceae (107). These probiotic-mediated, anti-inflammatory responses are driven by the host’s ability to distinguish commensal bacteria from pathogenic bacteria via several mechanisms, including TLR signalling by immunosuppressive DNA motifs (108) and SCFA production upon microbiota modulation (58,

65). This anti-inflammatory property of many probiotics could make them poor inducers of inflammation to anti-pathogenic immune responses. Thus, a delicate balance arises in which future, prospective prophylactics that increase anti-pathogenic immune responses in the gut must do so without inducing too excessive of inflammation, which would otherwise damage the host.

Summary Statement and Organization for Thesis Research

Altogether, these studies demonstrate the importance of identifying novel treatments for mitigating Enterobacteriaceae virulence activities and colonization in poultry. Given that the chicken intestine both serves as a reservoir for these pathogenic Enterobacteriaceae (i.e.,

Salmonella and E. coli), we hypothesized that orally-delivered prophylactics are viable strategies for improving host responses against Enterobacteriaceae. First, we hypothesized that probiotics would synergistically improve the activities of a live Salmonella vaccine and induce host changes at several levels in the gut (i.e., gut microbiome, neurochemical metabolism, plasmid transfer). Furthermore, we hypothesize that the ileal spore-forming bacteria can serve as novel bacterial treatment to improve Enterobacteriaceae resistance in chickens and stimulate immune maturation in young birds. Lastly, we hypothesize that targeting the neuroimmunological axis using the drug reserpine would stimulate anti-Enterobacteriaceae host responses in the chicken 13 intestine. Overall, these studies are crucial for understanding the breadth of mechanisms in which bacterial treatments induce to improve poultry health.

References

1. USDA. Foreign Agricultural Market Service: Global Market Analysis. Livestock and Poultry: World Markets and Trade. January 2021.

2. USDA. Egg Market News Report. 68(9), March 2021. ISSN: 1520-6122

3. Lay DC, Fulton RM, Hester PY, Karcher DM, Kjaer JB, Mench JA, et al. Hen welfare in different housing systems. Poult Sci. (2011) 90:278–94. doi: 10.3382/ps.2010-00962

4. Center for Disease Control and Prevention. Disease and Organisms in Healthcare Settings. (2021). Accessed February 2021. https://www.cdc.gov/hai/organisms/organisms.html

5. Antunes P, Mourão J, Campos J, Peixe L. Salmonellosis: the role of poultry meat. Clin Micro- biol Infect. (2016) 22:110–21. doi: 10.1016/j.cmi.2015. 12.004

6. European Food Safety Authority and European Centre for Disease Prevention and Control. The European union summary report on trends and sources of zoonoses, zoonotic agents and foodborne outbreaks in 2014. EFSA J. (2015) 13:4329–8. doi: 10.2903/j.efsa.2015.4329

7. Wigley P. Salmonella enterica in the chicken: how it has helped our understanding of immunology in a non-biomedical model species. Front Immunol. (2014) 5:482. doi: 10.3389/fimmu.2014.00482

8. Shanmugasundaram R, Kogut MH, Arsenault RJ, Swaggerty CL, Cole K, Reddish JM, Selvaraj RK. Effect of Salmonella infection on cecal tonsil regulatory T cell properties in chickens. Poult Sci. (2015) 94:1828-1835. doi: 10.3382/ps/pev161

9. Kogut MH, Arsenault RJ. Immunometabolic Phenotype Alterations Associated with the Induction of Disease Tolerance and Persistent Asymptomatic Infection of Salmonella in the Chicken Intestine. Front Immunol. (2017) 8:372. doi: 10.3389/fimmu.2017.00372

10. Uddin J, Hossain K, Hossain S, Saha K, Jubyda FT, Haque R, et al. Bacteriological assessments of foodborne pathogens in poultry meat at different super shops in Dhaka, Bangladesh. Ital J Food Saf. (2019) 8:6720. doi: 10.4081/ijfs.2019.6720

11. Heredia N, García S. Animals as sources of food-borne pathogens: a review. Anim Nutr. (2018) 4:250–5. doi: 10.1016/j.aninu.2018.04.006

12. Bergeron C, Prussing C, Boerlin P, Daignault D, Dutil L, Reid-Smith RJ, et al. Chicken as Reservoir for Extraintestinal Pathogenic Escherichia coli in Humans, Canada. Emerging Infec- tious Diseases. (2012) 18(3):415-21. doi: 10.3201/eid1803.111099

13. Ewers C, Antão EM, Diehl I, Philipp HC, Wieler LH. Intestine and environment of the chicken as reservoirs for extraintestinal pathogenic Escherichia coli strains with zoonotic potential. Appl Environ Microbiol. (2009) 75:184–92. doi: 10.1128/AEM.01324-08

14. Stromberg ZR, Johnson JR, Fairbrother JM, Kilbourne J, Van Goor A, Curtiss R, et al. Evalu- ation of Escherichia coli isolates from healthy chickens to determine their potential risk to poultry and human health. PLoS ONE. (2017) 12:e0180599. doi: 10.1371/journal.pone.0180599

15. Mellata M. Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog Dis. (2013) 10:916–32. doi: 10.1089/fpd.2013.1533

16. Duan H, Chai T, Cai Y, Zhong Z, Yao M, Zhang X. Transmission identification of Escherichia coli aerosol in chicken houses to their environments using ERIC-PCR. Sci China C Life Sci. (2008) 51, 164–173. doi: 10.1007/s11427-008- 0021-0

17. Chien YC, Chen CJ, Lin TH, Chen SH. Characteristics of microbial aerosols released from chicken and swine feces. J Air Waste Manag Assoc. (2011) 61, 882–889. doi: 10.3155/1047- 3289.61.8.882

18. ONeill J. Antimicrobial resistance: tackling a crisis for the health and wealth of nations. Re- view on Antimicrobial Resistance, London, United Kingdom. (2014)

19. Rotger R, Casadesús J. The virulence plasmids of Salmonella. Int Microbiol. (1999) 2(3):177- 84. PMID: 10943411.

20. Johnson TJ, Nolan LK. Pathogenomics of the virulence plasmids of Escherichia coli. Micro- biol Mol Biol Rev. (2009) 73(4):750-74. doi: 10.1128/MMBR.00015-09. Erratum in: Microbiol Mol Biol Rev. (2010) 74(3):477-8. PMID: 19946140

21. Fricke WF, McDermott PF, Mammel MK, Zhao S, Johnson TJ, Rasko DA, et al. Antimicrobial resistance-conferring plasmids with similarity to virulence plasmids from avian pathogenic Esch- erichia coli strains in Salmonella enterica serovar Kentucky isolates from poultry. Appl Environ Microbiol. (2009) 75:5963–71. doi: 10.1128/AEM.00786-09

22. Wegener HC. Antibiotic resistance- linking human and animal health. In: Institute of Medicine (US). Improving Food Safety Through a One Health Approach: Workshop Summary. Washington, DC: National Academies Press (2012). p. A15. Available online at: https://www.ncbi.nlm.nih.gov/books/ NBK114485/

23. Poulsen LK, Lan F, Kristensen CS, Hobolth P, Molin S, Krogfelt KA. Spatial distribution of Escherichia coli in the mouse large intestine inferred from rRNA in situ hybridization. Infect Im- mun. (1994) 62, 5191–5194. doi: 10.1128/IAI.62.11.5191-5194.1994

24. Lynn DJ, Lloyd AT, O'Farrelly C. In silico identification of components of the Toll-like receptor (TLR) signaling pathway in clustered chicken expressed sequence tags (ESTs). Vet Immu- nol Immunopathol. (2003) 93:177-184. doi:10.1016/s0165-2427(03)00058-8

25. Keestra, AM, de Zoete, MR, Bouwman, LI, Vaezirad, MM, van Putten, JP. Unique features of chicken Toll-like receptors. Dev Comp Immunol. (2013) 41:316-323. doi:10.1016/j.dci.2013.04.009

26. Ahirwar SK, Pratap CB, Patel SK, Shukla VK, Singh IG, Mishra OP, Kumar K, Singh TB, Nath G. Acid exposure induces multiplication of Salmonella enterica serovar Typhi. J Clin Mi- crobiol. (2014) 52(12):4330-3. doi: 10.1128/JCM.02275-14

27. Svihus B, Choct M, Classen HL. Function and nutritional roles of the avian caeca: a review. Worlds Poult Sci J. (2013) 69, 249–264. doi: 10.1016/j.vetmic. 2013.11.019

28. Rechkemmer G, Rönnau K, von Engelhardt W. Fermentation of polysaccharides and absorption of short chain fatty acids in the mammalian hindgut. Comp Biochem Physiol A Comp Physiol. (1988) 90(4):563-8. doi: 10.1016/0300-9629(88)90668-8.

29. Conway T, Cohen PS. (2015) Commensal and pathogenic Escherichia coli metabolism in the gut. Microbiol Spectr. (2015) 3:1–24. doi: 10.1128/microbiolspec.MBP-0006-2014

30. Befus AD, Johnston N, Leslie GA, Bienenstock J. Gut-associated lymphoid tissue in the chicken. I. Morphology, ontogeny, and some functional characteristics of Peyer’s patches. J Im- munol. (1980) 125:2626–32.

31. Kitagawa H, Hiratsuka Y, Imagawa T, Uehara M. Distribution of lymphoid tissue in the caecal mucosa of chickens. J Anat.(1998) 192(Pt. 2): 293–8.

32. Kitagawa H, Hiratsuka Y, Imagawa T, Uehara M. Distribution of lymphoid tissue in the caecal mucosa of chickens. J Anat. (1998) 192(2):293–8.

33. Nochi T, Jansen CA, Toyomizu M, Eden W. The Well-Developed Mucosal Immune Systems of Birds and Mammals Allow for Similar Approaches of Mucosal Vaccination in Both Types of Animals. Front. Nutr. (2018) 5:60. doi: 10.3389/fnut.2018.00060

34. Neutra MR, Kozlowski PA. Mucosal vaccines: the promise and the challenge. Nat Rev Immu- nol. (2006) 6:148–58. doi: 10.1038/nri1777

35. Wang Y, Qu L, Uthe JJ, Bearson SM, Kuhar D, Lunney JK, Couture OP, Nettleton D, Dekkers JC, Tuggle CK. Global transcriptional response of porcine mesenteric lymph nodes to Salmonella enterica serovar Typhimurium. Genomics. (2007) 90:72–84. doi: 10.1016/j.ygeno.2007.03.018 16

36. Martins RP, Collado-Romero M, Arce C, Lucena C, Carvajal A, Garrido JJ. Exploring the immune response of porcine mesenteric lymph nodes to Salmonella enterica serovar Typhi- murium: an analysis of transcriptional changes, morphological alterations and pathogen burden. Comp Immunol Microbiol Infect Dis. (2013) 36:149–160. doi: 10.1016/j.cimid.2012.11.003

37. Rabie NS, Amin Girh ZMS. Bacterial vaccines in poultry. Bull Natl Res Cent. (2020) 44:15. doi: 10.1186/s42269-019-0260-1

38. Hill C, Guarner F, Reid G, Gibson GR, Merenstein DJ, Pot B, et al. Expert consensus docu- ment. The international scientific association for probiotics and prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat Rev Gastroenterol Hepatol. (2014) 11:506–14. doi: 10.1038/nrgastro.2014.66

39. Sadeyen J, Wu Z, Davies H. Immune responses associated with homologous protection conferred by commercial vaccines for control of avian pathogenic Escherichia coli in turkeys. Vet Res. (2015) 46:5. doi: 10.1186/s13567-014-0132-5

40. Mohamed MA, Bakhit BM, Ibrahim AA, Saleh M. Evaluation of the living Escherichia coli- O78 deleted aroA vaccine against homologous and heterologous E. coli challenge in broiler chickens. J Adv Vet Res. (2016) 6:89– 92.

41. Solà-Ginés M, Cameron-Veas K, Badiola I, Dolz R, Majó N, Dahbi G, et al. Diversity of multidrug resistant avian pathogenic Escherichia coli (APEC) causing outbreaks of colibacillosis in broilers during 2012 in Spain. PLoS ONE. (2015) 10:e0143191. doi: 10.1371/journal.pone.0143191

42. Hassan JO, Curtiss R III. Efficacy of a live avirulent Salmonella typhimurium vaccine in preventing colonization and invasion of laying hens by Salmonella typhimurium and Salmonella enteritidis. Avian Dis. (1997) 41:783–791. doi: 10.2307/1592330

43. Muniz EC, Verdi R, Leão JA, Back A, Nascimento VPD. Evaluation of the effectiveness and safety of a genetically modified live vaccine in broilers challenged with Salmonella Heidelberg. Avian Pathol. (2017) 46:676–82. doi: 10.1080/03079457.2017.1348598

44. Bailey JS, Rolon A, Hofacre CL, Holt PS, Wilson JL, Cosby DE, et al. Intestinal humoral immune response and resistance to Salmonella challenge of progeny from breeders vaccinated with killed antigen. Int J Poult Sci. (2007) 6:417–23. doi: 10.3923/ijps.2007.417.423

45. Springer S, Lindner T, Ahrens M, Woitow G, Prandini F, Selbitz HJ. Duration of immunity induced in chickens by an attenuated live Salmonella enteritidis vaccine and an inactivated Sal- monella enteritidis/typhimurium vaccine. Berl Munch Tierarztl Wochenschr. (2011) 124:89–93.

46. Curtiss III R, Mellata M, Zekarias B, Shi Z, Branger C, Roland K. Recombinant bacterium capable of eliciting an immune response against enteric pathogens. Salmonella vaccine against bacterial enteric pathogens. US Pat. No. 8,465,755B2 (granted 06/18/13). https://patentimages.storage.googleapis. com/b5/81/f0/2ecf6f7d787f7c/US8465755.pdf.

47. Maddux JT, Stromberg ZR, Curtiss III R Mellata M. Evaluation of recombinant attenuated Salmonella vaccine strains for broad protection against extraintestinal pathogenic Escherichia coli. Front Immunol. (2017) 8:1280. doi: 10.3389/fimmu.2017.01280

48. Stromberg ZR, Van Goor A, Redweik GAJ, Mellata M. Characterization of spleen transcriptome and immunity against avian colibacillosis after immunization with recombinant attenuated Salmonella vaccine strains. Front Vet Sci. (2018) 5:198. doi: 10.3389/fvets.2018.00198

49. Dittoe DK, Ricke SC, Kiess AS. Organic acids and potential for modifying the avian gastrointestinal tract and reducing pathogens and disease. Front Vet Sci. (2018) 5:216. doi: 10.3389/fvets.2018.00216

50. Flint HJ, Duncan SH, Scott KP, Louis P. Links between diet, gut microbiota composition and gut metabolism. Proc Nutr Soc. (2015) 74:13–22. doi: 10.1017/S0029665114001463

51. Arpaia N, Campbell C, Fan X, Dikiy S, van der Veeken J, deRoos P, et al. Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation. Nature. (2013) 504:451–5. doi: 10.1038/nature12726

52. Smith PM, Howitt MR, Panikov N, Michaud M, Gallini CA, Bohlooly Y, et al. The microbial metabolites, short-chain fatty acids, regulate colonic Treg cell homeostasis. Science. (2013) 341:569–73. doi: 10.1126/science.1241165

53. Schulthess J, Pandey S, Capitani M, Rue-Albrecht KC, Arnold I, Franchini F, et al. The short chain fatty acid butyrate imprints an antimicrobial program in macrophages. Immunity. (2019) 50:432–45.e7. doi: 10.1016/j.immuni.2018.12.018

54. Liao SF, Nyachoti M. Using probiotics to improve swine gut health and nutrient utilization. Anim Nutr. (2017) 3:331–43. doi: 10.1016/j.aninu.2017.06.007

55. Biloni A, Quintana CF, Menconi A, Kallapura G, Latorre J, Pixley C, et al. Evaluation of effects of early-bird associated with floramax-B11 on Salmonella enteritidis, intestinal morphology, and performance of broiler chickens. Poult Sci. (2013) 92:2337–46. doi: 10.3382/ps.2013- 03279

56. Prado-Rebolledo OF, Delgado-Machuca JDJ, Macedo-Barragan RJ, GarciaMárquez LJ, Mo- rales-Barrera JE, Latorre JD, et al. Evaluation of a selected lactic acid bacteria-based probiotic on Salmonella enterica serovar enteritidis colonization and intestinal permeability in broiler chickens. Avian Pathol. (2017) 46:90–4. doi: 10.1080/03079457.2016.1222808

57. Menconi A, Kallapura G, Latorre JD, Morgan MJ, Pumford NR, Hargis BM, et al. Identifica- tion and characterization of lactic acid bacteria in a commercial probiotic culture. Biosci Microbi- ota Food Health. (2014) 33:25– 30. doi: 10.12938/bmfh.33.25

58. Slizewska K, Markowiak-Kopec P, Zbikowski A, Szeleszczuk P. The effect of ´synbiotic’ preparations on the intestinal microbiota and her metabolism in broiler chickens. Sci Rep. (2020) 10:4281. doi: 10.1038/s41598-020-61256-z

59. Penaloza-Vazquez A, Ma LM, Rayas-Duarte P. Isolation and characterization of Bacillus spp. Can J Microbiol. (2019) 65:762–74. doi: 10.1139/cjm-2019-0019

60. La Ragione RM, Woodward MJ. Competitive exclusion by Bacillus subtilis spores of Salmo- nella enterica serotype enteritidis and Clostridium perfringens in young chickens. Vet Microbiol. (2003) 94:245–56. doi: 10.1016/S0378-1135(03)00077-4

61. Whelan RA, Doranalli K, Rinttilä T, Vienola K, Jurgens G, Apajalahti J. The impact of Bacillus subtilis DSM 32315 on the pathology, performance, and intestinal microbiome of broiler chickens in a necrotic enteritis challenge. Poult Sci. (2019) 98:3450–63. doi: 10.3382/ps/pey500

62. Stein T. Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Micro- biol. (2005) 56:845–57. doi: 10.1111/j.1365-2958.2005.04587.x

63. Knap I, Kehlet AB, Bennedsen M, Mathis GF, Hofacre CL, Lumpkins BS, et al. Bacillus subtilis (DSM17299) significantly reduces Salmonella in broilers. Poult Sci. (2011) 90:1690–4. doi: 10.3382/ps.2010-01056

64. Teo AYL, Tan HM. Effect of Bacillus subtilis PB6 (CloSTAT) on broilers infected with a pathogenic strain of Escherichia coli. J Appl Poult Res. (2006) 15:229–35. doi: 10.1093/japr/15.2.229

65. Arreguin-Nava MA, Graham BD, Adhikari B, Agnello M, Selby CM, Hernandez-Velasco X, et al. Evaluation of in ovo Bacillus spp. based probiotic administration on horizontal transmission of virulent Escherichia coli in neonatal broiler chickens. Poult Sci. (2019) 98:6483–91. doi: 10.3382/ps/pez544

66. Naimah AK, Al-Manhel AJA, Al-Shawi MJ. Isolation, purification and characterization of antimicrobial peptides produced from Saccharomyces boulardii. Int J Peptide Res Therap. (2018) 24:455–61. doi: 10.1007/s10989-017-9632-2

67. Branco P, Francisco D, Monteiro M, Almeida MG, Caldeira J, Arneborg N, et al. Antimicrobial properties and death-inducing mechanisms of saccharomycin, a biocide secreted by Saccharomy- ces cerevisiae. Appl Microbiol Biotechnol. (2017) 101:159–71. doi: 10.1007/s00253-016- 7755-6

68. Schneider SM, Girard-Pipau F, Filippi J, Hebuterne X, Moyse D, Hinojosa GC, et al. Effects of Saccharomyces boulardii on fecal short-chain fatty acids and microflora in patients on long- term total enteral nutrition. World J Gastroenterol. (2005) 11:6165–9. doi: 10.3748/wjg.v11. i39.6165

69. Kiros TG, Luise D, Derakhshani H, Petri R, Trevisi P, D’Inca R, et al. Effect of live yeast Saccharomyces cerevisiae supplementation on the performance and cecum microbial profile of suckling piglets. PLoS ONE. (2019) 14:e0219557. doi: 10.1371/journal.pone.0219557

70. S Wulandari and T M Syahniar. The effect of adding probiotic Saccharomyces cerevisiae on dietary antibiotic-free on production performance and intestinal lactic acid bacteria growth of broiler chicken. IOP Conf Ser. Earth Environ Sci. (2018) 207:012034

71. Licciardi PV, Tang ML. Vaccine adjuvant properties of probiotic bacteria. Discov Med. (2011) 12:525–33. PMID: 22204769.

72. Nothaft H, Perez-Muñoz ME, Gouveia GJ, Duar RM, Wanford JJ, Lango-Scholey L, et al. Coadministration of the Campylobacter jejuni N-glycan-based vaccine with probiotics improves vaccine performance in broiler chickens. Appl Environ Microbiol. (2017) 83:e01523–17. doi: 10.1128/AEM.01523-17

73. Ritzi MM, Abdelrahman W, van-Heerden K, Mohnl M, Barrett NW, Dalloul RA. Combination of probiotics and coccidiosis vaccine enhances protection against an Eimeria challenge. Vet Res. (2016) 47:111. doi: 10.1186/s13567-016-0397-y

74. Beirão BCB, Ingberman M, Favaro C Jr, Mesa D, Bittencourt LC, Fascina VB, et al. Effect of an Enterococcus faecium probiotic on specific IgA following live Salmonella enteritidis vaccination of layer chickens. Avian Pathol. (2018) 47:325–33. doi: 10.1080/03079457.2018.1450487

75. De Vadder F, Grasset E, Mannerås Holm L, Karsenty G, Macpherson AJ, Olofsson LE, et al. Gut microbiota regulates maturation of the adult enteric nervous system via enteric serotonin networks. Proc Natl Acad Sci USA. (2018) 115:6458–63. doi: 10.1073/pnas.1720017115

76. Dinan TG, Stilling RM, Stanton C, Cryan JF. Collective unconscious: how gut microbes shape human behavior. J Psychiatr Res. (2015) 63:1–9. doi: 10.1016/j.jpsychires.2015.02.021

77. Martin CR, Osadchiy V, Kalani A, Mayer EA. The brain-gut microbiome axis. Cell Mol Gas- troenterol Hepatol. (2018) 6:133–48. doi: 10.1016/j.jcmgh.2018.04.003

78. Ball AG, Bell EA, Sienerth K, Uno JK. Using a zebrafish model to study the gut microbiota’s effect on the brain’s neurochemistry and behavior. FASEB. (2018) 32(S1):765.8. doi: 10.1096/fasebj.2018.32.1_supplement.765.8

79. Lyte M. Probiotics function mechanistically as delivery vehicles for neuroactive compounds: microbial endocrinology in the design and use of probiotics. Bioessays. (2011) 33:574–81. doi: 10.1002/bies.201100024 20

80. Lyte M. Microbial endocrinology: an ongoing personal journey. Adv Exp Med Biol. (2016) 874:1–24. doi: 10.1007/978-3-319-20215-0_1

81. Villageliú DN, Rasmussen S, Lyte M. A microbial endocrinology-based simulated small intestinal medium for the evaluation of neurochemical production by gut microbiota. FEMS Micro- biol Ecol. (2018) 94:1–9. doi: 10.1093/femsec/fiy096

82. Valcarce DG, Martínez-Vázquez JM, Riesco MF, Robles V. Probiotics reduce anxiety-related behavior in zebrafish. Heliyon. (2020) 6:e03973. doi: 10.1016/j.heliyon.2020.e03973

83. Calefi AS, Fonesca JGS, Cohn DWH, Honda BTB, Costola-de-Souza C, Tsugiyama LE, et al. The gut-brain axis interactions during heat stress and avian necrotic enteritis. Poult Sci. (2016) 95:1005–14. doi: 10.3382/ps/pew021

84. Ramirez V, Swain S, Murray K, Reardon C. 2020. Neural immune communication in the control of host-bacterial pathogen interactions in the gastrointestinal tract. Infect Immun 88:e00928- 19. https://doi.org/10.1128/IAI .00928-19.

85. Belkaid Y, Hand TW. Role of the microbiota in immunity and inflammation. Cell. (2014) 157(1):121-141. doi:10.1016/j.cell.2014.03.011

86. Park JH, Kim IH. Supplemental effect of probiotic Bacillus subtilis B2A on productivity, organ weight, intestinal Salmonella microflora, and breast meat quality of growing broiler chicks. Poult Sci. (2014) 93(8):2054-2059. doi:10.3382/ps.2013-03818

87. Bielecka M, Smoragiewicz W, Siwicki AK, Wójcik R, Biedrzycka E, Orłowski A, Kask S, Jankowski J, Karska-Wysocki B, Ham D. The Effect of Various Probiotic Strains or Avilamycin Feed Additive on Immune Defense Markers and Acute-Phase Response to Salmonella Infection in Chickens. Probiotics Antimicrob Proteins. (2010) 2(3):175-185. doi: 10.1007/s12602-010- 9054-3

88. Sohail MU, Ijaz A, Yousaf MS, Ashraf K, Zaneb H, Aleem M, Rehman H. Alleviation of cyclic heat stress in broilers by dietary supplementation of mannan-oligosaccharide and Lactoba- cillus-based probiotic: dynamics of cortisol, thyroid hormones, cholesterol, C-reactive protein, and humoral immunity. Poult Sci. (2010) 89 (9):1934-1938. doi:10.3382/ps.2010-00751

89. Ding S, Wang Y, Yan W, Li A, Jiang H, Fang J. Effects of Lactobacillus plantarum 15-1 and fructooligosaccharides on the response of broilers to pathogenic Escherichia coli O78 challenge. PLoS One. (2019) 14 (6):e0212079. doi:10.1371/journal.pone.0212079

90. Huff GR, Huff WE, Enders C, Sonnenborn U, Rath NC, Farnell MB, Solis de los Santos F, & Donoghue AM. Oral treatment with the probiotic Escherichia coli Nissle 1917 improves body weight and modulates the stress response of poultry in respiratory challenges with avian pathogenic E. coli. In Proceeding of the XII European Poultry Conference (2006). September, 10-14, Verona, Italy. 21

91. Lutful Kabir SM. The role of probiotics in the poultry industry. Int J Mol Sci. (2009) 10(8):3531-3546. doi:10.3390/ijms10083531

92. Khan R, Naz S. The applications of probiotics in poultry production. Worlds Poult Sci J. (2013) 69(3):621-631. doi:10.1017/S0043933913000627

93. Patterson JA, Burkholder KM. Application of prebiotics and probiotics in poultry production. Poult Sci. (2003) 82(4):627-631. doi:10.1093/ps/82.4.627

94. Schmidt C. The startup bugs. Nat Biotechnol. (2013) 31:279–81. doi: 10.1038/nbt.2544

95. Johnson TJ, Siek KE, Johnson SJ, Nolan LK. DNA sequence and comparative genomics of pAPEC-O2-R, an avian pathogenic Escherichia coli transmissible R plasmid. Antimicrob Agents Chemother. (2005) 49, 4681–88. doi: 10.1128/AAC.49.11.4681-4688.2005

96. Johnson TJ, Thorsness JL, Anderson CP, Lynne AM, Foley SL, Han J, et al.. Horizontal gene transfer of a ColV plasmid has resulted in a dominant avian clonal type of Salmonella enterica serovar Kentucky. PLoS ONE. (2010) 5:e15524. doi: 10.1371/journal.pone.0015524

97. Yang QE, Sun J, Li L, Deng H, Liu BT, Fang LX, et al. IncF plasmid diversity in multi-drug resistant Escherichia coli strains from animals in China. Front Microbiol. (2015) 6:964. doi: 10.3389/fmicb.2015.00964

98. Kaldhone PR, Carlton A, Aljahdali N, Khajanchi BK, Sanad YM, Han J, et al. Evaluation of incompatibility group I1 (IncI1) plasmid-containing Salmonella enterica and assessment of the plasmids in bacteriocin production and biofilm development. Front Vet Sci. (2019) 6:298. doi: 10.3389/fvets.2019.00298

99. Imperial IC, Ibana JA. Addressing the antibiotic resistance problem with probiotics: reducing the risk of its double-edged sword effect. Front Microbiol. (2016) 7:1983. doi: 10.3389/fmicb.2016.01983

100. Carpenter S, O'Neill LA. Recent insights into the structure of Toll-like receptors and post- translational modifications of their associated signalling proteins. Biochem J. (2009) 422(1):1-10. doi:10.1042/BJ20090616

101. Roach JC, Glusman G, Rowen L, Kaur A, Purcell MK, Smith KD, Hood LE, Aderem A. The evolution of vertebrate Toll-like receptors. Proc Natl Acad Sci USA. (2005) 102(27):9577-9582. doi:10.1073/pnas.0502272102

102. Adhikari P, Lee CH, Cosby DE, Cox NA, Kim WK. Effect of probiotics on fecal excretion, colonization in internal organs and immune gene expression in the ileum of laying hens challenged with Salmonella Enteritidis. Poult Sci. (2019) 98(3):1235-1242. doi:10.3382/ps/pey443

103. Karaffova V, Marcinkova E, Bobikova K, Herich R, Revajova V, Stasova D, Kavul’ova A, et al. TLR4 and TLR21 expression, MIF, IFN-β, MD-2, CD14 activation, and sIgA production in chickens administered with EFAL41 strain challenged with Campylobacter jejuni. Folia Microbiol (Praha). (2017) 62(2):89-97. doi:10.1007/s12223-016-0475-6

104. Tarradas J, Tous N, Esteve-Garcia E, Brufau AJ. The Control of Intestinal Inflammation: A Major Objective in the Research of Probiotic Strains as Alternatives to Antibiotic Growth Promoters in Poultry. Microorganisms. (2020) 8(2). doi:10.3390/microorganisms8020148

105. Klasing KC. Nutrition and the immune system. Br Poult Sci. (2007) 48(5):525-537. doi:10.1080/00071660701671336

106. Berghman LR. Immune responses to improving welfare. Poult Sci. (2016) 95(9):2216-2218. doi:10.3382/ps/pew159

107. Kogut MH, Swaggerty CL, Byrd JA, Selvaraj R, Arsenault RJ. Chicken-Specific Kinome Array Reveals that Salmonella enterica Serovar Enteritidis Modulates Host Immune Signaling Pathways in the Cecum to Establish a Persistence Infection. Int J Mol Sci. (2016) 17(8). doi:10.3390/ijms17081207

108. Bouladoux N, Hall JA, Grainger JR, dos Santos LM, Kann MG, Nagarajan V, Verthelyi D, Belkaid Y. Regulatory role of suppressive motifs from commensal DNA. Mucosal Immunol. (2012) 5(6):623-634. doi:10.1038/mi.2012.36

Figure

Figure 1-1. Summary of differences between mammalian and chicken gastrointestinal tract (GIT). Mammals use the stomach for chemical and enzymatic food digestion, whereas the chicken gizzard is used to mechanically break down food. Although both mammals and chickens possess similar intestinal compartments, chickens have two relatively long ceca compared to the mammalian cecum. Notably, intestinal immune organization is vastly different between mammals and chickens, exemplified by the absence of mesenteric lymph nodes in birds. Created with BioRender.com. 24

CHAPTER 2. ORAL TREATMENTS WITH PROBIOTICS AND LIVE SALMONELLA VACCINE INDUCE CHANGES IN GUT NEUROCHEMICALS AND MICROBIOME IN CHICKENS

Modified from a manuscript published in Frontiers in Microbiology

Graham A.J. Redweika,b, Karrie Danielsc, Andrew J. Severind, Mark Lyteb,c, and Melha Mellataa,b aDepartment of Food Science and Human Nutrition, Iowa State University, Ames, IA, USA; bIn- terdepartmental Microbiology Graduate Program, Iowa State University, Ames, IA, USA; cDepart- ment of Veterinary Microbiology and Preventative Medicine, Iowa State University, Ames, IA, USA; dGenome Informatics Facility, Iowa State University, Ames, IA, USA

Abstract

Cross-talk between the gut microbiota and neurochemicals affects health and wellbeing of animals. However, little is known about this interaction in chickens despite their importance in food production. Probiotics and live Salmonella vaccines are microbial products commonly given orally to layer pullets to improve health and ensure food safety. This study’s objective was to determine how these oral treatments, individually or in combination, would impact the gut environment of chickens. White Leghorn chicks were either non-treated (CON) or orally given probiotics (PRO), a recombinant attenuated Salmonella vaccine (RASV; VAX), or both (P+V).

Birds were fed with probiotics daily beginning at 1-day-old and orally immunized with RASV at

4-days-old and boosted 2 weeks post-primary vaccination. At 5 weeks, ceca content, ceca tissues, and small intestinal scrapings (SISs) were collected from ten birds/group post-euthanasia for analyses. Catecholamine, but not serotonergic, metabolism was affected by treatments. Dopa- mine metabolism, indicated by L-DOPA and DOPAC levels, were increased in P+V birds versus

CON and PRO birds. Based on 16S rRNA sequencing, beta diversity was more similar among vaccinated birds versus birds given probiotics, suggesting live Salmonella vaccination has a ma- 25 jor selective pressure on microbial diversity. Abundances of Akkermansia muciniphila and En- terobacteriaceae positively correlated with levels of tyrosine and norepinephrine, respectively.

Both enumeration and 16S rRNA sequencing determined that PRO exhibited the greatest levels of Enterobacteriaceae in the ceca and feces, which was associated with greater IgA production against E. coli virulence factors as tested by ELISA. In summary, we demonstrate that using probiotics alone versus in combination with a live vaccine has major implications in catecholamine production and the microbiota of layer pullets. Additionally, unique correlations between changes in some neurochemicals and specific bacteria have been shown.

Introduction

The gut microbiota directly regulates host activities through the brain-gut-enteric microbiota axis (1). The ability of microbes to secrete and respond to neurochemicals, i.e., microbial endocrinology, has major implications on host health and behavior (2), including poultry (3). In poultry, probiotics are used by commercial producers to improve intestinal microbial balance, intestinal morphology, colonization resistance against pathogens, nutrient acquisition, animal performance, and immune responses in chickens (4-6). In commercial poultry practices, lactic acid bacteria (e.g., Lactobacillus acidophilus, Pediococcus spp.), yeast (e.g., Saccharomyces spp.), and spore-formers (e.g., Bacillus subtilis) are probiotics commonly given to animals, typically as polymicrobial mixtures (7). Additionally, probiotics can serve as delivery vehicles for neuroactive compounds (8), suggesting probiotics may change the dynamics of neurochemical production in the chicken intestine.

Live Salmonella vaccines are commonly used to reduce colonization of broad-host Sal- monella enterica serovars in poultry (9), the primary vehicle of human salmonellosis (10). These 26 vaccines successfully reduce Salmonella ceca colonization (11) and environmental contamination (12). Given that S. enterica serovar Typhimurium virulence is stimulated by norepinephrine and epinephrine (13, 14), S. Typhimurium-derived vaccines could also respond to neurochemicals. Microbial endocrinology research is virtually absent in chickens (3), and no study has investigated the impact of oral vaccination on neurochemical synthesis in the gut of any animal model. Recently, we found that layer pullets orally treated with a commercial probiotic mix and live attenuated Salmonella vaccine χ9373 improved resistance to E. coli air sac challenge and

Salmonella gut colonization (15). However, the effects of these oral treatments on the gut microbiota and neurochemical production are unknown. In this study, we establish a foundation for microbial endocrinology in the chicken gut by evaluating (i) neurochemical production and (ii) microbiome in the ceca of chickens given probiotics, a recombinant attenuated Salmonella vaccine (RASV), or both. We hypothesize that each treatment group will have a unique neurochemical and microbiome profiles.

Materials and Methods

Ethics Statement and General Conditions

This project was approved by Iowa State University Institutional Animal Care and Use

Committee, log #1-16-8159-G. Animals were placed in open-floor pens and given enrichments

(i.e., string-hung CDs, free range of movement) during the course of the experiment. Euthanasia techniques (CO2 asphyxiation followed by thoracotomy) followed the American Veterinary

Medical Association Guidelines (2013).

In vivo Experiments

1-day-old male and female specific pathogen-free layer chickens (White Leghorns;

VALO, Adel, IA, United States) were randomly placed into four pens (n = 10 birds/pen), evenly split between two rooms to separate unvaccinated and vaccinated chickens, respectively (Figure

2-1A). Chickens were given ad libitum access to feed and water. One pen per room received a commercial probiotic supplement (Gro-2-Max, BioNatural America Institute), containing Bacil- lus subtilis, Lactobacillus acidophilus, Pediococcus acidilactici, Pediococcus pentosaceus, and

Saccharomyces pastorianus, as verified phenotypically and by PCR, thoroughly mixed with feed

(2.5 g dry probiotic mix to 2.3 kg feed; PRO and P+V, Figures 2-1C, 2-1D). Fresh feed was evenly weighed and replaced in each pen every 2 days. Bedding was not replaced during the duration of the experiment.

Vaccine Preparation and Immunization

Recombinant attenuated Salmonella vaccine χ9373 (Figure 2-1E) was derived from the virulent S. Typhimurium strain UK-1 (χ3761), using molecular strategies that enhance safety and immunogenicity (16). This strain was previously shown to effectively colonize chickens in vivo

(17). The day prior to vaccination, χ9373 was cultured in Luria Bertani (LB) broth (0.1% glucose, 0.02% mannose, 0.05% arabinose) overnight at 37°C. The next day, χ9373 was grown shaking in the same media until OD600 reached ∼0.8, and the inoculum was centrifuged for 20 min at 4,000 × g at room temperature. The pellet was then resuspended, serially diluted in PBS, and plated on MacConkey agar to confirm bacterial concentrations.

At 4-days-old, feed and water were removed from pens of all birds 4–6 h prior to vaccination. Chickens in the vaccine groups (i.e., VAX and P+V) were orally immunized via mi- 28 cropipette with 20 µl of 109 colony-forming units (CFU) χ9373. Two weeks post-primary vaccination, the same chickens were orally immunized with a 20 µl χ9373 boost (108 CFU). Non- vaccinated birds (i.e., CON and PRO) received 20 µl PBS as a control. Feed and water were returned to pens 30 min post-immunization. Enumeration of χ9373 in feces (n = 5) showed no differences in colonization in VAX and P+V chickens (Figure 2-10).

Sample Collection

Sample collection and corresponding analyses are summarized in Figures 2-1A and 2-1B, respectively. At 4 weeks of age, three birds per group were randomly selected and placed into sterile containers to collect feces. Fecal matter was then resuspended in PBS, serially diluted, and plated onto MacConkey agar for Enterobacteriaceae enumeration. At 5 weeks of age, birds were humanely euthanized via CO2 asphyxiation. To collect small intestinal scrapings (SISs; n = 10 per group), a 10-cm segment aligning Meckel’s diverticulum in the center was longitudinally cut to expose the lumen. After removing excess luminal contents, the epithelial layer was gently scraped and then washed with 1 ml PBS to collect mucus into 50 ml conicals (one conical/bird) filled with 10 ml PBS. Conicals were then centrifuged at 5,000 × g for 20 min at 4°C. Then, 1 ml supernatant was added to 30 µl storage mixture (1% sodium azide, 5% BSA, 50 mM phenylmethane sulfonyl fluoride) and stored in −80°C.

To collect ceca samples (n = 10 per group), contents were squeezed from both ceca into respective cryogenic tubes (Nalgene System 100™, Thermo Fisher Scientific) and immediately placed on dry ice. The remaining ceca tissue (n = 10 per group) was briefly washed with PBS and flash-frozen in liquid nitrogen, and the tissues were transferred to cryogenic tubes and placed on dry ice. Tubes were then moved into −80°C for long-term storage.

Ultra-High Pressure Liquid Chromatography

Ceca tissue, content, and SISs were pre-treated with 0.2 M perchloric acid (1:10 sample- acid ratio), and homogenized via Omni Bead Ruptor tubes. After centrifugation, supernatant liquid was transferred to 2–3 kDa spin filter and centrifuged again at 2,950 × g at 4°C. Flow- through was then analyzed via ultrahigh-performance liquid chromatography with electrochemical detection (UHPLC-ED) using the 99 Dionex UltiMate 3000 with MD-TM Mobile Phase So- lution as sample diluent (Fisher Scientific) as performed previously (18).

DNA Isolation and Microbiome 16S rRNA Sequencing

Total DNA was isolated from 0.25 g of ceca contents using the DNeasy PowerSoil Kit

(Qiagen). Extracted DNAs were assessed for quality using a NanoDrop 2000 spectrophotometer

260–280 nm ratios. Concentrations were determined using a Qubit fluorometer with the double- stranded DNA broad range kit (Thermo Fisher Scientific), adjusted to 50 ng/µl in nuclease-free water, and shipped on dry ice to Argonne National Laboratory in Lemont, IL, United States. All

40 ceca samples were used for sequencing. DNAs were used for library preparation using the

MiSeq and HiSeq2500 kit (Illumina) following all manufacturer’s instructions with 151 × 151 paired-end MiSeq sequencing (Illumina). For 16S rRNA analysis, QIIME2 (version 2019.10) was used to analyze the 16S rRNA data between all sequenced groups. However, due to lane effect (further details provided in our GitHub repository at https://github.com/ISUgenomics/MelhaMellata), all CON and four PRO samples were removed.

Thereafter, QIIME2 analysis was used with the remaining samples to compare treatment groups

(PRO, n = 6; VAX, n = 10; and P+V, n = 10). Sequences were demultiplexed using the QIIME2 demux emp-paired function and denoised using the QIIME2 plugin DADA2. The number of good quality reads for taxonomic assignment ranged from 27,272 to 60,368 reads. GreenGenes 30 database (version 13.8) at the 99% operational taxonomic units (OTUs) for the region

(515F/806R) was used to classify each of the reads using QIIME2’s featureclassifier function.

Alpha and beta diversity analyses were calculated using QIIME2’s built in functions. Gneiss plugin was used to explore taxonomic balances and taxonomic group differences between treatment groups. The ols-regression summary indicated the model used (Treatment+Unknown) was a good fit for the data with small residuals. A large unknown factor was noted to account for

40% of the variation but this variation was orthogonal to the variation that can discriminate between treatment groups and can be safely ignored. For a more thorough description of our step- by-step methods, please refer to the GitHub repository at https://github.com/ISUgenomics/MelhaMellata. The 16S rRNA dataset is available in the NCBI

Sequence Read Archive (SRA) repository with accession BioProject ID SUB5641933.

IgA Titers Measured by ELISA

Ninety-six-well plates were coated with 2.0 µg/ml of lipopolysaccharide (LPS, Salmo- nella enterica serovar Typhimurium, Sigma), salmochelin receptor (IroN), aerobactin receptor

(IutA), or 0.25 µg/ml unlabeled chicken IgA (i.e., total IgA; H+L, Thermo Fisher Scientific) overnight at 4°C. LPS is common in gram-negative bacteria, and IroN and IutA are virulence factors involved in iron acquisition. Recombinant IroN and IutA proteins were purified from culture of E. coli BL21 containing the pET-101/D-TOPO vectors (Invitrogen) carrying iroN or iutA genes as previously described (19). SISs were diluted 1:1 in SEA blocking buffer (Thermo

Fisher Scientific), serially diluted 1:2, and incubated for 1 h at room temperature. Goat-anti- chicken-IgA-AP (H+L, Thermo Fisher Scientific) was added, followed by PNPP substrate

(Thermo Fisher Scientific), and absorbance was measured at 405 nm. To measure antibody titer, the reciprocal of the highest dilution values doubling the control value (i.e., CON birds) were 31 considered positive. ELISAs were done in duplicate per individual bird and independently replicated twice.

Statistical Analysis

Statistical analyses were performed using GraphPad Prism software 6.0 for non-linear regression analyses. One-way ANOVA followed by Tukey’s test for multiple means comparisons was used to compare differences between all groups for each experiment. P-values < 0.05 were considered significant. For correlational analyses, R software was used to run linear regression models between log-transformed 16S rRNA reads of microbial taxa (normalization step) and neurochemical metabolite concentrations. Log transformations were done in Excel, and data used for linear regression analyses are included in Table 2-1. Improved normalization of 16S rRNA abundances via log transformation can be seen in Supplementary Figures 2-7, 2-8.

Results

Catecholamine, but Not Serotonin Metabolism, Was Altered in Treatment-Specific Manner

Total neurochemical metabolites detected in any tissue type were split by metabolic pathway, i.e., serotonergic (Figure 2-2) and catecholaminergic (Figure 2-3). In all treatment groups, serotonin was detected in both the ceca content and tissue but not in SISs (Figure 2-2A). Its breakdown product, 5-hydroxyindoleacetic (5- HIAA), was similarly detected in the ceca tissue

(Figure 2-2B) but not in the content. Additionally, 5-HIAA was detectable in SISs. Treatment did not significantly change production of either metabolite in any sample.

In Figure 2-3, catecholamines were consistently detected in ceca content and tissue, though only tyrosine levels reached a detectable threshold in SISs (Figure 2-3A). In general, treatments modified metabolite levels in a case-by-case basis. In Figure 2-3A, the ceca content of 32

VAX birds exhibited increased tyrosine levels compared to CON (P < 0.05) and PRO (P < 0.01).

Ceca content from P+V birds had the highest levels of 3,4-dihydroxyphenylacetic acid (DOPAC) compared to both CON and PRO birds (P < 0.05; Figure 2-3B). PRO birds exhibited increased norepinephrine levels in ceca content versus VAX and P+V birds (Figure 2-3C; P < 0.01). L-3,4- dihydroxyphenylalanine (L-DOPA) levels were dramatically increased in P+V tissue compared to CON (P < 0.05) and Probiotics (P < 0.05; Figure 2-3E). No differences were found for levels of 3,4-dihydroxymandelic acid (DHMA, Figure 2-3D), homovanillic acid (HVA, Figure 2-3F), and epinephrine (Figure 2-3G) in any sample tested between treatment groups.

Ceca Microbiome Diversity Changed by Treatment

Microbiome 16S rRNA sequencing and analyses were originally performed with ten samples from each group (CON, PRO, VAX, and P+V). However, after detecting a lane effect that affected our 16S rRNA analysis, we corrected this effect by focusing on analyzing those sequenced on a single lane only, which includes the three treatment groups (PRO, VAX, and P+V).

Despite this limitation, this strategy still allows ceca microbiome characterization of chickens given P+V versus mono-treated animals, PRO or VAX.

Using multiple means comparisons via one-way ANOVA, microbial richness (i.e.,

Faith’s PD) was not statistically different between treatment groups (Figure 2-11A). However, evenness was significantly greater in P+V versus VAX group (P < 0.05; Figure 2-11B), but no significant difference between P+V and PRO was observed. Using a Bray– Curtis PCoA and a

Jaccard Emperor plot to display quantitative (Figures 2-4A through C) and qualitative (Figures

2-4D through F) differences for community dissimilarity, respectively. These data show that ceca microbiomes of VAX and P+V birds clustered similarly along Axes 1 and 3 of the respective diversity plots. Overall, individuals tended to cluster based on treatment group. 33

Specific Microbial Abundances Are Influenced by Live Prophylactics

At the phylum level, Firmicutes were the most abundant phylum in all groups (Figure 2-

5). Proteobacteria and Verrucomicrobia were specifically increased in PRO (all groups, P <

0.001) and VAX (all groups, P < 0.001), respectively (Figure 2-5). At the class level, Clostridia were slightly lower in abundance in P+V versus PRO (P < 0.05; Figure 2-12). Similar to the pattern of Proteobacteria abundances, PRO exhibited the greatest abundances of Gammaproteobac- teria (all groups, P < 0.001; Supplementary Figure 2-3). At the family level, Lachnospiraceae levels were highest in PRO versus P+V birds (Figure 2-13A, P < 0.01), and Peptostreptococca- ceae were elevated in P+V versus VAX birds (Figure 2-13B, P < 0.01). Additionally, Mogibac- teriaceae were reduced in vaccinated birds versus PRO (Figure 2-13C, P < 0.05).

At the genus level, birds from both vaccinated groups (i.e., VAX and P+V) had reduced levels of Enterococcus, Weisella, Anaerofustis, Clostridium, and Coprabacillus versus PRO

(Figures 2-14A through E; P < 0.001). Conversely, the Erysipelotrichaceae taxon Cc-115 levels were elevated in P+V birds versus PRO (Figure 2-14F; P < 0.05). Looking at the species level,

Lactobacillus vaginalis levels were distinctly lower in VAX birds (CON and P+V, Figure 2-6A;

P < 0.001). Clostridium species were impacted by treatment, as C. lavalense and C. symbiosum were decreased in vaccinated birds versus PRO (Figures 2-6B, D; P < 0.001). However, C. aldense was decreased in P+V birds alone versus PRO and VAX (Figure 2-6C, P < 0.05). Fae- calibacterium prausnitzii levels were decreased in P+V versus VAX (Figure 2-6E, P < 0.05).

Lastly, Akkermansia muciniphila, a member of the Verrucomicrobia phylum, was starkly elevated in VAX birds versus PRO and P+V (Figure 2-6F, P < 0.001).

Additionally, a Gneiss heatmap was used to construct microbial balance trees between treatment groups (Figure 2-15 and Table 2-2). Given estimating abundance levels inherently has 34 its own limitations given lack of ability to absolutely quantify bacteria via 16S rRNA analyses

(20), we used these data to support abundance shifts of specific taxa as well as identifying other taxa which could facilitate these shifts (hence their placement in these nodes via similar changes in balance). Full microbial balance data are provided in our GitHub repository (see text footnote

1). Looking at OTUs, PRO birds were distinguished from VAX and P+V birds, and Enterobacte- riaceae, Weisella, Anaerofustis, and Coprabacillus were among the 1,384 total OTUs specific to

PRO birds within respective balances, supporting our previous findings. Furthermore, looking at the taxa level 463 OTUs were unique to VAX birds, including Akkermansia muciniphila, providing support that this taxon is specific to VAX birds. Lastly, 69 total OTUs were unique to P+V birds, including Cc-115 (Table 2-1).

Enterobacteriaceae Antigen-Specific IgA Positively Associated with Enterobacteriaceae Lev- els

In line with Enterobacteriaceae 16S rRNA abundance (Figure 2-7A), PRO birds had highest abundance of fecal Enterobacteriaceae determined by plating (Figure 2-7B; all groups, P

< 0.001). Using ELISA to assess IgA in SISs, PRO scrapings yielded greatest Enterobacteri- aceae-specific IgA levels compared to other groups (Figure 2-7C).

Certain Bacteria Positively Correlated with Specific Neurochemical Metabolites

Using a log transformation, there was a clear improvement in normalization of 16S rRNA data (Figures 2-16 and 2-17), improving conditions for performing a linear regression model.

Significant, though weak, positive correlations were found between norepinephrine and Entero- bacteriaceae (R2 = 0.21, P = 0.012; Figure 2-8A) and tyrosine and A. muciniphila (R2 = 0.24, P

= 0.011; Figure 2-8B). 35

Discussion

Chicken Ceca Is a Major Site for Neurochemical Metabolism, Although Only Catechola- mines Were Affected by Treatments

The impact of the gut microbiota on mammalian host behavior and emotions through neurochemical intermediates has been well-characterized (1, 2, 21). For example, spore-forming bacteria elevate tryptophan hydroxylase activity by colonic enterochromaffin cells, producing serotonin for local signaling or circulatory transportation (22, 23). Some probiotics can produce neurochemicals like GABA, which bind to cognate receptors on the intrinsic primary afferent neurons innervating the intestinal villi (24) or the epithelium itself (21). To the authors’ best knowledge, this is the first study to map neurochemicals in the chicken gut and correlate them to specific members of the chicken gut microbiota. The chicken cecum is the primary site for microbial fermentation in the gut (25). Thus, the cecum content serves as a potential reservoir of neurochemical metabolites derived from microbial synthesis, although the host secretes some neuroactive chemicals into the lumen (26).

In the avian brain, serotonin signaling plays a major role in aggression (27) and exploratory behaviors (28). In this study, we found no differences in serotonin metabolism in the chicken ceca between any treatment group. Notably, serotonin (and not 5-HIAA) was consistently detected in the ceca content, which suggests serotonin is selectively secreted into the intestinal lumen. This likely occurs via apical secretion by enterochromaffin cells (29). This release can occur via direct control from the microbiota (23) as well as a means for the host to regulate these commensal microbes (30). Although we did not find any differences in ceca serotonin metabolism between treatment groups, there is evidence live prophylactics can have an influence. In 36 the zebrafish brain, supplementation of Lactobacillus rhamnosus IMC 501 modulated transcription of enzymes involved in serotonin production (31). Future studies could focus on the avian brain to further investigate the extraintestinal impacts of probiotics and live vaccines.

In this study, treatments uniquely affected levels of catecholamines in both ceca tissue and content. L-DOPA, the precursor to dopamine, was detected at the highest levels in ceca tissue in P+V birds. Furthermore, L-DOPA levels were associated with 3,4-dihydroxyphenylacetic acid (DOPAC), the waste metabolite of dopamine. Thus, it appears the combination of probiotics and RASV increased L-DOPA synthesis in the ceca, which resulted in excretion of dopaminergic waste metabolites primarily in the form of DOPAC. Notably, overall levels of homovanillic acid

(HVA) and DOPAC combined were much greater than the sum of norepinephrine and epinephrine. This suggests intestinal dopamine in birds may be predominately degraded into waste metabolites rather than being utilized for catecholamine synthesis, aligning with what is observed in mammals (32-34). Increased L-DOPA in the chicken ceca tissue may be an indication of an increased abundance of non-neural cellular populations in the lamina propria (34) like regulatory T cells (Tregs), which express high levels of tyrosine hydroxylase (35) and play a crucial role in maintaining gut homeostasis (36). Current studies are underway to determine whether changes

Treg abundances or other functions like gut motility (37) are related to L-DOPA concentrations in the ceca.

RASV Causes Major Rift in Gut Microbiome Diversity

The RASV χ9373 contains a number of genetic modifications, including a pmi deletion

(38). This particular gene encodes 6-phosphomannose isomerase, which when missing ablates 37 lipopolysaccharide (LPS) synthesis in the absence of mannose, resulting in increased complement and macrophage-mediated lysis of the bacterium (16). Other live Salmonella vaccines contain similar genetic attenuations to reduce virulence in vivo (16).

In young chicks, wild-type Salmonella infection causes major rifts in the ceca microbiome (39). Despite its attenuation, the RASV given to the chicks in this study drastically reduced beta diversity in treated groups, particularly decreasing the abundances of short chain fatty acid

(SCFA)-producing fermenters like Clostridium (40) and Weisella (41). These reductions may have negative consequences on chicken health, as SCFAs have numerous benefits for the host

(42, 43). Since the RASV was given at 4 days old, it likely triggered an inflammatory response, which altered the gut microbiome. Additionally, in this study, treating chickens with probiotics prior to RASV immunization, could have allowed birds to acquire a gut microbiota, which could have improved vaccine response (44) and disease resistance (15). However, future studies could test different Salmonella vaccines (genetic attenuations, serotype, etc) as well as their effects at different time points.

Certain Gut Bacteria Were Correlated with Neurochemical Metabolites

A positive correlation was detected between tyrosine and A. muciniphila levels, as both were higher in birds given the RASV only. A. muciniphila is a mucus-degrading bacterial taxon, which has garnered much interest due to its implicated health benefits (45). Mucin, produced by goblet cells in the intestinal tract and the major component of mucus, is a glycoprotein composed of several amino acids including tyrosine (46). Thus, it is possible the increase in A. muciniphila in the chicken ceca results in greater mucin degradation and, subsequently, tyrosine levels, which might directly affect bacterial abundances in the gut via its use as substrate (47). 38

Although oral live vaccines can improve mucosal immune responses (48), it has not been reported these live vaccines increase mucus production as well. Thus, given the lack of improved

IgA production upon RASV immunization in this study, it is possible this live vaccine could have stimulated an increase in mucus production, improving intestinal barrier integrity. LPS (49) and wild-type S. Typhimurium (50) increase mucin production directly, suggesting this RASV could have induced a similar response. Interestingly, the addition of probiotics to the RASV ablated this effect. Future studies will seek to directly measure mucus thickness in vaccinated birds and how probiotics may interfere with mucin biosynthesis.

Our study supports the positive relationship between norepinephrine and Enterobacteri- aceae. Norepinephrine has been demonstrated to increase the growth of Enterobacteriaceae pathogens (51, 52) through quorum sensing (53). In this study, PRO birds exhibited the greatest levels of both norepinephrine and Enterobacteriaceae 16S rRNA reads in the ceca content, and this was supported by corresponding levels of Enterobacteriaceae fecal shedding. This observation seemingly contradicts the reputation of probiotics to inhibit GI pathogen colonization in the host (5, 6). However, this response to norepinephrine is not limited to pathogenic Enterobacteri- aceae, as non-pathogenic E. coli also respond to norepinephrine (54).

It is unlikely our probiotics are increasing norepinephrine production by the enteric nervous system, as there were not corresponding increases in metabolites, which would precede norepinephrine biosynthesis (i.e., L-DOPA) in the PRO group. Norepinephrine is commonly deactivated by the host during excretion via glucuronide conjugation. Notably, E. coli use beta-glucuronidase to deconjugate this form of norepinephrine in the gut (55). Thus, it is likely the probiotic mix increased commensal Enterobacteriaceae abundance, and this increase resulted in greater conversion of norepinephrine to its free form in the ceca. Whether increased availability 39 of norepinephrine has an impact on the virulence of these Enterobacteriaceae (given its role as a quorum sensing ligand) remains to be investigated.

Furthermore, E. coli respond to norepinephrine via sensor kinase QseC, which upon activation increase transcription of tynA and feaB, whose protein products convert norepinephrine to

DHMA (54). Although these authors proposed gut E. coli or other resident microbes convert norepinephrine to DHMA, in the present study we did not find corresponding levels of DHMA in the ceca content, suggesting factors crucial to the gut ecosystem, such as bile acids, SCFAs, humoral immune effectors, microbiota, neurochemical metabolites (all absent in their model) may influence this proposed pathway.

Ceca Enterobacteriaceae Levels Associated with Intestinal IgA Levels

Given our observation of greater levels of Enterobacteriaceae in the PRO group, we hypothesized this had implications on host fecal shedding and mucosal responses. SISs from PRO birds contained the highest levels of anti-IutA and IroN IgA, associated with greater Enterobac- teriaceae levels. IutA and IroN are iron siderophore receptors commonly found in extraintestinal pathogenic E. coli, which are commensals in the chicken intestine (56). Thus, increases in these

IgA may decrease risks for APEC infection by interfering with APEC translocation into the bloodstream at mucosal surfaces like the lung via connections between the gut-lung axis (57).

Furthermore, why the RASV ablates the effect of probiotic-mediated increase in IgA and Entero- bacteriaceae is unclear. Given the aforementioned decrease of SCFA-producing microbes in

P+V birds, it is likely the ecological “restaurants” that break fiber down into accessible, simple- sugar substrates for Enterobacteriaceae are being altered (58). Thus, vaccination with RASV may change these micro-niches within the GI tract, augmenting Enterobacteriaceae colonization, 40 which is supported by the lower abundances of Enterobacteriaceae in the ceca and feces of vaccinated birds.

Conclusion

In conclusion, we show that treatment with probiotics and/or RASV results in unique catecholamine and microbiome profiles in the gut (summarized in Figure 2-9). Importantly, these changes appear to be related in certain circumstances and have implications on local humoral responses against particular pathogens. Additionally, we provide a provisional mechanism in which dopaminergic metabolism occurs in the chicken ceca. This study is the first to correlate neurochemical metabolites with microbiome data in the chicken model, which has important implications for disease susceptibility as well as behavior. Future studies will investigate how individual microbes within the probiotic mix as well as the RASV strain itself may contribute to these observed mechanisms, as well as using greater numbers of birds, which could be more representative of commercial poultry conditions.

Data availability statement

The datasets generated for this study can be found in the NCBI Sequence Read Archive

(SRA) repository with accession BioProject ID SUB5641933.

Author Contributions

MM conceived and designed the experiments. GR, KD, and MM performed the experiments. GR, KD, AS, ML, and MM analyzed the data. ML and MM contributed the reagents, materials, and analysis tools. GR and MM wrote the manuscript. KD, ML, and MM revised the manuscript. All authors read and approved the final version of the manuscript. 41

References

1. Rhee SH, Pothoulakis C, Mayer EA. Principles and clinical implications of the brain-gut- enteric microbiota axis. Nat Rev Gastroenterol Hepatol. (2009) 6:306–314. doi: 10.1038/nrgastro.2009.35

2. Lyte M. Microbial endocrinology: an ongoing personal journey. Adv Exp Med Biol. (2016) 874:1–24. doi: 10.1007/978-3-319-20215-0_1

3. Villageliú DN, Lyte M. Microbial endocrinology: why the intersection of microbiology and neurobiology matters to poultry health. Poult Sci. (2017) 96:2501–2508. doi: 10.3382/ps/pex148

4. Fuller R. Probiotics in man and animals. J Appl Bacteriol. (1989) 66:365–378. doi: 10.1111/j.1365-2672.1989.tb05105.x

5. Patterson JA, Burkholder KM. Application of prebiotics and probiotics in poultry production. Poult Sci. (2003) 82:627–631. doi: 10.1093/ps/82. 4.627

6. Kabir SM. The role of probiotics in the poultry industry. Int J Mol Sci. (2009) 10:3531– 3546. doi: 10.3390/ijms10083531

7. FAO (2016). “Probiotics in animal nutrition – production, impact, and regulation by S. Bajagai, Athol V. Klieve, Peter J. Dart and Wayne L. Bryden,” in FAO Animal Production Health paper No. 179, ed. H. P. S. Makkar (Rome: FAO).

8. Lyte M. (2011). Probiotics function mechanistically as delivery vehicles for neuroactive compounds: microbial endocrinology in the design and use of probiotics. Bioessays 33:574–581. doi: 10.1002/bies.201100024

9. Hassan JO, Curtiss R III. Efficacy of a live avirulent Salmonella typhimurium vaccine in preventing colonization and invasion of laying hens by Salmonella typhimurium and Sal- monella enteritidis. Avian Dis. (1997) 41:783–791. doi: 10.2307/1592330

10. Batz M, Hoffmann S, Morris J. Ranking the disease burden of 14 pathogens in food sources in the United States using attribution data from outbreak investigations and expert elicitation. J Food Protect. (2012) 75:1278–1291. doi: 10.4315/0362-028X.JFP-11-418

11. Muniz EC, Verdi R, Leão JA, Back A, Nascimento VPD. Evaluation of the effectiveness and safety of a genetically modified live vaccine in broilers challenged with Salmonella Heidelberg. Avian Pathol. (2017) 46:676–682. doi: 10.1080/03079457.2017.1348598

12. Dórea FC, Cole DJ, Hofacre C, Zamperini K, Mathis D, Doyle MP, et al. Effect of Salmo- nella vaccination of breeder chickens on contamination of broiler chicken carcasses in integrated poultry operations. Appl Environ Microbiol. (2010) 76:7820–7825. doi: 10.1128/AEM.01320-10

13. Karavolos MH, Spencer H, Bulmer DM, Thompson A, Winzer K, Williams P, et al. Adren- aline modulates the global transcriptional profile of Salmonella revealing a role in the antimicrobial peptide and oxidative stress resistance responses. BMC Genomics (2008) 9:458. doi: 10.1186/1471-2164-9-458

14. Pullinger GD, Carnell SC, Sharaff FF, van Diemen PM, Dziva F, Morgan E, et al. Norepi- nephrine augments Salmonella enterica induced enteritis in a manner associated with increased net replication but independent of the putative adrenergic sensor kinases QseC and QseE. Infect. Immun. (2010) 78:372–380. doi: 10.1128/IAI.01203-09

15. Redweik GAJ, Stromberg ZR, Van Goor A, Mellata M. Protection against avian pathogenic Escherichia coli and Salmonella Kentucky exhibited in chickens given both probiotics and live Salmonella vaccine. Poult Sci. (2020) 99:752–762. doi: 10.1016/j.psj.2019.10.038

16. Curtiss R, Xin W, Li Y, Kong W, Wanda S, Gunn B, et al. New technologies in using recombinant attenuated Salmonella vaccine vectors. Crit Rev Immunol. (2010) 30:255– 270. doi: 10.1615/critrevimmunol.v30.i3.30

17. Pei Y, Parreira V, Roland K, Curtiss R, Prescott J. Assessment of attenuated Salmonella vaccine strains in controlling experimental Salmonella typhimurium infection in chickens. Can J Vet Res. (2014) 78:23–30.

18. Villageliú DN, Rasmussen S, Lyte M. A microbial endocrinology-based simulated small intestinal medium for the evaluation of neurochemical production by gut microbiota. FEMS Microbiol Ecol. (2018) 94:1–9. doi: 10.1093/ femsec/fiy096

19. Mellata M, Mitchell NM, Schödel F, Curtiss R, Pier GB. Novel vaccine antigen combinations elicit protective immune responses against Escherichia coli sepsis. Vaccine (2016) 34:656–662. doi: 10.1016/j.vaccine.2015.12.014

20. Morton JT, Sanders J, Quinn RA, McDonald D, Gonzalez A, Vazquez-Baeza Y, et al. Bal- ance trees reveal microbial niche differentiation. mSystems (2017) 2:e00162-16. doi: 10.1128/mSystems.00162-16

21. Cryan JF, Dinan TG. Mind-altering microorganisms: the impact of the gut microbiota on brain and behaviour. Nat Rev Neurosci. (2012) 13:701–712. doi: 10.1038/nrn3346

22. Wikoff WR, Anfora AT, Liu J, Schultz PG, Lesley SA, Peters EC, et al. Metabolomics analysis reveals large effects of gut microflora on mammalian blood metabolites. Proc Nat Acad Sci USA. (2009) 106:3698–3703. doi: 10.1073/pnas.0812874106

23. Yano JM, Yu K, Donaldson GP, Shastri GG, Ann P, Ma L, et al. Indigenous bacteria from the gut microbiota regulate host serotonin biosynthesis. Cell. (2015) 161:264–276. doi: 10.1016/j.cell.2015. 02.047

24. Forsythe P, Kunze WA. Voices from within: gut microbes and the CNS. Cell Mol Life Sci. (2013) 70:55–69. doi: 10.1007/s00018-012- 1028-z

25. Svihus B, Choct M, Classen HL. Function and nutritional roles of the avian caeca: a review. Worlds Poult Sci J. (2013) 69:249–264. doi: 10.1016/j.vetmic. 2013.11.019

26. Lyte M. Microbial endocrinology and the microbiota-gut-brain axis. Adv Exp Med Biol. (2014) 817:3–24. doi: 10.1007/978-1-4939-0897-4_1

27. Dennis RL, Chen ZQ, Cheng HW. Serotonergic mediation of aggression in high and low aggressive chicken strains. Poult Sci. (2008) 87:612–620. doi: 10.3382/ps.2007-00389

28. Dennis RL, Lay DC, Cheng HW. Effects of early serotonin programming on behavior and central monoamine concentrations in an avian model. Behav Brain Res. (2013) 253:290– 96. doi: 10.1016/j.bbr.2013.07.043

29. Fujimiya M, Okumiya K, Kuwahara A. Immunoelectron microscopic study of the luminal release of serotonin from rat enterochromaffin cells induced by high intraluminal pressure. Histochem Cell Biol. (1997) 108:105–113. doi: 10.1007/s004180050151

30. Kwon YH, Wang H, Denou E, Ghia J-E, Rossi L, Fontes ME, et al. Modulation of gut microbiota composition by serotonin signaling influences intestinal immune response and susceptibility to colitis. Cell Mol Gastroenterol Hep. (2019) 7:709–728. doi: 10.1016/j.jcmgh.2019.01.004

31. Borrelli L, Aceto S, Agnisola C, De Paolo S, Dipineto L, Stilling RM, et al. Probiotic modulation of the microbiota-gut-brain axis and behaviour in zebrafish. Sci. Rep. (2016) 6:30046. doi: 10.1038/srep30046

32. Kopin IJ. Catecholamine metabolism: basic aspects and clinical significance. Pharmacol Rev. (1985) 37:333–64.

33. Lambert GW, Eisenhofer G, Cox HS, Horne M, Kalff V, Kelly M, et al. Direct determination of homovanillic acid release from the human brain, an indicator of central dopaminergic activity. Life Sci. (1991) 49:1061–72. doi: 10.1016/0024-3205(91)90593-z

34. Eisenhofer G, Aneman A, Friberg P, Hooper D, Fåndriks L, Lonroth H, et al. Substantial production of dopamine in the human gastrointestinal tract. J Clin Endocrinol Metab. (1997) 82:3864–71. doi: 10.1210/jcem.82. 11.4339

35. Cosentino M, Fietta AM, Ferrari M, Rasini E, Bombelli R, Carcano E, et al. Human CD4+CD25+ regulatory T cells selectively express tyrosine hydroxylase and contain endogenous catecholamines subserving an autocrine/paracrine inhibitory functional loop. Blood (2007) 109:632–42. doi: 10. 1182/blood-2006-01-028423

36. Barnes M, Powrie F. Regulatory T cells reinforce intestinal homeostasis. Immunity (2009) 31:401–11. doi: 10.1016/j.immuni.2009. 08.011

37. Li Z, Schmauss C, Cuenca A, Ratcliffe E, Gershon M. Physiological modulation of intestinal motility by enteric dopaminergic neurons and the D2 receptor: analysis of dopamine receptor expression, location, development, and function in wild-type and knock-out mice. J Neurosci. (2006) 26:2798–2807. doi: 10.1523/JNEUROSCI.4720-05.2006

38. Pei Y, Parreira V, Roland K, Curtiss R, Prescott J. Assessment of attenuated Salmonella vaccine strains in controlling experimental Salmonella typhimurium infection in chickens. (2014) Can J Vet Res. 78:23–30.

39. Liu L, Lin L, Zheng L, Tang H, Fan X, Xue N, et al. Cecal microbiome profile altered by Salmonella enterica, serovar Enteritidis inoculation in chicken. Gut Pathog. (2018) 10:34. doi: 10.1186/s13099-018-0261-x

40. Lopetuso LR, Scaldaferri F, Petito V, Gasbarrini A. Commensal Clostridia: leading players in the maintenance of gut homeostasis. Gut Pathog. (2013) 5:23. doi: 10.1186/1757-4749- 5-23

41. Patel A, Falck P, Shah N, Immerzeel P, Adlercreutz P, Stalbrand H, et al. Evidence for xylooligosaccharide utilization in Weisella strains isolated from Indian fermented foods and vegetables. FEMS Mirobiol. Lett. (2013) 346:20–28. doi: 10.1111/1574-6968.12191

42. Koh A, De Vadder F, Kovatcheva-Datchary P, Bäckhed F. From dietary fiber to host phys- iology: short-chain fatty acids as key bacterial metabolites. Cell. (2016) 165:1332–1345. doi: 10.1016/j.cell.2016.05.041

43. Wu W, Xiao Z, An W, Dong Y, Zhang B. Dietary sodium butyrate improves intestinal development and function by modulating the microbial community in broilers. PLoS ONE (2018) 13:e0197762. doi: 10.1371/journal. pone.0197762

44. Ciabattini A, Olivieri R, Lazzeri E, Medaglini D. Role of the microbiota in the modulation of vaccine immune responses. Front Microbiol. (2019) 10:1305. doi: 10.3389/fmicb.2019.01305

45. Naito Y, Uchiyama K, Takagi T. A next-generation beneficial microbe. J Clin Biochem Nutr. (2018) 63:33–35. doi: 10.3164/jcbn.18-57

46. Smirnov A, Sklan D, Uni Z. Mucin dynamics in the chick small intestine are altered by starvation. J Nutr. (2004) 134:736–42. doi: 10.1093/jn/134. 4.736

47. Mardinoglu A, Shoaie S, Bergentall M, Ghaffari P, Zhang C, Larsson E, et al. The gut microbiota modulates host amino acid and glutathione metabolism in mice. Mol Syst Biol. (2015) 11:834. doi: 10.15252/msb.2015 6487

48. Kim SH, Jang YS. The development of mucosal vaccines for both mucosal and systemic immune induction and the roles played by adjuvants. Clin Exp Vaccine Res. (2017) 6:15– 21. doi: 10.7774/cevr.2017.6.1.15

49. Smirnova MG, Guo L, Birchall JP, Pearson JP. LPS upregulates mucin and cytokine mRNA expression and stimulates mucin and cytokine secretion in goblet cells. Cell Immu- nol. (2003) 221:42–49. doi: 10.1016/ s0008-8749(03)00059-5

50. Zarepour M, Bhullar K, Montero M, Ma C, Huang T, Velcich A, et al. The mucin Muc2 limits pathogen burdens and epithelial barrier dysfunction during Salmonella enterica serovar Typhimurium colitis. Infect Immun. (2013) 81:3672–83. doi: 10.1128/IAI.00854- 13

51. Freestone PP, Haigh RD, Lyte M. Blockade of catecholamine-induced growth by adrenergic and dopaminergic receptor antagonists in Escherichia coli O157:H7. BMC Microbiol. (2007) 7:8. doi: 10.1186/1471-2180-7-8

52. Freestone PP, Haigh RD, Lyte M. Specificity of catecholamine-induced growth in Esche- richia coli O157:H7. FEMS Microbiol Lett. (2007) 269:221–28. doi: 10.1111/j.1574- 6968.2006.00619.x

53. Clarke MB, Hughes DT, Zhu C, Boedeker EC, Sperandio V. The QseC sensor kinase: a bacterial adrenergic receptor. Proc Natl Acad Sci USA. (2006) 103:10420–25. doi: 10.1073/pnas.0604343103

54. Pasupuleti S, Sule N, Cohn WB, MacKenzie DS, Jayaraman A, Manson MD. Chemotaxis of Escherichia coli to norepinephrine (NE) requires conversion of NE to 3,4-dihydroxymandelic acid. J Bacteriol. (2014) 196, 3992–4000. doi: 10.1128/JB.02065-14

55. Asano Y, Hiramoto T, Nishino R, Aiba Y, Kimura T, Yoshihara K, et al. Critical role of gut microbiota in the production of biologically active, free catecholamines in the gut lumen of mice. Am J Physiol Gastrointest Liver Physiol. (2012) 303:1288–95. doi: 10.1152/ajpgi.00341.2012

56. Mellata M. Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog Dis. (2013) 10:916–932. doi: 10.1089/fpd.2013.1533

57. Samuelson DR, Welsh DA, Shellito JE. Regulation of lung immunity and host defense by the intestinal microbiota. Front Microbiol. (2015) 6:1085. doi: 10.3389/fmicb.2015.01085

58. Conway T, Cohen PS. Commensal and pathogenic Escherichia coli metabolism in the gut. Microbiol Spectr. (2015) 3:1–24. doi: 10.1128/microbiolspec.MBP-0006-2014

Figures and Tables

Figure 2-1. Overview of study. Four groups of birds were evenly split into two rooms, one group given probiotics per room. At 4 and 18 days, birds received recombinant attenuated Salmonella vaccine χ9373 (RASV) or PBS as a control. Samples were collected at days 25 and 35 (A), which were then used for subsequent analyses (B). Summary of abbreviations used in this study for treatment groups (C). Probiotic CFUs in mix (D). Genotypic details of the RASV (E).

Figure 2-2. Detection of serotoninergic metabolites in chicken intestine. (A) serotonin and (B) 5-HIAA acid in ceca content, ceca tissue, and small intestinal scrapings. Each dot represents an individual animal, bars represent mean ± standard deviation. White, CON; yellow, PRO; blue, VAX; green, P+V.

Figure 2-3. Detection of catecholamine metabolites in chicken intestine. (A) tyrosine, (B) DO- PAC, (C) norepinephrine, (D) DHMA, (E) L-DOPA, (F) HVA, and (G) epinephrine in ceca content, ceca tissue, and small intestinal scrapings. Each dot represents an individual animal, bars represent mean ± standard deviation. *, P < 0.05; **, P < 0.01. White, CON; yellow, PRO; blue, VAX; green, P+V. 49

Figure 2-4. Beta diversity plots of ceca microbiome from individual birds. Bray–Curtis (A-C) and Jaccard (D-F) PCoA two-dimensional plots comparing beta diversity clustering along different diversity axes. Each sphere represents an individual bird, colored per respective group. Figures were generated by QIIME2 software. Yellow, PRO; blue, VAX; green, P+V.

Figure 2-5. Microbial phyla relative frequencies in the chicken ceca by treatment group. Fre- quencies were generated by QIIME2 software. VAX, vaccine-only. PRO, probiotics only. P+V, vaccine and probiotics combination.

Figure 2-6. Bacterial abundances of bacterial species influenced by treatment group. 16S rRNA reads for (A) Lactobacillus vaginalis, (B) Clostridium lavalense, (C) Clostridium aldense, (D) Clostridium symbiosum, (E) Faecalibacterium prausnitzii, and (F) Akkermansia muciniphila were generated by QIIME2 software, and figures were developed on GraphPad. Each dot represents an individual animal, bars represent mean ± standard deviation. Yellow, PRO; blue, VAX; green, P+V. *, P < 0.05; ***, P < 0.001.

Figure 2-7. Enterobacteriaceae levels in ceca, feces and antigen-specific IgA production are positively associated. (A) Enterobacteriaceae 16S rRNA reads generated by QIIME2 (n = 10 per group). (B) Enterobacteriaceae enumerated on MacConkey from feces (n = 3 per group, experimentally duplicated). (C) Antigen-specific and total IgA levels in small intestinal scrapings (IutA, aerobactin; IroN, salmochelin; LPS, lipopolysaccharide; experimentally duplicated). Each dot represents an individual animal, bars represent mean ± standard deviation. White, CON; yellow, PRO; blue, VAX; green, P+V. *, P < 0.05; **, P < 0.01; ***, P < 0.001. 52

Figure 2-8. Neurochemical metabolites positively correlated with microbial taxa in ceca content. Data were generated via R software. (A) Norepinephrine:Enterobacteriaceae; (B) tyrosine:Akkermansia muciniphila; (C), coefficient of determination (R2) and P value for each correlation. Yellow, PRO; blue, VAX; green, P+V.

Figure 2-9. Proposed interactions between neurochemical metabolites, bacteria, and IgA in the chicken ceca. NE, Norepinephrine; DOPAC, 3,4-dihydroxyphenylacetic acid; L-DOPA, L- 3,4-dihydroxyphenylalanine. 53

Figure 2-10. Fecal shedding of RASV χ9373 in chickens. Feces (n = 5 per group) were collected 1-week post-primary RASV immunization and plated on MacConkey agar for RASV enumeration. Each dot represents an individual animal, bars represent mean ± standard deviation. CON, no- treatment control. PRO, probiotics only. VAX, vaccine-only. P+V, vaccine and probiotics combination.

Figure 2-11. Impact of treatment on microbial alpha diversity in the chicken ceca. (A) Faith’s PD (richness), (B) evenness plots. Figures were generated via QIIME2 software. ∗P < 0.05. Yel- low, PRO; blue, VAX; green, P+V.

Figure 2-12. Bacterial abundances of specific classes influenced by treatment group. 16S rRNA reads for Clostridia and Gammaproteobacteria were generated by QIIME2 software, and figures were developed on GraphPad. Each dot represents an individual animal, bars represent mean ± standard deviation. Yellow, PRO; blue, VAX; green, P+V. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 2-13. Bacterial abundances by family influenced by treatment group. 16S rRNA reads for (A) Lachnospiraceae, (B) Peptostreptococcaceae, and (C) Mogibacteriaceae were generated by QIIME2 software, and figures were developed on GraphPad. Each dot represents an individual animal, bars represent mean ± standard deviation. Yellow, PRO; blue, VAX; green, P+V. *, P < 0.05; **, P < 0.01.

Figure 2-14. Bacterial genera influenced by treatment group. 16S rRNA reads for (A) Enter- ococcus, (B) Weisella, (C) Anaerofustis, (D) Clostridium, (E) Coprabacillus, and (F) Cc-115 were generated by QIIME2 software, and figures were developed on GraphPad. Each dot represents an individual animal, bars represent mean ± standard deviation. Yellow, PRO; blue, VAX; green, P+V. *, P < 0.05; ***, P < 0.001.

Figure 2-15. Gneiss heatmap used to determine taxonomic shifts in microbial balances. Pro- biotics (PRO), Live Salmonella (VAX), and Probiotics and Live Salmonella (P+V). Figure was generated via QIIME2 analysis.

Figure 2-16. Plots for comparing normality of tyrosine:Akkermansia muciniphila linear regression models generated by R software. (A–D) No log transformation of A. muciniphila 16S rRNA reads. (E–H) Log-transformed A. muciniphila 16S rRNA reads.

Figure 2-17. Plots for comparing normality of norepinephrine:Enterobacteriaceae linear regression models generated by R software. (A–D) No log transformation of Enterobacteriaceae 16S rRNA reads. (E–H) Log-transformed Enterobacteriaceae 16S rRNA reads.

Table 2-1. Original 16S rRNA abundance data, HPLC data, and log-transformed 16S rRNA abundance data used for correlation analyses.

Chicken Group kBacteria kBacteria Con- Con- Enterobacteri- Akkermansia_mu- ID fEnterobac- Akkerman- tent_NE tent_Tyro- aceae_log ciniphila_log teriaceae sia_mucini- (µg/g) sine (µg/g) phila 30 PRO 801 1 4.075 0 2.904 0 32 PRO 4280 1 1.514 0 3.631 0 33 PRO 1533 17 3.199 0 3.186 1.230 36 PRO 1376 6 1.369 0 3.139 0.778 39 PRO 1181 1 1.761 0 3.072 0 40 PRO 599 1 1.677 0 2.777 0 41 VAX 523 4364 0 2.465 2.719 3.640 42 VAX 25 1729 2.069 2.418 1.398 3.238 45 VAX 47 4802 0 0 1.672 3.681 47 VAX 160 2008 0 2.068 2.204 3.303 49 VAX 15 5173 0 2.614 1.176 3.714 50 VAX 108 6675 0 3.604 2.033 3.824 53 VAX 384 1261 1.362 0 2.584 3.101 52 VAX 135 493 1.493 1.826 2.130 2.693 56 VAX 144 2375 0 2.135 2.158 3.376 58 VAX 412 1805 1.571 3.975 2.615 3.256 61 P+V 202 1 0 0 2.305 0 62 P+V 75 9 1.761 0 1.875 0.954 63 P+V 15 7 0 4.923 1.176 0.845 65 P+V 19 135 0 3.238 1.279 2.130 67 P+V 44 30 0 0 1.643 1.477 69 P+V 25 62 0 0 1.398 1.792 73 P+V 40 5 1.246 0 1.602 0.699 74 P+V 71 1 1.253 0 1.851 0 77 P+V 52 9 1.411 3.943 1.716 0.954 79 P+V 18 4 1.501 0 1.255 0.602

Table 2-2. Gneiss plugin output from QIIME2 analysis describing balance shifts via treatments. PRO, probiotics only; VAX, vaccine only; P+V, vaccine and probiotics combination.

Table 2-2 can be found following this link: https://www.frontiersin.org/arti- cles/10.3389/fmicb.2019.03064/full#supplementary-material

CHAPTER 3. EVALUATION OF LIVE BACTERIAL PROPHYLACTICS TO DE- CREASE INCF PLASMID TRANSFER IN CHICKEN GUT AND ASSOCIATION WITH INTESTINAL SMALL RNAS

Modified from a manuscript published in Frontiers in Microbiology

Graham A.J. Redweika,b, Mary Kate Horaka, Ryley Hovena, Logan Otta,b, and Melha Mellataa,b aDepartment of Food Science and Human Nutrition, Iowa State University, Ames, IA, USA; bIn- terdepartmental Microbiology Graduate Program, Iowa State University, Ames, IA, USA

Abstract

Chicken intestinal Escherichia coli are a reservoir for virulence and antimicrobial resistance (AMR) genes that are often carried on incompatibility group F (IncF) plasmids. The rapid transfer of these plasmids between bacteria in the gut contributes to the emergence of new multidrug-resistant and virulent bacteria that threaten animal agriculture and human health. Thus, the aim of the present study was to determine whether live bacterial prophylactics could affect the distribution of large virulence plasmids and AMR in the intestinal tract and the potential role of smRNA in this process. In this study, we tested ∼100 randomly selected E. coli from pullet feces (n = 3 per group) given no treatment (CON), probiotics (PRO), a live Salmonella vaccine

(VAX), or both (P+V). E. coli isolates were evaluated via plasmid profiles and several phenotypic (siderophore production and AMR), and genotypic (PCR for virulence genes and plasmid typing) screens. P+V isolates exhibited markedly attenuated siderophore production, lack of

AMR and virulence genes, which are all related to the loss of IncF and ColV plasmids (P <

0.0001). To identify a causal mechanism, we evaluated smRNA levels in the ceca mucus and found a positive association between smRNA concentrations and plasmid content, with both being significantly reduced in P+V birds compared to other groups (P < 0.01). To test this positive association between IncF plasmid transfer and host smRNA concentration, we evenly pooled 60 smRNA per group and treated E. coli mating pairs with serial concentrations of smRNA in vitro.

Higher smRNA concentrations resulted in greater rates of IncF plasmid transfer between E. coli donors (APEC O2 or VAX isolate IA-EC-001) and recipient (HS-4) (all groups; P < 0.05). Fi- nally, RNAHybrid predictive analyses detected several chicken miRNAs that hybridize with pilus assembly and plasmid transfer genes on the IncF plasmid pAPEC-O2-R. Overall, we demonstrated P+V treatment reduced smRNA levels in the chicken ceca, which was associated with a reduction in potentially virulent E. coli. Furthermore, we propose a novel mechanism in which intestinal smRNAs signal plasmid exchange between E. coli. Investigations to understand the changes in bacterial gene expression as well as smRNAs responsible for this phenomenon are currently underway.

Introduction

Plasmids are mobile genetic elements that can bolster a host bacterium’s fitness in harsh environments like the gastrointestinal tract by carrying genes encoding AMR (1), iron acquisition factors (2), and antimicrobial products like colicin (4). In poultry, many of these factors are commonly found in intestinal E. coli and other Enterobacteriaceae on narrow-range plasmids like incompatibility group F (IncF) (4-7). However, these factors may have negative consequences for the animal host, as a transfer of these genes can increase bacterial virulence potential and/or generate AMR pathogens (6). Thus, efforts for mitigating the transfer of these virulence and/or AMR plasmids should be a top priority for both animal agriculture and human medicine.

Conjugation inhibitors like unsaturated fatty acids (8) have been postulated as a means to reduce plasmid transfer. However, no treatment nor prophylactics (i.e., treatments used to proactively prevent disease) have yet been tested for their effect on plasmid transfer in the gut. Thus, a 61 greater understanding of which host factors influence bacterial conjugation as well as treatments to achieve this are imperative.

One such host factor may be small RNA (smRNA), a class of RNA molecules of less than 200 nucleotides in length. These smRNAs include species like microRNA (miRNA), which have intracellular regulatory and immune functions in plants and animals (9, 10). In chickens, miRNA expression profiles are augmented during bacterial infections with avian pathogenic

Escherichia coli (APEC) (11), a subset of extraintestinal pathogenic E. coli (ExPEC) (12), and

Salmonella enterica (13-14), suggesting that miRNA may have implications on resistance to bacterial infections. Recently, Liu and colleagues found that the composition of the gut microbiota was highly dependent on miRNA secreted by host intestinal cells into the lumen (15). However, how smRNA may influence bacterial activities like plasmid conjugation is unknown.

In addition to bacterial pathogens, non-pathogenic bacteria like probiotics (13) can affect chicken intestinal smRNA levels. Previously, we found that immunization with a live Salmonella vaccine reduced Enterobacteriaceae in the ceca and feces, regardless of probiotic supplementation (16). The aim of this study was to determine whether live prophylactics affect the level of E. coli carrying plasmids and genes encoding AMR and ExPEC virulence factors in the chicken intestine as well as whether this effect is correlated with smRNAs.

Materials and Methods

Ethics Statement

Chicken experiments were approved by Iowa State University Institutional Animal Care and Use Committee, log #1-16-8159-G. Animal distress was minimized during experimental procedures by providing enrichments and an open-floor setting (room temperatures ranging 73– 62

° 75 F maintained via heat lamps) to promote social interactions. Euthanasia techniques (CO2 asphyxiation followed by thoracotomy) followed the American Veterinary Medical Association

Guidelines (2013).

Experimental Design and Sample Sizes

Samples in this study were taken from chickens used in previous studies (16, 17). Briefly,

1- day-old specific pathogen-free White Leghorns (straight run mix of males and females;

VALO Biomedia, Adel, IA) fed Purina® Organic Starter-Grower were either orally vaccinated with an RASV alone (VAX), supplemented with a commercial probiotic supplement (Bacillus subtilis, Lactobacillus acidophilus, Pediococcus acidilactici, Pediococcus pentosaceus, Saccha- romyces pastorianus) alone (PRO), or treated with both (P+V). No treatment controls (CON) were included for comparison. Two weeks post-boost, feces were collected from three randomly selected birds per group, homogenized and serially diluted in PBS, and plated on MacConkey agar. Then, 100 random isolates were evenly selected among the three birds per group, streaked onto MacConkey agar, and stored in peptone-glycerol solution at -80°C for further analyses.

Ceca mucus, the physiological site for plasmid transfer in the chicken intestine (18) was collected from birds (n = 4–5 per group) at 3 weeks post-boost, flash-frozen, and stored at -80°C.

Phenotypic and Genotypic Assays

All isolates were streaked on LB agar (0.1% glucose) and preliminarily screened for E. coli conserved gene uidA (beta-glucuronidase; Table 3-3) to determine Enterobacteriaceae identity (19). All subsequent analyses solely used E. coli isolates to identify plasmid-associated phenotypes and genes associated with APEC. 63

Siderophore Production and Antibiotic Resistance. E. coli were picked onto CAS agar plates and incubated overnight (ON) at 37°C. Thereafter, oxidation rings were measured in mm.

Additionally, E. coli were picked onto LB plates spiked with tetracycline (TC; 15 µg/ml) or streptomycin (50 µg/ml) and incubated ON at 37°C. E. coli were determined to be resistant to respective antibiotics via positive growth. All in vitro assays were repeated twice for confirmation.

Virulence Gene and Plasmid-Typing PCR. Colony PCR was used with each E. coli isolate to screen for iss (increased serum survival), iutA (aerobactin receptor), iroN (salmochelin receptor), and hylF (hemolysin) virulence genes using the primers mentioned in Table 3-1 and

PCR conditions from respective references (5, 20-22). Furthermore, to characterize the types of plasmids possessed by each isolate, a previously established multiplex array for 18 incompatibility (Inc) groups found in E. coli (5) was performed using conditions as previously described (Ta- ble 3-4). Additionally, given that APEC virulence genes are commonly found on plasmids harboring the cvaC gene (i.e., colicin V or ColV plasmids), we screened all E. coli isolates for the presence of this gene (Table 3-4). All PCRs were repeated twice per isolate for confirmation.

Large Plasmid Profiling. Large plasmid content was determined in each isolate as previously described (23) with minor modifications. Briefly, each fecal isolate was cultured in 4 ml

LB broth (0.1% glucose) ON at 37°C, and 1 ml per culture was centrifuged at 10,000 × g at RT.

For isolates from conjugation experiments (see section “Inter-E. coli Conjugation-smRNA As- says”), transconjugants (i.e., TCRNAR) were cultured in 4 ml LB broth (0.1% glucose, 15 µg/ml

TC, and 30 µg/ml NA) ON at 37°C. Pellets were resuspended in 200 µl 1X TAE (pH 7.9) and

400 µl lysis buffer (0.02 M Tris, 0.4% SDS, 0.2 M NaOH; pH 12.7). Suspensions were gently mixed and incubated at 37°C for 50 min. Following incubation, 600 µl 1:1 phenol chloroform was added per isolate suspension, gently mixed, then centrifuged for 15 min at 10,000 × g. The 64 subsequent supernatants that contain plasmids were then loaded into a 0.5% TAE gel and ran via gel electrophoresis (40 V) for 860 min at 4°C. Gels were then stained via ethidium bromide and imaged via Azure Imager c300. E. coli reference strain 39R681 (24) was used as a ladder to measure plasmid sizes as done previously (25), which were calculated via GelAnalyzer 19.1 software.

Ceca smRNA Extraction and Quantification

Total smRNAs were extracted from ceca mucus (n = 4–5 per group) following mir-

Vana™ miRNA isolation kit (Ambion®) following the manufacturer’s procedure for smRNA purification. Subsequently, smRNAs were further purified using Amicon® Ultra-0.5 Centrifugal

Filter Devices (Millipore) as described previously (15). As calculated by NanoDrop 2000, the

A260/A280 ratios for all extracts were approximately 2.0, indicating an acceptable purity of the smRNAs. smRNA quantity was calculated via Qubit™ microRNA Assay Kit (which broadly detects small RNA molecules), and concentrations were calculated by adjusting for the weight (g) of each sample.

Inter-E. coli Conjugation-smRNA Assays

The APEC strain APEC O2 (TCR carried on IncF plasmid pAPEC-O2-R) was used to model the effect of ceca smRNA on transfer of IncF plasmids to the recipient commensal E. coli

HS-4 (NAR) (Table 3-1). Respective E. coli strains were cultured in LB broth (0.1% glucose) with appropriate selective antibiotics ON at 37°C, shaking at 225 rpm. The following day, cultures were adjusted to OD600 ∼0.1, centrifuged, and washed with LB broth (0.1% glucose) twice to remove antibiotics from original cultures. Afterward, APEC O2 and HS-4 were mixed 1:1, and 20 µl were added to each reaction on a 96-well plate. 65

Total smRNA extracted from chickens was pooled by group, serially diluted in LB broth

(0–50 ng per reaction), and 180 µl of solutions were aliquoted to respective reactions in duplicate. Conjugation assays were then incubated for 6 h at 41°C, and reactions were serially diluted in PBS and plated on MacConkey agar with various antibiotic compositions (15 µg/ml TC only;

30 µg/ml NA only; 30 µg/ml NA + 15 µg/ml TC) to enumerate donor, recipient, and transconjugant E. coli, respectively.

To determine if smRNA-effects on IncF plasmid transfer were not specific to pAPEC-

O2-R plasmid transfer, a VAX E. coli isolate (IA-EC-001; TCR; Table 3-1) was tested as a donor strain in separate conjugation assays. All conditions were kept the same except for an extended

° incubation for 10 h at 41 C, as IA-EC-001 was determined to optimally transfer TCR at this time.

RNAHybrid miRNA Target Predictions

The predictive binding of chicken miRNAs to the IncF plasmid pAPEC-O2-R genes was accomplished using the RNAHybrid pipeline as described previously (26, 27). Briefly, the complete DNA sequence of the APEC O2 IncF plasmid pAPEC-O2-R (NC_006671.1) was obtained from NCBI. The Gallus gallus specific miRNA library was then obtained by downloading the mature miRNA database (v22) from miRbase1 and extracting all sequences with the header text

“gga-miR-.” Predictive miRNA targets were determined by binding structure stability and sequence alignment outputs using RNAhybrid2 with the default settings. Alignments generating P- values less than 0.001 were considered significant bindings for further description. RNAhybrid alignments resulted in reported minimum free energy (MFE, kcal/mol) values with increasingly negative numbers indicating greater affinity binding. Full predictions are summarized in Table 3-

66 miRNA RT-qPCR and Mimic in vitro Assays

To confirm the presence of miRNA species from the top five host miRNA—IncF target gene interactions (see Table 3-2), total smRNA from each group was converted to cDNA via reverse transcription using the TaqMan Advanced miRNA cDNA Synthesis Kit. Thereafter, custom qPCR primers for each miRNA species were developed via TaqMan Advanced miRNA As- says, and qPCR was performed on StepOnePlus as per manufacturer instructions.

To investigate the role of individual chicken miRNAs in plasmid transfer, mimic miRNA for gga-miR-12267-3p (40-GGGUCGCCCCGGGUCUCGGUGU-61; miRbase accession

MIMAT0050029) was synthesized (Creative Biogene). After serial dilution in LB broth, mimic gga-miR-12267-3p was then added at different concentrations (0, 50 ng, or 2 µg per 200 µl reaction) to E. coli conjugation assays using donor APEC O2 and recipient HS-4 as described earlier to assess changes in pAPEC-O2-R transfer.

Statistical Analyses and Binary Heatmap Development

GraphPad Prism software version 6.0 (San Diego, CA) was used to calculate significance between treatment groups via one-way ANOVA followed by Tukey’s test for multiple means comparisons. P < 0.05 were considered significant. To summarize binary datasets (i.e., positive or negative) like PCR and antibiotic resistance, R package “d3heatmap” was used to construct binomial heat maps indicating the presence (i.e., green) or absence (i.e., black) of a particular gene, Inc group, or antibiotic resistance in each E. coli isolate. 67

Results

Fecal E. coli from P+V Group Exhibited Absence in IncFIB+ ColV+ Plasmids, Virulence Genes, and Phenotype

After plating feces from CON, PRO, VAX, and P+V birds on MacConkey, the vast majority of isolates (≥89% per group) were positive for the E. coli-specific marker uidA (Bej et al.,

1991) (Table 3-3). Proceeding with E. coli isolates from each group for screening, we found a significant decrease in siderophore production via CAS agar in P+V E. coli isolates (P < 0.0001;

Figure 3-1). Similarly, P+V E. coli were much more susceptible to tetracycline and streptomycin compared to E. coli from other groups (P < 0.0001; Figure 3-2). Using PCR to investigate whether other APEC-associated plasmidic genes were absent in P+V E. coli, iutA, hlyF, and iss were significantly decreased in P+V E. coli compared with other groups (P < 0.0001; Figure 3-

2). However, the presence of iroN was unchanged between groups (Figure 3-2). Additionally,

IncFIB and ColV plasmids were significantly reduced in P+V isolates compared to the other groups (P < 0.0001; Figure 3- 2). However, IncI1 plasmids were maintained in all groups, with nearly all P+V isolates tested harboring an IncI1 plasmid. Thus, only fecal E. coli from P+V birds exhibited a loss in virulence attributes, associated with an absence of specific plasmid- types.

Lack of Large Plasmids in Isolates Is Associated with Decreased Ceca smRNA Concentra- tion

Using phenol-chloroform plasmid-extraction for each isolate, P+V E. coli had significantly fewer large plasmids (>25 kb) compared to E. coli from the other groups (P < 0.0001;

Figure 3-3A). Notably, a single ∼100 kb plasmid was generally conserved in all P+V E. coli

(Figure 3-6).

Greater Ceca smRNA Concentrations Increased in vitro IncF Plasmid Transfer Between E. coli Mating Pairs

To identify a mechanism for this loss of plasmids, we hypothesized that host smRNAs may play a role in IncF plasmid transfer. In association with this loss of large plasmids, smRNA concentration in ceca mucus by weight was markedly lower in P+V birds vs. other groups (P <

0.01; Figure 3-3B). These data suggest a potential relationship between E. coli plasmid content and host smRNA levels.

Using in vitro conjugation assays with and without smRNA pooled within each group, we found that smRNA concentrations were positively associated with HS-4 transconjugant yields (P

< 0.01) using APEC O2 (Figure 3-4A), carrying TCR on the IncF plasmid pAPEC-O2-R (4) or

VAX isolate IA-EC-001 (IncFIB+ ColV+, this study; Figure 3-4B) as donor strains. Furthermore, this effect was generally independent of the treatment group, as this pattern was consistent in conjugation assays with smRNA from all treatment groups (Figure 3-4). Importantly, growth of donor or recipient strains was independent of smRNA concentration (Figure 3-7), suggesting that these smRNAs had a specific effect on conjugation and not E. coli growth during this time frame. To characterize the IA-EC-001 plasmids being transferred in this assay, transconjugants from each smRNA dilution per group (n = 10) were isolated and genotyped via PCR. Transfer of

TCR from the IA-EC-001 isolate to HS-4 recipients was consistent with transfer of the genes iutA, iroN, hlyF, and iss (Figure 3-5A). Furthermore, this was linked with IncF1B and ColV plasmid typing (Figure 3-5A), suggesting TCR and these genes were being carried on a single

IncFIB+ ColV+ plasmid. This assumption was further supported by consistent identification of a

∼125 kb plasmid found in every single transconjugant (Figure 3-5B). Finally, though a high proportion of transconjugants also received a ∼102 kb IncI1 plasmid (Figure 3-5), this was not consistently found among transconjugants as were the previous biomarkers. 69

Host miRNA Species Predicted to Target pAPEC-O2-R Genes

To determine whether specific smRNAs may affect IncF plasmid transfer, we first used

RNAHybrid to predict whether chicken miRNAs could hybridize with pAPEC-O2-R genes.

RNAHybrid analysis resulted in 74 bindings within known coding sequences with P-values below 0.001 when hybridized with the large antimicrobial resistance plasmid pAPEC-O2-R (Table

3-5). The top five high affinity bindings demonstrated minimum free energies of less than -44 kcal/mol and P-values below 0.0006 (Table 3-2). Although functions for these miRNAs have yet to be determined (28), their predicted gene targets are largely involved in F-pilus assembly and conjugal transfer proteins (Table 3-2). Using RT-qPCR to identify these miRNAs in our samples, we found that gga-miR-12267-3p was the only detectable miRNA species in all groups (Figure

3-8A). However, adding synthetic gga-miR-12267-3p miRNA to pAPEC-O2-R conjugation assays did not alter donor (APEC O2; Figure 3-8B), recipient (HS-4; Figure 3-8C), nor transconjugant abundances in vitro (Figure 3-8D).

Discussion

We report that live bacterial prophylactics, specifically the combination of probiotics and live Salmonella vaccine used in this study, reduced virulence trait and plasmid-containing E. coli in the chicken gut. The vast number of fecal E. coli isolates in this study possessed APEC virulence factors, suggesting there is a competitive advantage for possessing these genes in the intestine. However, there was a marked loss of iron-acquisition ability in P+V E. coli compared to the other groups. This loss was highly associated with the loss of iutA, which encodes the receptor for the aerobactin system. Notably, this system is a highly effective mode of iron acquisition compared to other systems and is crucial for inter-bacterial competition in the intestine (2, 29).

ExPEC, which cause extraintestinal diseases like urinary tract infections in mammalian models 70 and colibacillosis in avian species (12), are similar to commensal E. coli in genetic composition

(30) and their avid colonization of the animal intestinal tract (19, 31-33).

The absence of these virulence genes and phenotypes like AMR in P+V E. coli is directly related to the absence of IncFIB and ColV plasmids. These plasmid types carry virulence factors like iron acquisition systems (i.e., aerobactin and salmochelin), tetracycline and streptomycin- resistance, serum resistance (i.e., iss), and hemolysins (i.e., hylF) for APEC (4, 25, 34, 35). ColV plasmids classified by their possession of the cvaC gene, which encodes the antimicrobial com- pound colicin V and targets other Enterobacteriaceae (36). Given that APEC depend on plasmid virulence factors like iron acquisition and serum resistance for infection (25) upon fecal aerosoli- zation in young birds (37, 38), the reduction of these virulence attributes in commensal E. coli would dramatically lower risks of contracting colibacillosis. Interestingly, this prophylactic combination also enhanced systemic clearance of APEC infection in vivo via increased bactericidal responses in blood (17), suggesting P+V birds are protected from APEC infection via multiple mechanisms.

P+V treatment uniquely reduced smRNA in the ceca mucus, and intestinal smRNA concentrations were positively associated with IncF plasmid transfer in vitro. This is the first study to identify smRNA as a potential mediator for plasmid transfer in the animal intestine. Character- izing microbe-microbe interactions in the gut and how host genetics and factors drive these interactions has been a major gap in microbiome research (39). Host signals like catecholamines increase plasmid transfer in vitro, theoretically to promote bacteria to exchange genes during periods of acute stress in their host (40). In mice, smRNA species like miRNA are released via vesi- cles from epithelial cells into the gut lumen under homeostatic conditions (15). Thus, we hypoth- 71 esized that host miRNA may be a signal intestinal bacteria use to mediate plasmid transfer. Alt- hough several Gallus gallus miRNAs were predicted to interact with pAPEC-O2-R genes essential for the function and fertility of plasmid replication and conjugative transfer (41), we only detected one of these species, gga-miR-12267-3p, in our samples. Although gga-miR-12267-3p was predicted to bind to traP, a conjugal transfer protein carried on pAPEC-O2- R, its individual role in promoting plasmid transfer was not demonstrated in our conditions tested, suggesting the role of smRNAs may be multifactorial. Still, the question remains whether the smRNAs responsible for regulating plasmid transfer are of host or bacterial origin. For example, E. coli use finP, an antisense, non-coding, 79-nucleotide RNA molecule, which forms a complex with FinO to suppress plasmid transfer intracellularly (42, 43). Future studies will determine whether individual smRNA species (of host and/or bacterial origin) or a synergism between smRNAs are required to promote IncF plasmid transfer. Importantly, this study did not fully elucidate the role of a specific miRNA in intestinal IncF plasmid transfer in vivo. Future studies will use in vivo conjugation transfer experiments to confirm that smRNAs drive IncF plasmid transfer in the chicken intestine.

Uniquely, a single IncI1 plasmid and salmochelin receptor iroN remained highly conserved in P+V fecal E. coli, and IncI1 in vitro plasmid transfer by isolate IA-EC-001 was largely unaffected by smRNA concentration. The salmochelin operon is commonly found on IncI1 plasmids (44), which suggests this conserved IncI1 plasmid may be responsible for this observed iroN maintenance in P+V isolates. This suggests that intestinal smRNAs specifically target genes on IncF plasmids and do not affect the transfer of IncI1 plasmids. Reasons underlying the conser- vation of this particular IncI1 plasmid in P+V isolates are unclear. However, since IncF and

IncI1 plasmids have unique mechanisms for replication and transfer between bacterial hosts (45, 72

46), intestinal smRNAs could specifically target IncF genes involved in these processes, although this still remains to be confirmed.

In conclusion, our findings suggest the combination of these live prophylactics, despite not being specifically designed to target AMR and virulence plasmids, reduced abundances of

IncF virulence plasmids and associated ExPEC characteristics in fecal E. coli, by potentially reducing intestinal smRNA levels. This suggests that combining these probiotics and live vaccines may reduce antimicrobial resistance by reducing IncF plasmid transfer between intestinal E. coli as well as directly antagonizing Enterobacteriaceae colonization and infection (16, 17). How- ever, it should be noted that these samples were taken within a specific time window pre-lay and that these pullets were from the same flock. It is possible that changes in smRNA levels over time may occur (47) and thus could likely result in changes to bacterial conjugation in the chicken intestine. Furthermore, the environment plays a major role in microbiome development in poultry (48). Thus, this mechanism may be permissible to pullets exposed to one particular microbiome but perhaps not another. Current work is underway to understand these nuances as well as identify smRNA molecular mechanisms which drive plasmid transfer.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplemen- tary Material, further inquiries can be directed to the corresponding author/s.

Author Contributions

GR and MM conceived, designed the experiments, and wrote the manuscript. GR, RH,

MH, and LO performed the experiments and analyzed the data. GR, RH, MH, LO, and MM revised the manuscript. MM contributed to reagents, materials, and analysis tools. All authors read and approved the final manuscript.

References

1. Rolain JM. Food and human gut as reservoirs of transferable antibiotic resistance encoding genes. Front Microbiol. (2013) 4:173. doi: 10.3389/fmicb.2013.00173

2. Deriu E, Liu JZ, Pezeshki M, Edwards RA, Ochoa RJ, Contreras H, et al. Probiotic bacteria reduce Salmonella typhimurium intestinal colonization by competing for iron. Cell Host Microbe. (2013) 14:26–37. doi: 10.1016/j.chom.2013.06.007

3. Gordon DM, Riley MA, Pinou T. Temporal changes in the frequency of colicinogeny in Escherichia coli from house mice. Microbiology. (1998) 144(8):2233–2240. doi: 10.1099/00221287-144-8-2233

4. Johnson TJ, Siek KE, Johnson SJ, Nolan LK. DNA sequence and comparative genomics of pAPEC-O2-R, an avian pathogenic Escherichia coli transmissible R plasmid. Antimi- crob Agents Chemother. (2005) 49:4681–4688. doi: 10.1128/AAC.49.11.4681-4688.2005

5. Johnson TJ, Wannemuehler YM, Johnson SJ, Logue CM, White DG, Doetkott C, et al. Plasmid replicon typing of commensal and pathogenic Escherichia coli isolates. Appl En- viron Microbiol. (2007) 73:1976–1983. doi: 10.1128/AEM.02171-06

6. Johnson TJ, Thorsness JL, Anderson CP, Lynne AM, Foley SL, Han J, et al. Horizontal gene transfer of a ColV plasmid has resulted in a dominant avian clonal type of Salmonella enterica serovar Kentucky. PLoS ONE. (2010) 5:e15524. doi: 10.1371/journal.pone.0015524

7. Yang QE, Sun J, Li L, Deng H, Liu BT, Fang LX, et al. IncF plasmid diversity in multidrug resistant Escherichia coli strains from animals in China. Front Microbiol. (2015) 6:964. doi: 10.3389/fmicb.2015.00964

8. Getino M, Sanabria-Ríos DJ, Fernández-López R, Campos-Gómez J, Sánchez-López JM, Fernández A, et al. Synthetic fatty acids prevent plasmid-mediated horizontal gene transfer. mBio. (2015) 6:e001032-15. doi: 10.1128/mBio.01032-15

9. Liu SR, Zhou JJ, Hu CG, Wei CL, Zhang JZ. MicroRNA-mediated gene silencing in plant defense and viral counter-defense. Front Microbiol. (2017) 8:1801. doi: 10.3389/fmicb.2017.01801

10. Zhou X, Li X, Wu M. miRNAs reshape immunity and inflammatory responses in bacterial infection. Signal Transduct Target Ther. (2018) 3:14. doi: 10. 1038/s41392-018-0006-9

11. Jia X, Nie Q, Zhang X, Nolan LK, Lamont SJ. Novel MicroRNA involved in host response to avian pathogenic Escherichia coli identified by deep sequencing and integration analysis. Infect Immun. (2017) 85:e00688-16. doi: 10.1128/IAI.00688-16

12. Mellata, M. (2013). Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog. Dis. 10, 916–932. doi: 10.1089/fpd.2013.1533

13. Chen Q, Tong C, Ma S, Zhou L, Zhao L, Zhao X. Involvement of MicroRNAs in probiotics-induced reduction of the cecal inflammation by Salmonella typhimurium. Front Immu- nol. (2017) 8:704. doi: 10.3389/fimmu.2017.00704

14. Wu G, Qi Y, Liu X, Yang N, Xu G, Liu L, et al. Cecal MicroRNAome response to Salmo- nella enterica serovar enteritidis infection in White Leghorn Layer. BMC Genomics (2017) 18:77. doi: 10.1186/s12864-016-3413-8

15. Liu S, da Cunha AP, Rezende RM, Cialic R, Wei Z, Bry L, et al. The host shapes the gut microbiota via fecal MicroRNA. Cell Host Microbe. (2016) 19:32–43. doi: 10.1016/j.chom.2015.12.005

16. Redweik GAJ, Daniels K, Severin AJ, Lyte M, Mellata M. Oral treatments with probiotics and live Salmonella vaccine induce unique changes in gut neurochemicals and microbiome in chickens. Front Microbiol. (2019) 10:3064. doi: 10.3389/fmicb.2019.03064

17. Redweik GAJ, Stromberg, ZR, Van Goor A, Mellata M. Protection against avian pathogenic Escherichia coli and Salmonella Kentucky exhibited in chickens given both probiotics and live Salmonella vaccine. Poult Sci. (2020) 99:752–762. doi: 10.1016/j.psj.2019.10.038

18. Poulsen LK, Lan F, Kristensen CS, Hobolth P, Molin S, Krogfelt KA. Spatial distribution of Escherichia coli in the mouse large intestine inferred from rRNA in situ hybridization. Infect Immun. (1994) 62:5191–5194. doi: 10.1128/IAI.62.11.5191-5194.1994

19. Stromberg Z, Johnson J, Fairbrother J, Kilbourne J, Van Goor A, Curtiss R, et al. Evalua- tion of Escherichia coli isolates from healthy chickens to determine their potential risk to poultry and human health. PLoS ONE. (2017) 12:e0180599. doi: 10.1371/journal.pone.0180599

20. Bej AK, DiCesare JL, Haff L, Atlas RM. Detection of Escherichia coli and Shigella spp. in water by using the polymerase chain reaction and gene probes for uid. Appl Environ Microbiol. (1991) 57:1013–1017. doi: 10.1128/AEM.57.8.2445-2445.1991

21. Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis. (2000) 181:261–272. doi: 10.1086/315217

22. Johnson TJ, Wannemuehler Y, Doetkott C, Johnson SJ, Rosenberger SC, Nolan LK. Iden- tification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. J Clin Microbiol. (2008) 46:3987–3996. doi: 10.1128/JCM.00816- 08

23. Kado CI, Liu ST. Rapid procedure for detection and isolation of large and small plasmids. J Bacteriol. (1981) 145:1365–1373. doi: 10.1128/JB.145.3. 1365-1373.1981

24. Mainil JG, Bex F, Dreze P, Kaeckenbeeck A, Couturier M. Replicon typing of virulence plasmids of enterotoxigenic Escherichia coli isolates from cattle. Infect Immun. (1992). 60:3376–3380. doi: 10.1128/IAI.60.8.3376-3380.1992

25. Mellata M, Ameiss K, Mo H, Curtiss R. Characterization of the contribution to virulence of three large plasmids of avian pathogenic Escherichia coli χ7122 (O78:K80:H9). Infect Immun. (2010) 78:1528–1541. doi: 10.1128/IAI.00981-09

26. Rehmsmeier M, Steffen P, Hochsmann M, Giegerich R. Fast and effective prediction of microRNA/target duplexes. RNA. (2004) 10:1507–1517. doi: 10.1261/rna.5248604

27. Krüger J, Rehmsmeier M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res. (2006) 34:451–454. doi: 10.1093/nar/gkl243

28. Warnefors M, Mössinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, et al. Sex- biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation. Genome Res. (2017) 27:1961–1973. doi: 10.1101/gr.225391.117

29. Garcia EC, Brumbaugh AR, Mobley HL. Redundancy and specificity of Escherichia coli iron acquisition systems during urinary tract infection. Infect Immun. (2011) 79:1225– 1235. doi: 10.1128/IAI.01222-10

30. Grozdanov L, Raasch C, Schulze J, Sonnenborn U, Gottschalk G, Hacker J, et al. Analysis of the genome structure of the nonpathogenic probiotic Escherichia coli strain Nissle 1917. J Bacteriol. (2004) 186:5432–5441. doi: 10.1128/JB.186.16.5432-5441.2004

31. Ewers C, Antão EM, Diehl I, Philipp HC, Wieler LH. Intestine and environment of the chicken as reservoirs for extraintestinal pathogenic Escherichia coli strains with zoonotic potential. Appl Environ Microbiol. (2009) 75:184–192. doi: 10.1128/AEM.01324-08 76

32. Diard M, Garry L, Selva M, Mosser T, Denamur E, Matic I. Pathogenicity-associated is- lands in extraintestinal pathogenic Escherichia coli are fitness elements involved in intestinal colonization. J Bacteriol. (2010) 192:4885– 4893. doi: 10.1128/JB.00804-10

33. Meador JP, Caldwell ME, Cohen PS, Conway T. Escherichia coli pathotypes occupy distinct niches in the mouse intestine. Infect Immun. (2014) 82:1931–1938. doi: 10.1128/IAI.01435-13

34. Johnson TJ, Nolan LK. Pathogenomics of the virulence plasmids of Escherichia coli. Mi- crobiol Mol Biol Rev. (2009) 73:750–774. doi: 10.1128/MMBR.00015-09

35. Mellata M, Touchman JW, Curtiss R. Full sequence and comparative analysis of the plasmid pAPEC-1 of avian pathogenic E. coli χ7122 (O78:K80:H9). PLoS ONE. (2009) 4:e4232. doi: 10.1371/journal.pone.0004232

36. Cascales E, Buchanan SK, Duché D, Kleanthous C, Lloubès R, Postle K, et al. Colicin biology. Microbiol Mol Biol Rev. (2007) 71:158–229. doi: 10.1128/MMBR.00036-06

37. Duan H, Chai T, Cai Y, Zhong Z, Yao M, Zhang X. Transmission identification of Esche- richia coli aerosol in chicken houses to their environments using ERIC-PCR. Sci China C Life Sci. (2008) 51:164–173. doi: 10.1007/s11427-008-0021-0

38. Chien YC, Chen CJ, Lin TH, Chen SH. Characteristics of microbial aerosols released from chicken and swine feces. J Air Waste Manag Assoc. (2011) 61:882–889. doi: 10.3155/1047-3289.61.8.882

39. NIH Human Microbiome Portfolio Analysis Team A review of 10 years of human microbiome research activities at the US National Institutes of Health, Fiscal Years 2007-2016. Microbiome. (2019) 7:31. doi: 10.1186/s40168-019-0620-y

40. Peterson G, Kumar A, Gart E, Narayanan S. Catecholamines increase conjugative gene transfer between enteric bacteria. Microb Pathog. (2011) 51:1–8. doi: 10.1016/j.micpath.2011.03.002

41. Maneewannakul S, Maneewannakul K, Ippen-Ihler K. Characterization, localization, and sequence of F transfer region products: the pilus assembly gene product TraW and a new product, TrbI. J Bacteriol. (1992) 174:5567–5574. doi: 10.1128/jb.174.17.5567-5574.1992

42. Koraimann G, Teferle K, Markolin G, Woger W, Högenauer G. The FinOP repressor system of plasmid R1: analysis of the antisense RNA control of traJ expression and conjugative DNA transfer. Mol Microbiol. (1996) 21:811–821. doi: 10.1046/j.1365- 2958.1996.361401.x

43. Torreblanca J, Marqués S, Casadesús J. Synthesis of FinP RNA by plasmids F and pSLT is regulated by DNA adenine methylation. Genetics. (1999) 152, 31–45. 77

44. Zatyka M, Thomas CM. Control of genes for conjugative transfer of plasmids and other mobile elements. FEMS Microbiol Rev. (1998) 21:291–319. doi: 10.1111/j.1574- 6976.1998.tb00355.x

45. Kaldhone PR, Carlton A, Aljahdali N, Khajanchi BK, Sanad YM, Han J, et al. Evaluation of incompatibility group I1 (IncI1) plasmid-containing Salmonella enterica and assessment of the plasmids in bacteriocin production and biofilm development. Front Vet Sci. (2019) 6:298. doi: 10.3389/fvets.2019.00298

46. del Solar G, Giraldo R, Ruiz-Echevarría MJ, Espinosa M, Díaz-Orejas R. Replication and control of circular bacterial plasmids. Microbiol Mol Biol Rev. (1998) 62:434–464. doi: 10.1128/mmbr.62.2.434-464.1998

47. Noren Hooten N, Fitzpatrick M, Wood WH, De S, Ejiogu N, Zhang Y, et al. Age-related changes in microRNA levels in serum. Aging. (2013) 5:725–740. doi: 10.18632/aging.100603

48. Kers JG, Velkers FC, Fischer EAJ, Hermes GDA, Stegeman JA, Smidt H. Host and environmental factors affecting the intestinal microbiota in chickens. Front Microbiol. (2018) 9:235. doi: 10.3389/fmicb.2018.00235

49. Johnson TJ, Siek KE, Johnson SJ, Nolan LK. DNA Sequence and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains. J Bacteriol. (2006) 188(2): 745-58. doi: 10.1128/JB.188.2.745-758.2006

50. Ott LC, Stromberg ZR, Redweik GAJ, Wannemuehler MJ, Mellata M. Mouse Genetic Background Affects Transfer of an Antibiotic Resistance Plasmid in the Gastrointestinal Tract. mSphere. (2020) 5(1):e00847-19. doi: 10.1128/mSphere.00847-19

Figures and Tables

Figure 3-1. P+V E. coli produce less siderophores compared to other treatment group isolates. Siderophore production on CAS agar plates by each E. coli isolate (dot) per treatment group. Ring radius from individual, bacterial colonies were measured via ruler (cm). ****, P < 0.0001.

Figure 3-2. ColV, IncF plasmids, virulence factors, and antibiotic resistances are absent in P+V fecal E. coli. Binary heatmap indicating presence (green) or absence (black) of virulence genes and antibiotic resistance per individual isolate (i.e., each horizontal line). uidA, β-glucuronidase. ColV, cvaC-positive. FIB, IncFIB replicon. Y, IncY replicon. I1, IncI1 replicon. N, IncN replicon. iutA, aerobactin receptor. iroN, salmochelin receptor. iss, increased serum survival gene. hlyF, hemolysin. TC_R, tetracycline resistance. Strep_R, streptomycin resistance. APEC, avian pathogenic Escherichia coli. AMR, antimicrobial resistance.

Figure 3-3. E. coli plasmid content is positively associated with smRNA concentration in ceca mucus of the chicken intestine. (A), plasmid number per E. coli isolate (as indicated by individual dots). (B), smRNA concentration in ceca mucus per bird (as indicated by individual dots). ****, P < 0.0001. Differences in letters A, B, and C indicate significant differences between groups (P < 0.01).

Figure 3-4. Transconjugant levels of in vitro E. coli conjugation assays treated with smRNA. IncF plasmid donor E. coli used were APEC O2 (A) or IA-EC-001 (B). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Figure 3-5. Confirmation of genes associated with IncF plasmid IA-P-001A and transfer to E. coli transconjugants. Binary heatmap (A) and plasmid profiles (B) of E. coli transconjugants from IA-EC-001 conjugation assays. iutA, aerobactin receptor. iroN, salmochelin receptor. hlyF, hemolysin. iss, increased serum survival. ColV, FIB, and I1 indicate plasmid type. D (A) or 1 (B), IA-EC-001 donor. R (A) or 2 (B), HS-4 recipient. 3–12 (B), in vitro transconjugants.

Figure 3-6. Representative image of single IncI1 plasmid conserved in P+V isolates. Plasmid profiles of strains in 0.5% agarose TAE gel. Gel A: 1, E. coli ladder 39R681; 2, E. coli HS-4 (negative control); 3–12, individual P+V isolates. Gel B: 1, E. coli ladder 39R681; 2–12, individual P+V isolates. Gel C: 1, E. coli ladder 39R681; 2–12, individual P+V isolates.

Figure 3-7. Summary of donor and recipient E. coli CFU in in vitro conjugation assays treated with smRNA. Donor (A, C); recipient (B, D).

Figure 3-8. Summary of Gallus gallus RT-qPCR miRNA reads and in vitro conjugation assays with gga-miR-12267-3p. (A) qPCR reads for chicken miRNAs predicted to hybridize with pAPEC-O2-R target genes (see Table 3-2). (B–D) Levels of donor (APEC O2; B), recipient (HS- 4; C) and transconjugants (D) from in vitro E. coli conjugation assays treated with synthetic mimic gga-miR-12267-3p miRNA at different concentrations (0, 50 ng, and 2 μg per 200 μl reactions). *, P < 0.05.

Table 3-1. Escherichia coli strains and large plasmids evaluated in this study. Escherichia coli Role Plasmid Plasmid Size Inc Group, Relevant Antibiotic Source strains (kb) Resistance APEC O2 Donor pAPEC-O2-R 101 IncF, Tetracycline 4

pAPEC-O2- 180 IncFIB, N/A 49

ColV

IA-EC-001 Donor IA-P-001A 125 IncF1B, Tetracycline This

study

IA-P-001B 102 IncI1, N/A

HS-4 Nalr Recipi- None N/A Nalidixic acid (spontaneous) 50

ent

39R681 Ladder - 147 N/A 24

- 65 N/A

- 35.85 N/A

Table 3-2. Top five predictive miRNA hybridizations and gene targets of chicken miRNA on the plasmid pAPEC-O2-R. miRNA MFE miRNA function; Target Gene Function; P value (gga-miR-) (kcal/mol) Reference Gene UniProt Accession 12282-5p -45.7 Novel, function NYD; traW Involved in F-pilus assem- 0.00029 A bly. Required for F plasmid conjugative transfer; P18472

12207-3p -45.4 Novel, function NYD; traB Conjugal transfer pilus as- 0.00027 A sembly protein; P41067 12237-5p -45.4 Novel, function NYD; aadA4 Aminoglycoside 3''-ade- 0.00053 A nylyltransferase activity; Q7BPB1

12237-5p -45.2 Novel, function NYD; traW Involved in F-pilus assem- 0.00033 A bly. Required for F plasmid conjugative transfer; P18472

12267-3p -44.1 Novel, function NYD; traP Conjugal transfer protein 0.00015 A V5KCM6

Table 3-3. Summary of PCR primers used in this study for virulence gene and plasmid replicon detection. Gene Target Forward Primer (5’-3’) Reverse Primer (5’-3’) Reference uidA TGGTAATTACCGACGAAAACGGC ACGCGTGGTTACAGTCTT- 20 GCG iss CAGCAACCCGAACCACTTGATG AGCATTGCCAGAGCGG- 22 CAGAA iutA GGCTGGACATCATGGGAACTGG CGTCGGGAACGGG- 22 TAGAATCG iroN AATCCGGCAAAGAGACGAAC- GTTCGGGCAACCCCTGCTTT- 22 CGCCT GACTTT hylfA GGCCACAG- GGCGGTTTAGGCATTCCGA- 22 TCGTTTAGGGTGCTTACC TACTCAG cvaC CACACACAAACGGGAGCTGTT CTTCCCGCAGCATAGTTCCAT 21 Replicon Panel 1: B/O GCGGTCCGGAAAGCCAGAAAAC TCTGCGTTCCGCCAAGTTCGA 5 FIC GTGAACTGGCAGATGAGGAAGG TTCTCCTCGTCGCCAAACTA- 5 GAT A/C GAGAACCAAAGACAAAGAC- ACGACAAACCTGAATT- 5 CTGGA GCCTCCTT P CTATGGCCCTGCAAAC- TCACGCGCCAGGGCGCAGCC 5 GCGCCAGAAA T TTGGCCTGTTTGTGCCTAAACCAT CGTTGATTACACTTAGCTTT- 5 GGAC Panel 2: K/B GCGGTCCGGAAAGCCAGAAAAC TCTTTCACGAGCCCGCCAAA 5 W CCTAAGAACAACAAAGCCCCCG GGTGCGCGGCATAGAACCGT 5 FIIA CTGTCGTAAGCTGATGGC CTCTGCCACAAACTTCAGC 5 FIA CCATGCTGGTTCTAGAGAAGGTG GTATATCCTTACTGGCTTCCG 5 CAG FIB GGAGTTCTGACACACGATTTTCTG CTCCCGTCGCTTCAGGGCATT 5 Y AATTCAAACAACACTGTG- GCGAGAATGGACGAT- 5 CAGCCTG TACAAAACTTT Panel 3: I1 CGAAAGCCGGACGGCAGAA TCGTCGTTCCGCCAAGTTCGT 5 Frep TGATCGTTTAAGGAATTTTG GAAGATCAGTCACACCATCC 5 X AACCTTAGAGGCTATTTAAGTT- TGAGAG- 5 GCTGAT TCAATTTTTATCTCATGTTTT AGC HI1 GGAGCGATGGATTACTTCAGTAC TGCCGTTTCACCTCGTGAGTA 5 N GTCTAACGAGCTTACCGAAG GTTTCAACTCTGCCAAGTTC 5 HI2 TTTCTCCTGAGTCAC- GGCTCACTACCGTT- 5 CTGTTAACAC GTCATCCT L/M GGATGAAAACTATCAG- CTGCAGGGGCGAT- 5 CATCTGAAG TCTTTAGG

Table 3-4. Summary of uidA detection in fecal isolates from 100 randomly selected colonies from each treatment group. Treatment % uidA- Group positive CON 97 PRO 89 VAX 93 P+V 100

Table 3-5. Complete RNAHybrid predictive bindings output, gene targets, and gene names for all significant interactions. - This table can be found here: https://www.frontiersin.org/arti- cles/10.3389/fmicb.2020.625286/full#supplementary-material

CHAPTER 4. PROTECTION AGAINST AVIAN PATHOGENIC ESCHERICHIA COLI AND SALMONELLA KENTUCKY EXHIBITED IN CHICKENS GIVEN BOTH PROBI- OTICS AND LIVE SALMONELLA VACCINE

Modified from a manuscript published in Poultry Science

Graham A.J. Redweik,a,b Zachary R. Stromberg,a Angelica Van Goor,a and Melha Mellataa,b aDepartment of Food Science and Human Nutrition, Iowa State University, Ames, IA, USA; bIn- terdepartmental Microbiology Graduate Program, Iowa State University, Ames, IA, USA

Abstract

Commercial poultry farms are increasingly threatened by bacterial infections from avian pathogenic Escherichia coli (APEC) and broad-host Salmonella serovars. Recombinant attenuated Salmonella vaccines (RASV) elicit cross-reactive immune responses against APEC in chickens; however, assessment of broad protection is lacking. Probiotics can serve as biological adjuvants and improve vaccination responses. The objective of this study was to determine whether the RASV, the probiotics, or their combination had protection against APEC and Salmo- nella. White Leghorn chicks were randomly placed into four groups: no treatment (CON), probiotics (PRO), RASV (VAX), or both prophylactics (P+V). Chicks in the PRO and P+V groups were fed probiotics daily, beginning at the age of 1-day-old. Chicks in the P+V and VAX groups were orally inoculated with RASV at the age of 4 days and boosted two weeks later. Total and antigen-specific IgY responses to Salmonella (lipopolysaccharide [LPS]) and E. coli (IroN and

IutA) were measured in serum samples via ELISA. Bactericidal potential of both serum and blood against 42 APEC isolates comprising 25 serotypes was assessed in vitro. In vivo protection against APEC was evaluated by air sac challenge with APEC χ7122 (O78:K80), gross pathological lesions were scored, and bacterial loads were enumerated. In a second similar study, birds 88 were orally challenged with S. Kentucky (CVM29188), and feces were enumerated for Salmo- nella at multiple time points. Vaccination elicited significant LPS-specific antibodies regardless of probiotics (P < 0.0001). Chicks in the P+V group demonstrated increased blood and serum bactericidal abilities against multiple APEC strains in vitro compared with the CON group. Fol- lowing χ7122 challenge, P+V birds had reduced levels of the APEC strainin their blood (P <

0.001) and lower signs of airsacculitis (P < 0.01) and pericarditis/perihepatitis (P < 0.05) than

CON birds. Finally, only P+V birds were negative for fecal Salmonella at all time points. This study shows this combination treatment may be a feasible method to reduce infection by APEC and Salmonella in chickens.

Introduction

Bacterial infections are a major problem for poultry. Avian pathogenic Escherichia coli

(APEC) causes systemic disease that is highly lethal in both broilers (1) and layers (2) and is the leading cause of first-week mortality in layers (3). In addition, poultry products such as eggs are the common source of broad-host serovars of Salmonella enterica, the primary cause of foodborne-associated hospitalizations and deaths in the United States (4). Furthermore, Salmonella enterica serovar Kentucky has broad host ranges, can transfer antibiotic resistance genes to commensal Enterobacteriaceae, and can effectively colonize the gastrointestinal tract of poultry (5), making it a threat for promoting abundant drug-resistant microbes in commercial poultry operations. Coincidentally, antimicrobial-resistant E. coli (6) and Salmonella (7-9) isolates are increasingly prevalent in poultry, necessitating alternative means to decrease bacterial load.

Live vaccines and probiotics are convenient and currently applied options to control bacterial infections. Recombinant attenuated Salmonella vaccines (RASV) are typically used to control Salmonella in poultry (10, 11); however, they have also demonstrated a reduction of APEC 89 mortality in chickens (12, 13). These studies used RASV delivering APEC surface antigens such as the aerobactin receptor IutA (12), but protection was only evaluated for a single APEC strain

(O2 serotype). Furthermore, RASV has cross-reactivity with Enterobacteriaceae (14), and our recent studies have demonstrated cross-reactivity between RASV strains and APEC antigens

(15) including IutA and the salmochelin receptor IroN (16). Thus, it is possible these RASV can be used to simultaneously decrease bacterial load of both Salmonella and APEC in chickens.

Certain probiotics boost host immune responses via cytokine activation (17), Toll-like receptor expression (18), improved antibody production (19, 20), and short-chain fatty acid secretion (21). Thus, probiotics have been proposed as potential vaccine adjuvants, but evidence is limited (22). Adding probiotics to an antigen-based coccidiosis vaccine improved Coccidia resistance in broilers (23, 24). However, use of both probiotics and RASV to protect against a broad spectrum of bacterial pathogens in layers has not been investigated.

This objective of the work was to determine whether the RASV, probiotics, or their combination provides resistance against APEC and Salmonella in layer hens. We hypothesized combining probiotics with RASV treatment in chickens will enhance host responses against both pathogens.

Materials and Methods

Ethics Statement

Animal experiments were approved by Iowa State University Institutional Animal Care and Use Committee (log #1-16-8159-G). Animal distress was minimized during experimental procedures by providing animal enrichments. For acclimation purposes, no experimental treatments were performed within 3 days of receiving chickens. Open floor pens were implemented 90

to enable social interactions between chickens. Euthanasia techniques (CO2 asphyxiation) were in accordance with the American Veterinary Medical Association Guidelines (2013).

Chicken Treatment Groups

The experimental timeline is summarized in Figure 4-1. One-day-old male and female specific pathogen–free White Leghorns (VALO, Adel, IA) were randomly placed into 4 groups: no treatment (CON), probiotics (PRO), RASV (VAX), or both treatments (P+V) (Table 4-1).

Based on the group, chicks were randomly placed into 4 pens (n = 5-10 birds/pen) and housed in separate rooms based on RASV treatment. Chickens were given ad libitum access to feed and water. One pen per room received a commercial probiotic supplement (Gro-2-max, BioNatural

America Institute, Royal Oak, MI) consisting of Bacillus subtilis, Lactobacillus acidophilus,

Pediococcus acidilactici, Pediococcus pentosaceus, and Saccharomyces pastorianus (confirmed by PCR), and this was thoroughly mixed with the feed (2.5 g of dry probiotic mix to 2.3 kg of feed; PRO and P+V). Fresh feed (3003484-324, Organic Starter-Grower, Purina, Gray Summit,

MO) was evenly weighed and replaced in all pens at least every 2 days. The bedding was not replaced during the experiment.

Bacterial Strains

Reference E. coli strains, clinical APEC isolates (25), and RASV χ9373 (26) (Table 4-2) were stored in peptone-glycerol solution at 80°C. In brief, E. coli isolates obtained in the study by Stacy et al. (25) were originally retrieved from diseased poultry exhibiting signs of colibacillosis (thus their designation as APEC) by Dr. John Fairbrother at the University of Montreal. The reference APEC strain χ7122 (O78:K80) (27) and S. Kentucky CVM29188, isolated from 91 chicken breast (5), were used for in vivo challenges. RASV χ9373 is designed for delayed attenuation upon absence of environmental mannose via pmi deletion and complemented with the plasmid pYA3337 to introduce a functional asd gene missing in this RASV strain (annotated in Ta- ble 4-2) (28). The strains were normally grown in Luria Bertani (LB) broth or agar (0.1% glucose) overnight at 37°C. For immunization and challenge studies, strains χ9373, χ7122, and

CVM29188 were grown by shaking (χ9373, CVM29188) or standing (χ7122) in LB broth until the bacterial suspension reached an optical density at 600 nm (OD600) of 0.8 and centrifuged for

20 min at 4,000 x g at room temperature. The pellet was resuspended and serially diluted in PBS.

Bacterial concentrations were confirmed by plating on MacConkey agar (212123, BD Difco,

Franklin Lakes, NJ).

Immunization

At the age of 4 days, food and water were removed from pens of all birds 4–6 h before vaccination. Vaccine groups were orally immunized with 20 µl of 109 CFU of RASV. Two weeks after vaccination, the same chickens were given an additional 20 µl of the oral RASV boost (108 CFU). No treatment and PRO groups received 20 µl of PBS as a control (Figure 4-1).

Food and water were returned to pens 30 min after immunization.

IgY Titers Measured by ELISA

Blood was collected from days 33 to 35 from the wing vein. After overnight coagulation at 4°C and centrifugation, serum was collected and stored at 80°C until needed. ELISA were performed to compare antigen-specific and total IgY titers between the groups. In brief, 96-well plates were coated with 2.0 mg/ml of the gram-negative envelope component lipopolysaccharide

(LPS; S. enterica serovar Typhimurium, L6511, Sigma, St. Louis, MO) or siderophore receptors 92

(IroN or IutA) overnight at 4°C. IroN and IutA antigens were purified from cultures of E. coli

BL21 transfected with pET101/D-TOPO vectors (Invitrogen, Carlsbad, CA) carrying iroN or iutA, respectively (29). In addition, 0.25 mg/ml of unlabeled mouse anti-chicken IgY (H + L,

8320-01, Southern Biotech, Birmingham, AL) was added onto separate 96-well plates to evaluate total IgY responses. Serum samples were diluted to a concentration of 1:50 in SEA blocking buffer (37,527; Thermo Fisher, Waltham, MA), serially diluted using 1:2 dilutions, and incubated for 1 hour at room temperature. Goat anti–chicken IgY-AP (H + L, A16057, Invitrogen,

Waltham, MA) was added, followed by the para-Nitrophenyl-phosphate (PNPP) substrate

(34,047; Thermo Fisher, Waltham, MA). Absorbance was measured at 405 nm. To measure antibody titer, the reciprocal of the highest dilution values doubling the control value (i.e., nontreated birds) was considered positive. ELISA were performed in duplicate per individual bird and independently replicated twice.

Whole-Blood Bactericidal Assay

Reference E. coli strains were prepared as described previously in the Bacterial Strains section to attain 102 CFU/200 µl. On days 34 and 35 after vaccination, 200 µl of blood was collected from wing veins of birds using filter-sterilized heparin (1000 U/ml)-coated needles and placed on ice. Blood was evenly pooled into 2 groups per treatment and then diluted to a concentration of 1:8 in CO2-independent media with 2 mmol L-glutamine (18045088, Gibco, Waltham,

MA). Individual wells in 96-well plates were filled with whole blood solution and the bacterial inoculum (9:1, respectively) and incubated at 40°C for 30 min. After brief resuspension, the samples were serially diluted, plated on MacConkey agar, and incubated overnight at 37°C. The samples were tested in triplicate, and the experiments were independently replicated.

Serum Bactericidal Assay

Forty-two APEC isolates, including APEC O1 (30), APEC O2 (31), and χ7122

(O78:K80), and non-pathogenic E. coli MG1655 (32) were streaked on LB agar (0.1% glucose), and colonies were mixed into PBS until OD600 reached 0.1, after which they were diluted to reach 102 CFU/20 µl. Equal volumes of chicken serum from each treatment group were split into two separate pools. Serum and the bacterial inoculum in the ratio of 9:1 (102 CFU) was aliquoted into individual wells of 96-well plates and incubated for 6 h at 40°C to imitate in vivo challenge conditions in chickens (33). Serum and bacterial mixtures were serially diluted and plated on

MacConkey agar. The samples were run in duplicate, and assays were independently repeated twice.

In Vivo Bacterial Challenges

Challenge 1: APEC χ7122 Air Sac Challenge. On day 50, the chickens were challenged with inoculation of 3 x 107 CFU of χ7122 in 100 µl of PBS via the left caudal thoracic air sac using 26G 9.5 mm needles (305110; BD, Franklin Lakes, NJ). The chickens were monitored for respiratory complications in the first 1 hour immediately after infection. No birds exhibited any signs of respiratory distress immediately after inoculation. In addition, the birds were checked twice daily and sacrificed via CO2 asphyxiation 48 hours post-infection (hpi). At 24 hpi, blood was collected using heparinized needles, serially diluted in PBS, plated on MacConkey agar, and incubated overnight at 37°C. Tissues were scored for signs of inflammation and lesions in the air sac (0, normal; 1, slight edema; 2, slight diffuse thickening and neovascularization with slight fibrinous exudate; 3, moderate fibrinous exudate; and 4, severe extensive exudate), heart and pericardium (0, normal; 1, vascularization, opacity, cloudy fluid in the pericardial cavity; 2, acute pericarditis), and liver (0, normal; 1, mild fibrinous exudate; 2, severe perihepatitis), as described 94 previously (34). Scores for heart plus pericardium and liver were combined for final analysis. At

48 hpi, tissues (spleen, liver, right lung, and heart) were aseptically collected from each euthanized bird for bacterial enumeration, performed as described previously.

Challenge 2: S. Kentucky CVM29188 Oral Challenge. In a separate experiment using the same treatment groups, feces from birds were plated on TC-S MacConkey agar (15 µg/ml of tetracycline and 30 µg/ml of streptomycin) to enumerate resistant Enterobacteriaceae 1 week before the Salmonella challenge. At day 58, the birds were orally challenged with 500 µl of

CVM29188 (4.6 x 108 CFU) in PBS. At days 3, 7, and 14 after the challenge, feces were collected from all birds, resuspended in PBS, and plated on TC-S MacConkey agar to track

CVM29188 and resistant Enterobacteriaceae. At day 21 after the challenge, intestinal contents

(jejunum, ileum, cecum, and colon) and extraintestinal tissues (spleen and liver) were collected, homogenized in PBS, and plated on TC-S MacConkey agar for bacterial enumeration.

Statistical Analysis

Prism software version 6.0 (GraphPad, San Diego, CA) was used to calculate significance for all statistical analyses. One-way ANOVA followed by Tukey’s test for multiple comparisons of means was used to compare differences between the groups, depending on the experiments. For ELISA, differences were compared between the groups within the antigen tested. For bactericidal assays, the groups were compared within the strain tested. For APEC challenge data, differences were compared within the tissue type. For Salmonella challenge data, differences were compared for groups both within and between time points. P values < 0.05 were considered significant.

Results

Specific and Nonspecific IgY Responses in Serum

In Figure 4-2, serum samples of the PRO group did not elicit significantly higher specific antibody titers against any antigen tested than those of the CON group. Serum samples of the

RASV-immunized groups demonstrated higher IgY titers against LPS than those of the CON

(VAX and P+V, P < 0.0001) and PRO (VAX, P < 0.0001; P+V, P < 0.01) groups. No significant differences were observed for anti-IutA, anti-IroN (Figure 4-2), or total IgY (data not shown).

Bactericidal Ability Against Multiple APEC Strains In Vitro

Whole blood samples of the PRO group exhibited enhanced bactericidal ability against

MG1655 (P < 0.05) and χ7122 (P < 0.01) compared with those of the CON group (Figure 4-3).

Blood of vaccinated birds yielded no significant bactericidal ability against any strain tested.

However, blood samples of the P+V group demonstrated the highest broad killing activity against MG1655 (P < 0.01), APEC O1 (P < 0.01), and χ7122 compared with those of the CON group (P < 0.001). Furthermore, APEC O1 growth was found to be suppressed in the blood samples of the P+V group when compared with those of the PRO group (P < 0.05). In serum, APEC growth inhibition occurred in a strain-dependent manner by treatment (Figure 4-4). Serum samples of the PRO group yielded significant killing ability against χ7233 (O1) compared with those of the CON group (Figure 4-4A, P < 0.05). Serum samples of the PRO, VAX, and P+V groups demonstrated increased killing activity against χ7234 (O18) compared with those of the control group (Figure 4-4A, P < 0.05). Serum samples of the VAX (P < 0.05) and P+V (P < 0.01) groups demonstrated increased bactericidal activity against χ7256 (O22) compared with those of the CON group (Figure 4-4A). The isolate χ7531 (O23) was found to be resistant to bactericidal 96 activity in the serum samples of the P+V group only when compared with those of all other treatment groups (Figure 4-4B, P < 0.01). Serum samples of the PRO group demonstrated increased killing activity against χ7249 (O45) compared with those of the CON, VAX, and P+V groups

(Figure 4-4B, P < 0.0001). Serum samples of the VAX group demonstrated increased killing activity against χ7520 when compared with those of the CON group (Figure 4-4B, P < 0.05).

χ7122 was completely eliminated in the serum samples of the PRO and P+V groups when compared with those of the CON group (Figure 4-4B, P < 0.0001). Most APEC isolates tested failed to grow in serum (complement sensitive) obtained from any group (Table 4-1).

In Vivo Protection Against APEC Challenge

For lesion scores, the PRO and P+V groups yielded significantly lower signs of airsacculitis (Figure 4-5A, P < 0.05 and P < 0.01, respectively) than the CON group. Lesion scores for heart and liver were significantly lower in the P+V and VAX groups (P < 0.05) than in the CON group. At 24 hpi, blood from RASV-immunized birds demonstrated low levels of χ7122 in vivo

(Figure 4-5B, P < 0.01 and P < 0.001 for VAX and P+V, respectively). For bacterial loads, reduced CFU of χ7122 were seen in the spleen tissues of the P+V group when compared with those of the VAX group (P < 0.05), although a significantly lower CFU was not observed when compared with that of the CON group. Numerical but insignificant decreases in CFU of χ7122 in liver and lung samples were seen in the P+V group. A higher proportion of tissue samples were negative for χ7122 in the P+V group than in the other groups, reaching significance in the lung

(Figure 4-5, P < 0.05). There were no significant differences between the groups in bacterial

CFU in heart tissue.

In Vivo Protection Against S. Kentucky CVM29188

No Salmonella was detected in feces of any bird before the CVM29188 challenge (data not shown). After the challenge, CVM29188 was not detected in feces at days 3 and 14 after the challenge. However, CVM29188 was shed the highest at day 7 when compared with other time points (CON and VAX, P < 0.05), although only birds of the P+V group were all negative for

CVM29188 (Figure 4-6). No significant differences were seen between the groups at day 7. Fur- thermore, CVM29188 was not detected in any intestinal contents and extraintestinal tissue samples collected at necropsy from any bird (data not included).

Discussion

The rise of bacterial infections in poultry necessitates a prophylactic that protects against a broad spectrum of pathogens. APEC is a commensal in the chicken gut (35), but if inhaled can translocate from the lung epithelium into the bloodstream to cause systemic infections such as colibacillosis (36). These antigenically and genetically diverse APEC strains are primed for outbreaks in densely populated chicken facilities upon aerosolizing from feces (37). A recent study genotyping E. coli isolates from broiler carcasses in Spanish farms characterized 26 different serotypes, with most strains containing multiple APEC-associated virulence factors and antimicrobial resistance (38). In addition, although colonization of broad-host Salmonella serovars in older laying hens is asymptomatic (39), they can be shed in feces, having major consequences on food safety and human health. Salmonella can contaminate egg surfaces via biofilms or the egg yolk itself via shell penetration or invasion into the oviduct before laying (40, 41). Altogether, a prophylactic option that can reduce loads of a broad spectrum of bacterial pathogens is imperative for optimal poultry production. 98

Recently, recombinant antigen–based vaccines have elicited broad APEC protection (33).

However, these vaccines require subcutaneous injections, which is inconvenient for commercial operations. Given orally, RASV translocate from the gut epithelium to lymphoid tissues such as the spleen, enabling memory T-cell development (42). This study is novel in the attempt to assess adjuvant potential of probiotics to improve host responses to RASV immunization. Im- portantly, both are currently used in poultry farms (10, 11, 43) and can be simply orally administered (e.g., food and water). A mixture of probiotics, opposed to individual strains, increases the range of beneficial activities (44). Furthermore, the addition of Anaerosporobacter mobilis and

Lactobacillus reuteri enhanced efficacy of a live E. coli–based vaccine carrying a Campylobac- ter jejuni antigen (24), suggesting that a probiotic mixture can enhance live vaccine efficacy in poultry.

In this study, vaccination with RASV χ9373 triggered significant anti-LPS IgY levels in the serum compared with control or probiotic treatment alone. The presence of anti-LPS IgY in birds not vaccinated with RASV could be due to a cross-reactivity with anti-LPS of other Enter- obacteriaceae species, such as E. coli (45). However, anti–lipid A antibodies are not protective

(46), suggesting that elevated levels may have little benefit to poultry. Importantly, the present study supports this claim by the poor association between serum bactericidal responses and anti-

LPS IgY titers.

Protection against multiple serogroups is crucial as APEC isolates from chickens are highly diverse within and between birds (38, 47). Blood samples from the P+V group elicited high bactericidal effects against 2 of the 3 APEC isolates tested in vitro. Although whole blood of probiotic-supplemented birds reduced bacterial loads of MG1655 and χ7122, blood samples from the VAX group did not decrease bacterial levels, suggesting that anti-LPS IgY was not a 99 major factor in these responses. Instead, this suggests probiotics could have improved bactericidal activities of the innate effector cells, such as monocytes and heterophils, present in whole blood. However, RASV immunization improved probiotic-stimulated bactericidal activities in blood as APEC O1 elimination was higher in the P+V group than in the PRO group. Blood leukocytes from mice that were given probiotics exhibited higher levels of phagocytosis and respiratory burst (48), supporting the evidence that probiotics modulate systemic immunity (49).

Serum resistance was highly variable between APEC isolates, even among those of the same serotype. However, the PRO and VAX groups generated protective serum against multiple

APEC isolates, although this range in in vitro protection was not increased by combining treatments. Peculiarly, serum from the P+V group stimulated survival of the APEC isolate χ7531

(O23) compared with that of the other groups. Heat-treated serum from nontreated birds enabled growth of χ7531 similar to MG1655 (data not shown), suggesting this strain is complement sensitive. Complement C3 instructs adaptive responses in mice (50), suggesting an interaction between host complement and adaptive responses induced by vaccination. Thus, we hypothesize the complement pathway may be altered via synergism between the RASV and probiotics, which may enhance serum survival of certain APEC strains and/or serotypes.

We challenged birds with χ7122 because of its unique susceptibility to both serum and blood of the P+V and PRO groups in our in vitro work and its high virulence capacity (27). The precise mechanism to serum resistance in this strain is unclear (34). It is possible that other immune effectors such as antimicrobial peptides specifically elicited under probiotic treatment are responsible; however, why only this particular isolate exhibited susceptibility in this manner warrants further investigation. In addition, although bacterial enumerations in blood were the 100 lowest in the P+V group when compared with the CON group 24 hpi, this trend was not significant for tissues 48 hpi. This suggests tissue survival may be important in χ7122 pathogenesis.

Mellata and colleagues (51) demonstrated not only the capability of χ7122 to survive in professional phagocytes for more than 48 hours but also the capability of its O78 antigen to enhance intracellular survival. In addition, loss of biofilm formation significantly attenuates APEC survival in tissues (52). χ7122 possesses genetic potential for biofilm formation, although this phenotype was not demonstrated in vitro (25).

Previous studies with broad-host Salmonella in laying hens have shown that Salmonella can be naturally cleared within 2 weeks (39), which is supported by our data for CVM29188 shedding. In the present study, CVM29188 was only detected 7 days after inoculation. Although birds of the CON, PRO, and VAX groups were all positive for CVM29188, birds of the P+V group were negative at every time point, suggesting the combination is efficacious against Sal- monella persistence. In the VAX group, highest levels of Salmonella were observed at day 7 when compared with 3 and 14 days after the challenge. Although χ9373 is a live Salmonella vaccine, it is derived from a Typhimurium strain (28) and may not provide broad protection against

S. Kentucky when given alone. The CVM29188 challenge strain was isolated from poultry, and the animal’s intestinal tract may serve as a reservoir for exchanging virulence and resistance genes horizontally (53, 54). CVM29188 possesses a ColV plasmid, which improves its ability to colonize the gut and cause extraintestinal disease in 1-day-old broilers (55). However, our birds were much older (58-days-old) and appeared to naturally resist colonization and disease to a greater degree, likely due to a more mature gut microbiota (56). Furthermore, this is the first study to inoculate this strain in layers, so immune differences in the production phenotype may also impact CVM29188 colonization (57). 101

In conclusion, our data show that RASV χ9373 and probiotics did not synergistically improve antibody responses in serum, but strain-specific synergistic protection against APEC was observed in whole blood and recapitulated via superior protection against χ7122 in vitro and in vivo. Furthermore, Salmonella shedding in feces at day 7 was not found in the group treated with this combination, whereas other groups exhibited highest shedding, suggesting this combination can effectively reduce risk of infection and colonization by multiple pathogenic bacteria. Future studies aim to uncover how effector cells may contribute to these responses and the role of individual probiotic strains.

Acknowledgments

The authors thank Dr. Roy Curtiss III (University of Florida, Gainesville, FL) for providing the RASV strain and undergraduates Kyle Anderson, Ellen Swartz, David Couri, Mary Kate

Horak, and Caroline Treadwell (Iowa State University, Ames, IA) for technical assistance. This research was supported by Iowa State University start-up funding and the USDA Hatch project

IOW03902 to MM. The funding sources had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The authors declare that neither commercial nor financial relationships create a potential conflict of interest with this research.

References

1. Yogaratnam V. Analysis of the causes of high rates of carcass rejection at a poultry pro- cessing plant. Vet Rec. (1995) 137:215–217.

2. Vandekerchove D, De Herdt P, Laevens H, Pasmans F. Colibacillosis in caged layer hens: characteristics of the disease and the aetiological agent. Avian Pathol. (2004) 33(2):117- 25. doi: 10.1080/03079450310001642149.

102

3. Olsen RH, Frantzen C, Christensen H, Bisgaard M. An investigation on first-week mortality in layers. Avian Dis. (2012) 56(1):51-7. doi: 10.1637/9777-051011-Reg.1.

4. Center for Disease Control and Prevention (2018). Salmonella homepage. Accessed Feb- ruary 2019. https://www.cdc.gov/Salmonella/ inde.html.

5. Fricke W, McDermott P, Mammel M, Zhao S, Johnson T, Rasko D, Fedorka-Cray P, Pedroso A, Whichard J, LeClerc J, et al. Antimicrobial Resistance-Conferring Plasmids with Similarity to Virulence Plasmids from Avian Pathogenic Escherichia coli Strains in Salmonella enterica Serovar Kentucky Isolates from Poultry. Applied and Environmental Microbiology. (2009) 75(18):5963-71. doi: 10.1128/AEM.00786-09.

6. Brower CH, Mandal S, Hayer S, Sran M, Zehra A, Patel SJ, Kaur R, Chatterjee L, Mishra S, Das BR, et al. The Prevalence of Extended-Spectrum Beta-Lactamase-Producing Multidrug-Resistant. Environ Health Perspect. (2017) 125(7):077015. doi: 10.1289/EHP292

7. Han J, Lynne A, David D, Tang H, Xu J, Nayak R, Kaldhone P, Logue C, Foley S. DNA Sequence Analysis of Plasmids from Multidrug Resistant Salmonella enterica Serotype Heidelberg Isolates. PLoS ONE. (2012) 7(12). doi: 10.1371/journal.pone.0051160

8. Folster J, Campbell D, Grass J, Brown A, Bicknese A, Tolar B, Joseph L, Plumblee J, Walker C, Fedorka-Cray P, et al. Identification and Characterization of Multidrug- Resistant Salmonella enterica Serotype Albert Isolates in the United States. Antimicrob Agents Chemo. (2015) 59(5):2774-9. doi: 10.1128/AAC.05183-14

9. Thung T, Mahyudin N, Basri D, Radzi C, Nakaguchi Y, Nishibuchi M, Radu S. Prevalence and antibiotic resistance of Salmonella Enteritidis and Salmonella Typhimurium in raw chicken meat at retail markets in Malaysia. Poult Sci. (2016) 95(8):1888-93. doi: 10.3382/ps/pew144

10. Dórea FC, Cole DJ, Hofacre C, Zamperini K, Mathis D, Doyle MP, Lee MD, Maurer JJ. Effect of Salmonella vaccination of breeder chickens on contamination of broiler chicken carcasses in integrated poultry operations. Appl Environ Microbiol. (2010) 76(23):7820-5. doi: 10.1128/AEM.01320-10

12. Chaudhari A, Matsuda K, Lee J. Construction of an Attenuated Salmonella Delivery System Harboring Genes Encoding Various Virulence Factors of Avian Pathogenic Escherichia coli and Its Potential as a Candidate Vaccine for Chicken Colibacillosis. Avian Dis. (2013) 57(1):88-96. 103

13. Lee, J., A. Chaudhari, I. Oh, S. Eo, S. Park, and C. Jawale. 2015. Immune responses to oral vaccination with Salmonella-delivered avian pathogenic Escherichia coli antigens and protective efficacy against colibacillosis. Can. J. Vet. Res. 79:229–234.

14. Curtiss III R, Mellata M, Zekarias B, Shi Z, Branger C, Roland K. Recombinant bacterium capable of eliciting an immune response against enteric pathogens. Salmonella vaccine against bacterial enteric pathogens. US Pat. No. 8,465,755B2 (granted 06/18/13). https://patentimages.storage.googleapis. com/b5/81/f0/2ecf6f7d787f7c/US8465755.pdf.

15. Maddux JT, Stromberg ZR, Curtiss III R, Mellata M. Evaluation of recombinant attenuated Salmonella vaccine strains for broad protection against extraintestinal pathogenic Esche- richia coli. Front Immunol. (2017) 8:1280. doi: 10.3389/fimmu.2017.01280

16. Stromberg ZR, Van Goor A, Redweik GAJ, Mellata M. Characterization of Spleen Transcriptome and Immunity Against Avian Colibacillosis After Immunization With Recombinant Attenuated Salmonella Vaccine Strains. Front Vet Sci. (2018) 5(198). doi: 10.3389/fvots.2018.00198

17. Brisbin J, Gong J, Parvizi P, Sharif S. Effects of Lactobacilli on Cytokine Expression by Chicken Spleen and Cecal Tonsil Cells. Clin Vaccine Immunol. (2010) 17(9):1337-43. doi: 10.1128/CVI.00143-10

18. Sato K, Takahashi K, Tohno M, Miura Y, Kamada T, Ikegami S, Kitazawa H. Immunomodulation in gut-associated lymphoid tissue of neonatal chicks by immunobiotic diets. Poult Sci. (2009) 88(12):2532-8. doi: 10.3382/ps.2009-00291

19. Yang Y, She R, Zheng S, Jiang Y. Effect of probiotics on intestinal mucosal immunity and ultrastructure of cecal tonsils of chickens. Archiv Anim Nutr. (2005) 59(4):237-46. doi: 10.1080/17450390500216928

20. Haghighi H, Gong J, Gyles C, Hayes M, Zhou H, Sanei B, Chambers J, Sharif S. Probiotics stimulate production of natural antibodies in chickens. Clin Vaccine Immunol. (2006) 13(9):975-80. doi: 10.1128/CVI.00161-06

21. Pang I, Iwasaki A. Control of antiviral immunity by pattern recognition and the microbiome. Immunol Rev. (2012) 245:209-26. doi: 10.1111/j.1600-065X.2011.01073.x

22. Praharaj I, John S, Bandyopadhyay R, Kang G. Probiotics, antibiotics and the immune responses to vaccines. Phil Trans Royal Soc Biolog Sci. (2015) 370(1671). doi: 10.1098/rstb.2014.0144

104

23. Ritzi M, Abdelrahman W, van-Heerden K, Mohnl M, Barrett N, Dalloul R. Combination of probiotics and coccidiosis vaccine enhances protection against an Eimeria challenge. Vet Res. (2016) 47. doi: 10.1186/s13567-016-0397-y

24. Nothaft H, Perez-Muñoz ME, Gouveia GJ, Duar RM, Wanford JJ, Lango-Scholey L, Panagos CG, Srithayakumar V, Plastow GS, Coros C, et al. Co-administration of the Cam- pylobacter jejuni N-Glycan-based vaccine with probiotics improves vaccine performance in broiler chickens. Appl Environ Microbiol. (2017) 83. doi: 10.1128/AEM.01523-17

25. Stacy AK, Mitchell NM, Maddux JT, De la Cruz MA, Durán L, Girón JA, Curtiss R, Mellata M. Evaluation of the prevalence and production of Escherichia coli common pilus among avian pathogenic E. coli and its role in virulence. PLoS ONE. (2014) 9(1):e86565. doi: 10.1371/journal.pone.0086565

26. Li Y, Wang S, Xin W, Scarpellini G, Shi Z, Gunn B, Roland K, Curtiss R. A sopB Deletion Mutation Enhances the Immunogenicity and Protective Efficacy of a Heterologous Antigen Delivered by Live Attenuated Salmonella enterica Vaccines. Infect Immun. (2008) 76(11):5238-46. doi: 10.1128/IAI.00720-08

27. Provence DL, Curtiss R. Role of crl in avian pathogenic Escherichia coli: a knockout mutation of crl does not affect hemagglutination activity, fibronectin binding, or Curli production. Infect Immun. (1992) 60(11):4460-7

28. Pei Y, Parreira V, Roland K, Curtiss R, Prescott J. Assessment of attenuated Salmonella vaccine strains in controlling experimental Salmonella Typhimurium infection in chickens. Can J Vet Res. (2014) 78(1):23-30

29. Mellata M, Mitchell NM, Schödel F, Curtiss R, Pier GB. Novel vaccine antigen combinations elicit protective immune responses against Escherichia coli sepsis. Vaccine. (2016) 34(5):656-62. doi: 10.1016/j.vaccine.2015.12.014

30. Johnson TJ, Kariyawasam S, Wannemuehler Y, Mangiamele P, Johnson SJ, Doetkott C, Skyberg JA, Lynne AM, Johnson JR, Nolan LK. The genome sequence of avian pathogenic Escherichia coli strain O1:K1:H7 shares strong similarities with human extraintestinal pathogenic E. coli genomes. J Bacteriol. (2007) 189(8):3228-36. doi: 10.1128/JB.01726- 06

31. Johnson T, Siek K, Johnson S, Nolan L. DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains. J Bacteriol. (2006) 188(2):745-58. doi: 10.1128/JB.188.2.745-758.2006

105

32. Barbieri NL, de Oliveira AL, Tejkowski TM, Pavanelo DB, Rocha DA, Matter LB, Callegari-Jacques SM, de Brito BG, Horn F. Genotypes and pathogenicity of cellulitis isolates reveal traits that modulate APEC virulence. PLoS ONE. (2013) 8(8):e72322. doi: 10.1371/journal.pone.0072322

33. Van Goor A, Stromberg Z, Mellata M. A recombinant multi-antigen vaccine with broad protection potential against avian pathogenic Escherichia coli. Plos ONE. (2017) 12(8). doi: 10.1371/journal.pone.0183929

34. Mellata M, Dho-Moulin M, Dozois C, Curtiss R, Brown P, Arne P, Bree A, Desautels C, Fairbrother J. Role of virulence factors in resistance of avian pathogenic Escherichia coli to serum and in pathogenicity. Infect Immun. (2003) 71(1):536-40. doi: 10.1128/IAI.71.1.536-540.2003

35. Ewers C, Antão EM, Diehl I, Philipp HC, Wieler LH. Intestine and environment of the chicken as reservoirs for extraintestinal pathogenic Escherichia coli strains with zoonotic potential. Appl Environ Microbiol. (2009) 75(1):184-92. doi: 10.1128/AEM.01324-08

36. Mellata M. Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog Dis. (2013) 10(11):916- 32. doi: 10.1089/fpd.2013.1533

37. Dziva F, Stevens MP. Colibacillosis in poultry: unravelling the molecular basis of virulence of avian pathogenic Escherichia coli in their natural hosts. Avian Pathol. (2008) 37(4):355-66. doi: 10.1080/03079450802216652

38. Solà-Ginés M, Cameron-Veas K, Badiola I, Dolz R, Majó N, Dahbi G, Viso S, Mora A, Blanco J, Piedra-Carrasco N, et al. Diversity of Multi-Drug Resistant Avian Pathogenic Escherichia coli (APEC) Causing Outbreaks of Colibacillosis in Broilers during 2012 in Spain. PLoS ONE. (2015) 10(11):e0143191. doi: 10.1371/journal.pone.0143191

39. Pande VV, Devon RL, Sharma P, McWhorter AR, Chousalkar KK. Study of Salmonella Typhimurium Infection in Laying Hens. Front Microbiol. (2016) 7:203. doi: 10.3389/fmicb.2016.00203

40. Gantois I, Ducatelle R, Pasmans F, Haesebrouck F, Gast R, Humphrey TJ, Van Immerseel F. Mechanisms of egg contamination by Salmonella Enteritidis. FEMS Microbiol Rev. (2009) 33(4):718-38. doi: 10.1111/j.1574-6976.2008.00161.x

41. Chousalkar K, Gole VC. Salmonellosis acquired from poultry. Curr Opin Infect Dis. (2016) 29(5):514-9. doi: 10.1097/QCO.0000000000000296

106

42. Curtiss R, Xin W, Li Y, Kong W, Wanda S, Gunn B, Wang S. New Technologies in Using Recombinant Attenuated Salmonella Vaccine Vectors. Crit Rev Immunol. (2010) 30(3):255-70

43. Tellez G, Pixley C, Wolfenden R, Layton S, Hargis B. Probiotics/direct fed microbials for Salmonella control in poultry. Food Res Int. (2012) 45(2):628-33. doi: 10.1016/j.foodres.2011.03.047

44. Adhikari PA. Overview of prebiotics and probiotics: focus on performance, gut health, and immunity- a review. In: Kim WK, ed.: Ann Anim Sci. (2017):949-66

45. Aydintug MK, Inzana TJ, Letonja T, Davis WC, Corbeil LB. Cross-reactivity of monoclonal antibodies to Escherichia coli J5 with heterologous gram-negative bacteria and extracted lipopolysaccharides. J Infect Dis. (1989) 160(5):846-57.

46. Mullan NA, Newsome PM, Cunnington PG, Palmer GH, Wilson ME. Protection against gram-negative infections with antiserum to lipid A from Salmonella minnesota R595. Infect Immun. (1974) 10(6):1195-201.

47. Paudel S, Stessl B, Hess C, Zloch A, Hess M. High genetic diversity among extraintestinal Escherichia coli isolates in pullets and layers revealed by a longitudinal study. BMC Vet Res. (2016) 12(1):221. doi: 10.1186/s12917-016-0859-5

48. Dvorožňáková E, Bucková B, Hurníková Z, Revajová V, Lauková A. Effect of probiotic bacteria on phagocytosis and respiratory burst activity of blood polymorphonuclear leukocytes (PMNL) in mice infected with Trichinella spiralis. Vet Parasitol. (2016) 231:69-76. doi: 10.1016/j.vetpar.2016.07.004

49. Belkaid Y, Hand TW. Role of the microbiota in immunity and inflammation. Cell. (2014) 157(1):121-41. doi: 10.1016/j.cell.2014.03.011

50. Kim YJ, Kim KH, Ko EJ, Kim MC, Lee YN, Jung YJ, Lee YT, Kwon YM, Song JM, Kang SM. Complement C3 Plays a Key Role in Inducing Humoral and Cellular Immune Responses to Influenza Virus Strain-Specific Hemagglutinin-Based or Cross-Protective M2 Extracellular Domain-Based Vaccination. J Virol. (2018) 92(20). doi: 10.1128/JVI.00969-18

51. Mellata M, Dho-Moulin M, Dozois C, Curtiss R, Brown P, Arne P, Bree A, Desautels C, Fairbrother J. Role of virulence factors in resistance of avian pathogenic Escherichia coli to serum and in pathogenicity. Infect Immun. (2003) 71(1):536-40. doi: 10.1128/IAI.71.1.536-540.2003

107

52. Wang S, Niu C, Shi Z, Xia Y, Yaqoob M, Dai J, Lu C. Effects of ibeA deletion on virulence and biofilm formation of avian pathogenic Escherichia coli. Infect Immun. (2011) 79(1):279-87. doi: 10.1128/IAI.00821-10

53. Shterzer N, Mizrahi I. The animal gut as a melting pot for horizontal gene transfer. Can J Microbiol. (2015) 61(9):603-5. doi: 10.1139/cjm-2015-0049

54. Zeng X, Lin J. Factors influencing horizontal gene transfer in the intestine. Anim Health Res Rev. (2017) 18(2):153-9. doi: 10.1017/S1466252317000159

55. Johnson TJ, Thorsness JL, Anderson CP, Lynne AM, Foley SL, Han J, Fricke WF, McDermott PF, White DG, Khatri M, et al. Horizontal gene transfer of a ColV plasmid has resulted in a dominant avian clonal type of Salmonella enterica serovar Kentucky. PLoS ONE. (2010) 5(12):e15524. doi: 10.1371/journal.pone.0015524

56. Varmuzova K, Kubasova T, Davidova-Gerzova L, Sisak F, Havlickova H, Sebkova A, Faldynova M, Rychlik I. Composition of Gut Microbiota Influences Resistance of Newly Hatched Chickens to Salmonella Enteritidis Infection. Front Microbiol. (2016) 7:957. doi: 10.3389/fmicb.2016.00957

57. Koenen ME, Boonstra-Blom AG, Jeurissen SH. Immunological differences between layer- and broiler-type chickens. Vet Immunol Immunopathol. (2002) 89(1-2):47-56.

58. Torres-Escobar A, Juárez-Rodríguez MD, Branger CG, Curtiss R. Evaluation of the humoral immune response in mice orally vaccinated with live recombinant attenuated Salmo- nella enterica delivering a secreted form of Yersinia pestis PsaA. Vaccine. (2010) 28(36):5810-6. doi: 10.1016/j.vaccine.2010.06.070.

108

Figures and Tables

Figure 4-1. Experimental design for treatments, sample collection, and analyses. (A) One- day-old chickens were split into 4 groups: probiotics only (PRO), vaccine only (VAX), both probiotics and vaccine (P+V), or no treatment (CON). Birds were placed in rooms based on vaccine treatment. Whole blood and sera were collected from birds before bacterial challenge, after which samples were collected to determine bacterial load. (B) Overview of analyses performed in this study. (C) Summary of the probiotics used in the present study. APEC, avian pathogenic Esche- richia coli; RASV, recombinant attenuated Salmonella vaccine.

109

Figure 4-2. Serum IgY antibody responses to treatments. Blood was collected from days 33 to 35, and serum was isolated to determine IgY antibody responses to treatments using ELISA. Chickens were placed into 4 groups: no treatment (CON), probiotics only (PRO), vaccine only (VAX), or both probiotics and vaccine (P+V). Each dot represents individual bird (n = 5-10 per group). Data are shown as mean ± standard deviation of 2 experiments performed in duplicate. **, P < 0.01; ****, P < 0.0001. LPS, lipopolysaccharide.

110

Figure 4-3. Whole-blood killing assay results with reference avian pathogenic Escherichia coli (APEC) strains and MG1655. Whole blood was pooled (n = 5), with each assay performed in triplicate, and 2 pools were performed per experimental replicate (days 34 and 35). Chickens were placed into 4 groups: no treatment (CON), probiotics only (PRO), vaccine only (VAX), or both probiotics and vaccine (P+V). Bars are shown as mean ± standard deviation of two experiments performed in triplicate. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

111

Figure 4-4. Serum bactericidal assay against multiple avian pathogenic Escherichia coli (APEC) isolates and reference strains. (A) MG1655 was the negative control owing to complement sensitivity. (B) χ7122, APEC O1, and APEC O2 were positive controls owing to known complement resistance. APEC isolates of various serogroups (O1, O2, O10, O18, O22, O23, O45, O55, O8/60, O78, O115, and O21/83) were used in this assay. Serum was pooled from 5 birds, and 2 pools were performed per experimental replicate. Chickens were placed into 4 groups: no treatment (CON), probiotics only (PRO), vaccine only (VAX), or both probiotics and vaccine (P+V). Data are shown as mean ± standard deviation of the mean of 2 experiments performed in triplicate. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

112

Figure 4-5. Gross colibacillosis lesions and bacterial loads after in vivo χ7122 challenge. An- imals were challenged via air sac with χ7122 and humanely euthanized 48 hpi. Tissues were (A) scored for signs of colibacillosis and (B) screened for bacterial enumeration. Bacterial enumeration was carried out in the blood at 24 hpi and in organs (spleen, liver, lung, and heart) at 48 hpi. Chickens were placed into 4 groups: no treatment (CON), probiotics only (PRO), vaccine only (VAX), or both probiotics and vaccine (P+V). Each dot represents an individual animal, and bars represent mean ± standard deviation. *, P < 0.05; **, P < 0.01 ***, P < 0.001. hpi, h post-infection.

113

Figure 4-6. Salmonella Kentucky shedding in feces after challenge. Animals were orally inoculated with S. Kentucky CVM29188, and feces were collected from birds at 3, 7, and 14 days after challenge for bacterial enumeration. Chickens were placed into 4 groups: no treatment (CON), probiotics only (PRO), vaccine only (VAX), or both probiotics and vaccine (P+V). Each dot represents an individual animal, and bars represent mean ± standard deviation. *, P < 0.05.

114

Table 4-1. Description of bacteria and plasmid used in this study. Strain or plasmid Relevant genotype, phenotype, and charac- References teristics Recombinant attenuated Salmonella Typhimurium vaccine 9373 ∆pmi-2426 ∆(gmd-fcl) 26∆Pfur81::TT araC PBAD 28 fur ∆Pcrp527::TT araC PBAD crp ∆asdA21:TT araC PBAD c2∆araE25 ∆araBAD23 ∆relA198::araC PBADlacI TT Salmonella Kentucky CVM29188 Tetracycline (tetRA) and streptomycin (strAB) re- 5 sistance Escherichia coli: complement resistant APEC O1 APEC isolate, O1 30 7233 APEC isolate, O1 25 7254 APEC isolate, O1 25 APEC O2 APEC isolate, O2 31 7245 APEC isolate, O2 25 7255 APEC isolate, O2 25 7533 APEC isolate, O10 25 7234 APEC isolate, O18 25 7501 APEC isolate, O22 25 7256 APEC isolate, O22 25 7531 APEC isolate, O23 25 7249 APEC isolate, O45 25 7520 APEC isolate, O55 25 7541 APEC isolate, O8/O60 25 7122 APEC isolate, O78 25 7516 APEC isolate, O78 25 7547 APEC isolate, O21/O83 25 7509 APEC isolate, O115 25 Escherichia coli: complement sensitive MG1655 Laboratory strain, K-12, OR:K-:H48 32 7235 APEC isolate, O1 25 7504 APEC isolate, O6 25 7523 APEC isolate, O8 25 7499 APEC isolate, O9 25 7536 APEC isolate, O10 25 7260 APEC isolate, O11 25 7510 APEC isolate, O11 25 7507 APEC isolate, O15 25 7500 APEC isolate, O45 25 7511 APEC isolate, O55 25 7537 APEC isolate, O71 25 7548 APEC isolate, O71 25 7241 APEC isolate, O78 25 7544 APEC isolate, O78 25 7550 APEC isolate, O78 25 7546 APEC isolate, O83 25 7558 APEC isolate, O83 25 7552 APEC isolate, O103 25 7525 APEC isolate, O114 25 7514 APEC isolate, O131 25 7542 APEC isolate, O131 25 7518 APEC isolate, O138 25 7512 APEC isolate, O7/O157 25 7540 APEC isolate, O173 25 Plasmid pYA3337 asd-based cloning vector (pSC101 ori) with Ptrc 58 promoter APEC, avian pathogenic E. coli. Underlined strains indicate reference strains used as positive or negative controls.

115

Table 4-2. Overview of treatment groups. Treatment group Probiotics (CFU/kg of feed) Vaccination

Control N/A N/A

Probiotics Bacillus subtilis (8 x 106), N/A

Lactobacillus acidophilus (3 x 106),

Pediococcus acidilactici (2 x 104),

Pediococcus pentosaceus (2 x 104),

Saccharomyces pastorianus (1 x 106)

Vaccine N/A 9373

Combo Bacillus subtilis (8 x 106), 9373

Lactobacillus acidophilus (3 x 106),

Pediococcus acidilactici (2 x 104),

Pediococcus pentosaceus (2 x 104),

Saccharomyces pastorianus (1 x 106)

N/A, not applicable.

116

CHAPTER 5. ORAL TREATMENT WITH ILEAL SPORES TRIGGERS IM- MUNOMETABOLIC SHIFTS IN CHICKEN GUT

Modified from a manuscript published in Frontiers in Veterinary Science

Graham A.J. Redweika,b, Michael H. Kogutc, Ryan J. Arsenaultd, and Melha Mellataa,b aDepartment of Food Science and Human Nutrition, Iowa State University, Ames, IA, USA; bIn- terdepartmental Microbiology Graduate Program, Iowa State University, Ames, IA, USA; cSouthern Plains Agricultural Research Center, USDA-ARS, College Station, TX, USA; dDe- partment of Animal and Food Sciences, University of Delaware, Newark, DE, USA

Abstract

The animal gut is a major site affecting productivity via its role in mediating functions such as food conversion and pathogen colonization. Live microorganisms like probiotics are widely used to improve poultry productivity. However, given that chicks receive their microbiota from the environment at-hatch, a bacterial treatment that can stimulate gut immune maturation in early life can benefit animal health. Thus, our lab has begun investigating alternative means to improve poultry health via single inoculation with microbial spores. In this study, we orally-inoculated day-old chicks with ileal scrapings (ISs) enriched for spores via chloroform treatment

(SPORE) or non-treated (CON). At 3-, 7-, and 14-days post-inoculation (dpi), gut permeability was measured via FITC-dextran assay in serum. Additionally, small intestinal scrapings (SISs) were tested for in vitro Salmonella killing and total IgA. Lastly, distal ileum was either fixed or flash-frozen for microscopy or kinome peptide array, respectively. Using bacterial 16S rRNA rRNA gene sequencing, SPORE and CON inocula were highly-similar in bacterial composition.

However, spores were detected in SPORE but not in CON inoculum. Segmented filamentous bacteria (SFB) filaments were observed in the distal ileum in SPORE birds as early as 3 dpi and all birds at 7 and 14 dpi. Additionally, SFB were detected via PCR in the ceca, colonizing all 117

SPORE birds at 3 dpi. At 3 dpi, SPORE birds exhibited lower gut permeability vs. CON. In

SPORE birds, SISs induced greater Salmonella growth in vitro at 3 dpi yet significantly-reduced Salmonella load at 7 and 14 dpi compared to CON in an IgA-independent manner. SPORE distal ileal tissue exhibited unique upregulation of several immunometabolic processes vs. CON birds, including innate (Toll-like receptor, JAK-STAT) and adaptive (T/B cell receptor, TH17 differentiation) immune pathways, PI3K/Akt signaling, mTOR signaling, and insulin-related pathways. Collectively, these data suggest oral inoculation with ileal spores generally-improved gut health.

Importance: We report that ileal, spore-forming commensal microbes have potent effects on ileum immunometabolism. Additionally, we identify a functional ileal phenotype in spore-treated chickens, which matched several of the observed immunometabolic changes and was associated with SFB colonization in the ileum.

Introduction

The intestinal tract is considered the central site for optimizing the health and production of food animals (1). In chickens, this complex tissue system must absorb nutrients to energize functions like growth and egg production while simultaneously serving as a barrier to pathogenic bacteria (ex: Salmonella) (2). Thus, interventions at the gastrointestinal tract are effective options to maximize health and production potential. Probiotics are commonly given to poultry to further maximize feed efficiency and pathogen resistance. Current probiotics require continuous addition in feed due to their inability to persist for long periods (3). Some taxa (i.e., Lactobacil- lus) have been found to serve as reservoirs for antibiotic resistance (4). This need to continually supplement probiotics in the feed as well as label inaccuracies like viability increases production 118 costs for poultry producers (5, 6). Thus, a novel probiotic that can be deliverable in a viable state and confer benefits after only a single dose is needed and would be immensely beneficial for poultry farmers. Spore-forming bacteria like Bacillus have become popular probiotics given their ability to form durable endospores [reviewed in (7)]. Spore-forming members of the ileal microbiota such as segmented filamentous bacteria (SFB) have been experimentally-demonstrated to have drastic yet positive impacts on mammalian gut immunity (8). Thus, we hypothesized that spores recovered from the ileum might have significant effects on the maturation of the chicken immune system.

Most immune-signaling pathways and critical metabolic processes are regulated by protein kinases. These enzymes catalyze the post-translation modification process of proteins known as phosphorylation. Kinomics is the global study of kinases and kinase signaling, as phosphorylation plays a crucial role in mediating most cellular signaling processes. Regulation of protein function through phosphorylation is observed in cellular processes that include metabolism, apoptosis, and signal transduction (9-11). The reversible nature of phosphorylation makes this biochemical event a critical feature and an effective mechanism for regulating protein behavior

(10). The development of the chicken-specific kinome peptide array has provided an invaluable tool for exploring the gut health phenotype through phosphorylation-mediated signaling (11). In this study, we tested the probiotic potential of ileal spores in young chicks using multiple approaches, including assays for gut health, microscopy, and immunometabolic kinome profiling.

119

Materials and Methods

Ethics Statement

Animal experiments were approved by Iowa State University Institutional Animal Care and Use Committee (IACUC) (protocols # 18-386 and 19-072). Animal enrichments were added to open floor pens to minimize stress during experimental procedures. Euthanasia techniques

(CO2 asphyxiation) followed the American Veterinary Medical Association Guidelines (2013).

Inoculum Preparation

Methods were based on previous experiments to enrich for ileal spores in mice (13).

Briefly, scrapings from the distal ileum and ileo-ceco-colic junction of two-week-old commercial layer pullets (Clearfield, IA; n = 10) were pooled and resuspended in PBS (3 mM EDTA). These commercial pullets were fed a corn-based SBM formula supplemented with wheat middling.

Pooled scrapings were then treated (SPORE) or untreated (CON) with chloroform (3% total solution). Tubes were gently inverted and placed on ice for 3 h until returning to Iowa State Uni- versity, where tubes were then incubated for 30 min at 37°C. Inocula were then injected with

CO2 to remove chloroform from SPORE inoculum. After a subsequent incubation for 10 min at room temperature (RT), the top layer was transferred to fresh microcentrifuge tubes and centrifuged at 10,000 × g for 10 min. The supernatant was discarded and the pellet was resuspended in a peptone-glycerol solution, evenly pooled between groups, purified through a 5 μm filter, and stored at −80°C for 3 months prior to animal-inoculation. The entire processes for both inocula were done under aerobic conditions. 120

16S rRNA Sequencing and Analysis

Total DNA was isolated via bead-beating from a single SPORE and CON inocula replicate (given inocula were pooled prior to storage) using the DNeasy PowerSoil Kit (Qiagen). No- tably, this kit lacks enzymatic digestion steps, although no differences in community composition were observed when compared to other commonly-used DNA extraction kits (14). Extracted

DNAs were assessed for quality using a NanoDrop 2000 spectrophotometer (260 to 280 nm ratios), and concentrations were determined using a Qubit fluorometer via dsDNA broad range kit

(ThermoFisher Scientific). Sample DNA concentration was then adjusted to 50 ng/μl in nuclease-free water, and library-prepared via MiSeq and HiSeq2500 kit (Illumina) following all manufacturer's instructions with 250 × 250 paired-end MiSeq sequencing (Illumina). DNAs were then sequenced via Illumina MiSeq (v3) at the Iowa State DNA facility. Using QIIME2 (version

2019.10) for 16S rRNA rRNA gene analysis, sequences were demultiplexed via QIIME2 demux emp-paired function and denoised via QIIME2 plugin DADA2. The number of good quality reads for taxonomic assignment ranged from 36,954 to 80,793 reads. SILVA database at the 99% operational taxonomic units (OTUs) spanning the V4 and V5 regions (515F,

GTGYCAGCMGCCGCGGTAA; 926R, CCGYCAATTYMTTTRAGTTT) was used to classify each of the reads using QIIME2's feature-classifier function. The raw sequence reads are available in the NCBI Sequence Read Archive (SRA) repository with accession BioProject ID

PRJNA637043.

Spore Imaging

For negative-staining of spores, 2 μl of each intestinal scraping sample was applied to a carbon film copper grid and incubated for 30 s at RT. The supernatant was briefly wicked, and 2 121

μl of aqueous 2% uranyl acetate (UA) was applied to the grid and allowed to sit for 30 s. The UA was wicked, and the resulting thin film was allowed to dry. Images were taken using a JEOL

JSM 2,100 scanning transmission electron microscope at 200 kV (jeol.com) with a Gatan One

View camera (gatan.com).

Chicken Treatment

One-day-old male and female specific pathogen-free White Leghorns (VALO, Adel, IA) were randomly placed into 2 pens (n = 21 birds/pen) in the same room. Immediately after placement, birds were orally inoculated with sodium bicarbonate and 50 μl inoculum (chloroform- treated, SPORE; non-chloroform-treated, CON). SPORE inoculum contained ~150 spores per 50 ul aliquot. Food and water were provided 30 min after treatment. Following inoculation, body weights were collected at days 1 (prior to inoculation) and 11.

PCR

Intestinal scraping and ceca content samples were separately-homogenized for 20 min via bead-containing tubes. DNAs were then extracted via DNeasy Powersoil Kit, and DNA concentrations were evaluated via NanoDrop 2000. SFB-specific 16S rRNA PCR primers (15) were as follows: forward primer, AGGAGGAGTCTGCGGCACATTAGC; reverse primer, TCCCCAC-

TGCTGCCTCCCGTAG. All reactions used 50 ng DNA template and 5 μM each primer. An initial denaturing step was set at 95°C for 15 min, followed by 32 cycles of 95°C (30 s), 59°C (30 s), and 72°C (30 s) as previously described (15).

122

Gut Permeability

At days 3, 7, and 14 post-inoculation, birds (n = 7 per time point) were orally inoculated with fluorescein isothiocyanate dextran (FITC-d, MW 3–5 kDa; Sigma Aldrich; 8.32 mg/kg chicken) 2 h prior to sacrifice. Serum from all FITC-d-inoculated birds was collected via wing vein, subsequently-centrifuged, and kept at 4°C until ready to aliquot onto 96 well-plates. A standard curve using serum from naïve birds serially-diluted for specific, added FITC-d concentrations (6,400 to 0 ng/ml) was developed to normalize output. A spectrophotometer was used to measure FITC concentration at an excitation wavelength of 485 nm and an emission wavelength of 528 nm.

Measuring Lengths of Intestinal Segments

Prior to intestinal sample collection, lengths of the small intestine (i.e., proximal segment attached to gizzard to ileo-ceco-colic junction), ceca loops, and colon (i.e., ileo-ceco-colic junction to cloaca opening) were measured via ruler. The average length of the two ceca loops per bird was used as the single value for ceca length per replicate.

Scanning Electron Microscopy of the Distal Ileum

Roughly 2 cm segments of distal ileum (n = 4 per group per time point) were fixed in

SEM fixative (4% paraformaldehyde, 3% glutaraldehyde and 0.1 M cacodylate buffer at pH 7.4) at 4°C until proceeding to next step. Tissues were washed with fresh SEM fixative overnight at

RT, followed by two 15 min washes in SEM fixative. Then, tissues were post-fixed with 1% os- mium tetroxide (0.1 M cacodylate buffer) for 1 h and washed in water for 15 min. For dehydra- tion, tissues were then incubated with 50, 70, 85, and 95% ethanol for 1 h each, followed by 123 overnight incubation with 100% ultrapure ethanol at RT. Then, specimens were dried to critical- point drying via liquid carbon dioxide as the medium and placed in a desiccator until ready to image. Prior to imaging, samples were coated with platinum and examined with a Hitachi S-800 scanning microscopy microscope at 10 kV.

Analyses of Paraffin-Embedded Ileo-Ceco-Colic Junction

The ileo-ceco-colic junction of each bird were placed into 4% PFA and stored at RT.

Subsequently, 5 μm paraffin-embedded cross sections were stained with hematoxylin and eosin

(H&E) to assess gut inflammation. More-specifically, parameters measuring inflammation (i.e., focal, multifocal, diffuse), infiltrate (i.e., presence of heterophils, lymphocytes, macrophages as well as hemorrhages), necrosis (i.e., focal, multifocal, diffuse), and location (i.e., lamina propria, villous lamina propria, crypt lamina propria) were used. Furthermore, sections were stained with

Alcian blue to enumerate goblet cells. Analyses were performed by a certified pathologist at

Iowa State University.

Bactericidal Assays Against Salmonella

To collect small intestinal scrapings (SISs), a 10-cm segment aligning Meckel's diverticulum in the center was longitudinally-cut, excess luminal contents were removed, and the epithelial layer was gently scraped and resuspended with 10 ml phosphate-buffered saline (PBS). Coni- cals were centrifuged at 5,000 × g for 20 min at 4°C, and 1 ml supernatant was added to 30 μl storage mixture (1% sodium azide, 5% BSA, 50 mM phenylmethane sulfonyl fluoride) before storage at −80°C. Importantly, SISs were confirmed to be Enterobacteriaceae-negative via plat- 124 ing on MacConkey agar. To determine broad protection against Salmonella, several S. enterica strains (Table 5-1) were cultured on LB agar (0.1% glucose). Individual colonies were added

2 to PBS until OD600 reached 0.1, and this inoculum was diluted until 10 CFU/100 μl was reached. SISs were pooled into two groups per treatment at each time point (A, n = 4; B, n = 3), and pooled washes were added to Salmonella inoculum at 1:1 ratio and incubated for 6 h at

37°C. Solutions were then serially diluted and plated on MacConkey for bacterial enumeration.

SIS bactericidal assays were run in triplicate.

Small Intestinal Total IgA

Ninety-six-well plates were coated with 0.25 μg/ml unlabeled mouse anti-chicken IgA

(i.e., total IgA; H+L, ThermoFisher) overnight at 4°C. CON and SPORE SISs were diluted 1:1 in

SEA blocking buffer (ThermoFisher), serially diluted 1:2, and incubated for 1 h at RT. Goat- anti-chicken-IgA-AP (H+L, ThermoFisher) was added, followed by PNPP substrate (Ther- moFisher), and absorbance was measured at 405 nm. To measure antibody titer, the reciprocal of the highest dilution values doubling the control value (i.e., CON birds) were considered positive.

ELISAs were done in duplicate per individual bird (n = 7 per group per time point) and independently-replicated twice.

Chicken-Specific Immunometabolic Kinome Peptide Array

Distal ileum tissues (n = 4 per time point per group) were flash-frozen and stored at

−80°C and transported overnight on dry ice to the University of Delaware. For kinome peptide array analyses, ileum tissues from four birds were used per group. Peptide array protocol was carried out as previously described and summarized below (12). Briefly, 40 mg of tissue samples 125 were used for the kinome peptide array protocol. Samples were homogenized by a Bead Ruptor homogenizer in 100 μl of a lysis buffer containing protease inhibitors. Homogenized samples were then mixed with an activation mix containing ATP and applied to peptide arrays. Arrays were incubated in a humidity chamber at 37°C with 5% CO2, thus allowing kinases to phosphor- ylate their target sites. Samples were then washed off the arrays, and a fluorescent phosphostain was applied. Stains not bound to phosphorylated sites were removed by a destaining process. Ar- rays were then imaged using a Tecan PowerScanner microarray scanner (Tecan Systems, San

Jose, CA, USA) at 532–560 nm with a 580 nm filter to detect dye fluorescence. Array images were then gridded using GenePix Pro software (Molecular Devices, San Jose, CA, USA), and the spot intensity signal was collected, thus ensuring peptide spots were correctly associated with their phosphorylation sites. Greater intensity fluorescence correlates to greater phosphorylation at the target site. Fluorescent intensities for treatments were then compared with controls using

PIIKA2 (18). The resulting data output was then used in downstream applications such as

STRING (19) and KEGG (20) databases used to pinpoint changes in the protein–protein interactions and signal transduction pathways.

Statistical Analyses

Statistical comparisons for weight gain, intestinal segment length, gut permeability, Sal- monella killing, and IgA production were performed via Student's t-test on GraphPad Prism software. For the kinome array, collected signal intensity values from the scanned array image were arranged into the PIIKA2 input format in Excel. The resultant data were then analyzed by the

PIIKA2 peptide array analysis software (http://saphire.usask.ca/saphire/piika/index.html). Using 126 the normalized data set, we performed comparisons between treatment and control groups, calculating fold change (= treatment/control) and a significance P-value. The P-values were calculated by conducting a one-sided paired t-test between treatment and control values for a given peptide.

The resultant fold change and significance values were used to generate optional analysis

(heatmaps, hierarchical clustering, principal component analysis, pathway analysis) via standard

R statistical functions or online analysis platforms.

Results

Chloroform-Treated ISs Enhanced Spore Enrichment

Using transmission electron microscopy (TEM), we did not detect any spores in non- chloroform treated samples, in which bacterial cells exhibited atrophy and death (Figures 5-1A and B). Although chloroform-treated ISs showed some cellular atrophy (Figure 5-1C), spores were widely observed (Figures 5-1D through F) at ~10 spores per μl. Using 16S rRNA sequencing, we found that bacterial abundances were highly similar in SPORE and CON inocula, with non-spore (ex: Faecalibacterium, Subdoligranulum, Butyricoccus), and spore-forming (ex: Can- didatus Arthromitus, Romboutsia) Clostridia (Figure 5-2). No Bacillus species were detected.

The lack of healthy microbes in the CON inoculum suggests the 16S rRNA rRNA gene sequences detected in CON inoculum do not indicate viable bacteria but rather dead cells (21, 22).

SFB Colonize Gut at Much-Earlier Age in SPORE Birds

SFB colonization is considered a biomarker for healthy poultry (23-25). It plays a major role in immune maturation in mammalian models (8). SFB exclusively-attach to the distal ileum 127 compared to other commensal bacteria [reviewed in (26)] and are routinely-visualized via scanning electron microscopy (SEM) (23, 27). SFB observations from SEM imaging are visually-rep- resented and summarized in Figure 5-3. In CON group, SFB filaments were absent in chicks at 3

(Figure 5-3A) and 7 dpi (Figure 5-3B) and were only detected at 14 dpi in 50% of birds (Figure

5-3C). However, in the SPORE-treated group, SFB filaments were detected at 3 dpi in 50% of birds (Figure 5-3D) and in all birds tested at 7 (Figure 5-3E) and 14 dpi (Figure 5-3F). Given the murine cecum serves as a reservoir for SFB (8), we investigated the presence of SFB in the chicken ceca content via PCR. SFB were detected in the chicken ceca in all SPORE birds at 3 dpi, whereas SFB was not consistently-detected in the ceca of CON birds at 3 dpi (Figure 5-4).

Nearly all CON and SPORE birds were positive for SFB in the ceca at 7 and 14 dpi (Figure 5-4).

SPORE Birds Had Reduced Weight Gain and Gut Permeability

Tracking weights from 1 to 11 days post-hatch (Figure 5-5A), SPORE birds had slightly- reduced weight gain (61.89 ± 2.99 g) vs. CON birds (70.27 ± 1.67 g; P < 0.05). This finding was independent of feed intake, as net feed consumption during this time frame was nearly-identical between groups (Figure 5-9; CON, 80.7 g; SPORE, 83.2 g). Measuring intestinal segment lengths 14 days post-treatment (Figure 5-5B), the small intestine length was similar among groups (CON, 69.51 ± 3.18 cm; SPORE, 65.81 ± 1.48 cm). Although not statistically-significant,

CON ceca lengths (6.90 ± 0.24 cm) were longer than SPORE lengths (6.24 ± 0.24 cm; P < 0.08), and SPORE colon lengths (4.19 ± 0.09 cm) were longer than CON lengths (4.67 ± 0.24 cm; P <

0.08). However, at 3 dpi, gut permeability was significantly reduced in SPORE (2.82 ± 0.09 ng

FITC-d/ml serum) vs. CON birds (3.61 ± 0.21 ng FITC-d/ml serum; Figure 5-5C; P < 0.01), but 128 no differences were seen 7 nor 14 dpi (Figure 5-10). Additionally, treatment did not affect inflammation (hematoxylin and eosin, H&E; Figure 5-11) nor goblet cell enumeration (Alcian blue; data not shown) in the ileo-ceco-colic junction of birds at any time point.

SPORE SISs in vitro Salmonella Killing Was Time-Dependent and IgA Independent

Using small-intestinal scrapings (SISs) for in vitro Salmonella-killing assays, we found that SPORE SISs at 3 dpi (Figure 5-6A) were highly reduced in inhibiting the growth of every S. enterica serovar tested vs. CON (P < 0.05). However, at 7 (Figure 5-6B) and 14 (Figure 5-6C) dpi, SPORE SISs had greater growth-suppression of all S. enterica serovars tested vs. CON (P <

0.05). Measuring total IgA in SISs at each time point (Figure 5-7), endpoint titers were similar at

3 and 14 dpi between SPORE and CON birds. However, total IgA levels were significantly lower at 7 dpi in SPORE compared to CON birds (P < 0.0001).

Several Immune and Metabolic Pathways Were Globally Altered in SPORE Birds

Chicken-specific kinome arrays were used to assess changes to ileal immunometabolism

(12). Kinome analysis was carried out on the ileal samples taken from SPORE and CON chickens at 3 and 7 dpi (n = 4 per group per time point). The results from the biological replicates from each group (SPORE and CON) and time point were combined to provide a representative result. To remove any non-specific or baseline phosphorylation signals from the analysis, data from each time point was compared to matched controls. Kinome data were subjected to pathway overrepresentation analysis to determine which cellular pathways/processes are activated under the SPORE conditions as compared to time-matched CON. To ensure that the identified 129 pathways represent conserved and consistent biological responses, input data were limited to peptides with a consistent pattern of differential phosphorylation across the four biological replicates as well as significant changes (P ≤ 0.05) in phosphorylation level relative to CON. These peptides for each time-point were input into the Search Tool for the Retrieval of Interacting

Genes/Proteins (STRING) database (19). Using STRING functionality, Kyoto Encyclopedia of

Genes and Genomes (KEGG) (20) pathway results were generated for each dataset. The

STRING-generated KEGG-pathway results showed several pathways altered by spore inoculation at a statistically significant level [P ≤ 0.05 false discovery rate (FDR) corrected].

Several immune and metabolic signaling pathways were dramatically altered by SFB treatment. The top 19 immunologic and 18 metabolic altered pathways are shown in Tables 5-2 and 5-3, respectively. Both immunologic and metabolic KEGG pathways had multiple peptide phosphorylation events altered at both time-points post-inoculation. In total, 414 differentially phosphorylated peptides from immune pathways were observed in the ileum of chickens 3 dpi and 389 differentially phosphorylated immune peptides on 7 dpi (Table 5-2), signifying a dramatic local post-translational modification of the immune proteins induced by the SPORE treatment. Of the 414 immune-related peptides differentially phosphorylated at 3 dpi, 109 belong to the innate immune signaling pathways including pattern recognition receptor signaling (TLR and

NOD), NK cell signaling, and Fc receptor phagocytosis (ε and γ) while 95 immune-related peptides belonging to the acquired immune signaling pathways including the T cell receptor signaling, IL17 signaling, and JAK-STAT pathways. By 7 dpi, there was a reduction in SPORE innate immune signaling compared to SPORE birds at 3 dpi: 81 total peptides from the TLR and NOD signaling, NK cell signaling and Fc receptor phagocytosis signaling. Conversely, by 7 dpi there was an increase in the number of phosphorylated peptides in SPORE from the acquired T cell 130

signaling pathways: 109 including T cell receptor signaling, TH17 differential signaling, IL17 signaling, and JAK-STAT pathways compared to SPORE birds at 3 dpi. More specifically, TH17 signaling was only increased in SPORE birds compared to CON at 7 dpi (Table 5-2).

Concurrently with several changes in peptide-phosphorylation in the ileal immune response, dramatic alterations in the metabolic phenotype were also occurring in the SPORE- treated chickens (Table 5-3). A total of 389 metabolically associated peptides were altered in the ileum of SPORE-treated chickens compared to CON birds at 3 dpi. Additionally, 101 of these peptides were associated with the mammalian target of rapamycin (mTOR), hypoxia-inducible factor-1α (HIF-1α), and insulin signaling pathways. The mTOR pathway phosphorylation triggers the local tissue's phenotype to anabolic metabolism by increasing the expression of the transcription factor HIF- 1α (28-31). An increase in HIF-1α expression results in the subsequent increased transcription of both glycolytic genes and pro-inflammatory genes (29, 30). Further, there are 30 altered peptides in the 5'-adenosine monophosphate-activated protein kinase

(AMPK) pathway at 3 dpi. AMPK is a sensor of cellular metabolism that directly mediates the function of mTOR and switches metabolic phenotype to catabolic metabolism when it senses a change in the AMP: ATP ratio (32, 33). Both alpha and beta subunits of AMPK showed significantly decreased phosphorylation (data not shown), implying that the AMPK pathway was deactivated. Similar results were observed at 7 dpi in the SPORE-treated chickens with 81 altered peptides associated with the insulin, mTOR, and HIF-1α signaling pathways with only 21 peptides in the AMPK pathway.

To determine similarities in kinome profiles (i.e., kinotypes) between treatment groups and time points, Platform for Intelligent, Integrated Kinome Analysis, version 2 (PIIKA2) was used to combine the biological replicates for each treatment and tissue, normalize the data, and 131 generate a representative kinotype that provides a visual image of the differences in phosphorylation events between SPORE and CON. Figure 5-8 shows that the most similar distal ileum kinotypes were CON from 7 dpi and SPORE from 3 dpi. However, the kinotype of SPORE birds from 7 dpi was the most unique, separating from the other three kinotypes.

Discussion

Clostridia consists of several spore-forming bacteria that play a major role in the maturation of the gut immune system in mammals. SFB, otherwise known as Candidatus Arthromitus or Savagella (34), are widely distributed among animals and were detected in each inoculum via bacterial 16S rRNA rRNA gene sequencing. In mice, SFB directly attach to the epithelium without damaging the gut barrier nor causing excessive inflammation (35) and improve epithelial barrier functions (13) as well as resistance to enteric infections like Citrobacter and Salmo- nella (8, 36). The limited work on poultry SFB demonstrate they colonize the distal ileum, cecal tonsil, and loops (37) and are associated with improved IgA production (24) and growth performance (25). Other notable Clostridia detected in the inocula include Faecalibacterium, Butyr- icicoccus, and Subdoligranulum. Faecalibacterium prausnitzii is a butyrate producer that improves anti-inflammatory functions and has been posited as a probiotic candidate in humans (38; reviewed in 39). Butyricoccus pullicaecorum was previously isolated from the chicken ceca (40) and demonstrated to have probiotic potential as a butyrate and acetate producer, depending on in vitro conditioning (41). Subdoligranulum variabile, another butyrate producer, is phylogenet- ically-similar to F. prausnitzii but otherwise has not been well-characterized (42). Importantly, all of these bacterial species are unable to form spores (40, 42, 43), which suggests that the 16S rRNA rRNA gene reads for several taxa detected in these inocula were derived from remnants of 132 the cellular fraction of intestinal scrapings and are not indicative of viable bacteria. Since spores were only-observed in the chloroform-treated SPORE inoculum, this suggests that only spore- forming bacteria like SFB (13), Romboutsia (44), Lachnospiraceae and Ruminococcaceae (45) would be viable in the SPORE inoculum. Future studies will use fluorescence in situ hybridization to assign species-identity to the spores and use live-dead fluorescence sorting to remove dead cells prior to 16S rRNA rRNA gene sequencing (25).

Interestingly, although SFB only constituted a minority of the 16S rRNA reads, there were vast improvements in their intestinal colonization when delivered via single SPORE inoculum. Thus, we demonstrate that oral inoculation with ileal spores 1) hastens SFB colonization and 2) improves the consistency of SFB colonization between birds. However, it is unclear whether this colonization is facilitated by SFB in the inoculum directly, whether other spore-formers present in the inoculum produce certain metabolites, which improve SFB colonization, or a combination of both mechanisms. A single-dose in ovo inoculation of lactic acid-producing bacteria (LAB) increased 16S rRNA reads of SFB in the distal ileal microbiome by day 10 post- hatch (46), suggesting that early exposure to LAB or ileal spores promote early colonization of

SFB. However, although our study used oral inoculation at day-of-hatch to deliver these ileal spores, comparing this method with in ovo delivery would be worth pursuing. Additionally, one of the more notable findings of our study was the broad changes of numerous immunometabolic pathways in SPORE birds, associated with SFB adherence to the distal ileum. This study showed a consistent trend in which phosphorylation shifts in immunometabolic pathways, mainly innate immunity, were reduced from 3 to 7 dpi. Similarly, single-dose in ovo delivery of Citrobac- ter species or LAB also altered early inflammatory responses in the chicken gut (47, 48). These findings suggest that innate immune responses are highly responsive to microbial “pioneers” in 133 the chicken intestine. Furthermore, our study specifically-finds that innate immune responses in the ceca peaked early post-inoculation of ileal spores but decreased over time.

As seen in this study, we identified increased phosphorylation of several enzymes within mTOR, insulin, and PI3K/Akt signaling pathways at both 3 and 7 dpi in SPORE birds. The protein mTOR is a serine/threonine, PI3K-related kinase that directs cell metabolism via sensing environmental cues, such as when immune cells are in metabolically-demanding situations during stimulation with immune regulatory signals (32). Additionally, mTOR is incorporated into two protein complexes, mTOR1 and mTOR2. These complexes are essential in regulating nutrient and endocrine signals (mTOR1) as well as proliferation and survival [reviewed in (49)]. The most important role for mTOR2 is the activation of Akt, the key effector in insulin/PI3K signaling (50). In fact, insulin and mTOR signaling pathways are highly coupled and display significant overlap, so much that it is referred to as the insulin/mTOR signaling pathway (51, 52). All of these pathways have been previously reported to interact with the gut microbiota (35, 53-55), suggesting the microbes in the SPORE inoculum are driving these responses. Work is currently underway to more-closely analyze these phosphorylation networks to identify a mechanism in which the ileal spore-inoculum induced kinomic changes over time.

In the current study, SPORE birds exhibited less weight gain than CON birds from 1 to

11 days post-hatch. Given that gut microbes calibrate the chicken gut immune system in early life (56), it is likely the large, immunometabolic shifts seen in this study shifted resources from weight gain to the immune system. Animals that undergo excessive innate and inflammatory responses grow more slowly due to reduced feed conversion efficiency (57). Although weight gain is one of the most important parameters for broiler productivity, it needs to be emphasized that 2) 134 this study investigated the effects in layers, which are immunologically and metabolically-distinct from broilers (58-60) and 2) only the first eleven days post-inoculation were evaluated, con- founding conclusions on how this ileal spore treatment could affect broiler productivity. Addi- tionally, several innate immune pathways like Toll-like receptor and JAK-STAT were activated in SPORE birds, suggesting the reduced weight gain is a result of host innate responses to the

SPORE inoculum. Although SPORE inoculum activated innate immune pathways, there were no differences in ceca inflammation between SPORE and CON birds based on H&E staining. Thus, this innate inflammation appears to be non-pathological. Although inflammation in the ileum

(the primary site of SFB adherence) was not measured, SFB adherence to this site, has not been implicated in ileal inflammation (61). Additionally, alterations in the PI3K/Akt signaling pathway, observed in this study, may also contribute to differences in growth rate between treatment groups (62). Altogether, we speculate that immune-cell populations in the SPORE gut may have utilized metabolic resources that might have otherwise contributed to growth.

SPORE birds exhibited lower gut permeability vs CON birds, suggesting these ileal spores reduce intestinal leakage. Similarly, the distal ileum of SPORE birds displayed notable changes in Wnt signaling and AMPK signaling. The Wnt pathway is conserved in animals and is crucial for maintaining homeostasis in the gut via differentiation of intestinal stem cells, which then differentiate into several cell-types like enterocytes and Paneth cells [reviewed in (63)]. Fur- thermore, AMPK signaling is crucial for cell-commitment to enterocytes, and loss of AMPK led to increased barrier leakiness (64). Thus, increased rates of cell differentiation into enterocytes may reduce gut permeability in SPORE birds. Additionally, Feng et al. found that higher levels of Akt phosphorylation and PI3K activation enhance gut barrier integrity (65), suggesting 135

SPORE-induced changes of the PI3K/Akt signaling pathway may also contribute to this reduction in gut permeability. Although we did not look at changes in tight junction protein formation and gene expression in this study, ileal spore treatment may have affected these parameters, as in ovo exposure to bacteria induced changes in tight junction signaling (47). Future studies will evaluate expression of tight junction proteins to allow better-interpretation of gut permeability data.

Paneth and plasma cells in the small intestine primarily release immunological effectors like host-defense peptides (HDPs) and IgA, respectively, making analyses of SISs an effective means of conveniently assessing gut immunity in vitro. These factors are crucial for regulating the gut microbiota (66, 67), including bacterial pathogens like Salmonella. In this study, SISs from SPORE birds at 7 and 14 dpi exhibited superior bactericidal activities against all Salmo- nella isolates vs. CON, albeit resistance was reduced at 3 dpi. However, the observed resistance at later time points suggests killing increases over time, although this remains to be explored in vivo. In vivo reduction of Salmonella Enteritidis in cecal tonsils and content was observed in birds given FloraMax®-B11 in ovo (68), suggesting that a single, early exposure to certain bacteria promote anti-Salmonella responses. These patterns in Salmonella resistance are notable, as poultry products are a major source of salmonellosis in the United States (69). However, these assays are not entirely-reflective of in vivo conditions, as cell-mediated mechanisms like hetero- phil infiltration (70) as well as microbiota-dependent mechanisms like competitive exclusion

(71). Rather, this assay is a basic screen to identify differences in bactericidal or bacteriostatic effector molecules present in SISs. In vivo tests against Salmonella will be explored in future studies. 136

Salmonella resistance was independent of IgA levels, as total IgA levels were not positively associated with bactericidal responses. Thus, antimicrobial products like HDPs were likely driving these responses. Uniquely, SPORE birds had reduced Salmonella in vitro resistance at 3 dpi, aligning with the absence of TH17 cell differentiation pathway-activation in the distal ileum.

Innate production of HDPs like gallinacins is elevated in the intestine of chicks at post-hatch for the first three days of life and drops after day four (72), which explains why CON birds exhibited greater Salmonella killing at 3 dpi independent of TH17 signaling. Similar to SFB-colonized mice (8), we report phosphorylation of the TH17 cell differentiation pathway in SPORE chickens at 7 dpi alone, a shift from TH1 and TH2 differentiation observed at 3 dpi. Supporting this hypothesis, propionate metabolism was similarly-phosphorylated at only 3 dpi in SPORE birds.

Propionate has been demonstrated in vitro to increase TH17 differentiation via promoting phosphorylation of an mTOR target protein (73). Under normal conditions, TH17 responses emerge around 16 days post-hatch (72), suggesting this treatment hastens maturation of the gut immune defenses. Thus, the elevated resistance to Salmonella in SPORE SISs at 7 and 14 dpi may result via a propionate-dependent, TH17 cell-mediated increase in HDP production.

One notable observation was that total IgA production was markedly lower at 7 dpi in

SPORE birds compared to controls. Similarly, as mentioned earlier, early HDP-production at 3 dpi appears downregulated by SPORE treatment (as indicated by reduced Salmonella resistance vs. CON birds). In chickens, SFB abundances naturally peak between 2- and 3-weeks post-hatch.

After this point, SFB levels fall as IgA levels begin to rise in the chicken intestine (24). This demonstrates an aversion to host-derived IgA by SFB, supported in studies in which IgA-deficient mice exhibit increased SFB colonization (15, 74). Thus, given SFB and other microbes in the SPORE inoculum may be susceptible to humoral immune effectors like HDPs and IgA, we 137 hypothesize these ileal spores elicit signals to downregulate innate-HDP and total IgA production in early life to facilitate initial colonization in the chicken intestine. However, HDP production appears to drastically-increase by 7 dpi in SPORE birds, likely due to changes in adaptive immunity (i.e., TH17 signaling) rather than innate mechanisms.

Conclusion

This study demonstrated for the first time that SFB spore-containing inoculum reduces gut permeability in young chickens and stimulates innate and adaptive immune responses. Addi- tionally, we are the first to study immunometabolic signaling induced by host-SFB interactions at the kinomic level. SFB-based treatment can potentially-protect chickens from enteric pathogens, partly due to its unique ability to trigger a TH17 response, which provides evidence of its potential as an agricultural treatment for poultry. Current efforts are underway to monoculture SFB in vitro to study its direct impacts on the chicken gastrointestinal tract as well as determine if common storage practices (i.e., lyophilization) can improve long-term maintenance of these intestinal spores.

Data Availability Statement

The datasets presented in this article are not readily available; data were generated and are maintained by MK. Requests to access the datasets should be directed to [email protected].

138

Author Contributions

GR and MM conceived, designed the experiments, and wrote the manuscript. GR, RA,

MK, and MM performed the experiments, analyzed the data, and revised the manuscript. RA,

MK, and MM contributed reagents, materials, and analysis tools. All authors read and approved

the final manuscript.

Acknowledgments

The authors thank Mary Kate Horak and Ryley Hoven (Iowa State University undergrad-

uates), Tracey Stewart (assistant scientist at Roy Carver Microscopy Facility, Iowa State Univer-

sity), and the Genome Informatics Facility (Iowa State University) for technical assistance in this

study.

References

1. Kogut MH, Arsenault RJ. Editorial: gut health: the new paradigm in food animal production. Front Vet Sci. (2016) 3:74. doi: 10.3389/fvets.2016.00071

2. Turner JR. Intestinal mucosal barrier function in health and disease. Nat Rev Immunol. (2009) 9:799–809. doi: 10.1038/nri2653

3. Schmidt C. The startup bugs. Nat Biotechnol. (2013) 31:279–81. doi: 10.1038/nbt.2544

4. Imperial IC, Ibana JA. Addressing the antibiotic resistance problem with probiotics: reducing the risk of its double-edged sword effect. Front Microbiol. (2016) 7:1983. doi: 10.3389/fmicb.2016.01983

5. Gueimonde M, Delgado S, Mayo B, Ruas-Madiedo P, Margolles A, de los Reyes-Gavilan CG, et al. Viability and diversity of probiotic Lactobacillus and Bifidobacterium populations included in commercial fermented milks. Food Res Int. (2004) 37:839–50. doi: 10.1016/j.foodres.2004.04.006

6. Weese JS, Martin H. Assessment of commercial probiotic bacterial contents and label accu- racy. Can Vet J. (2011) 52:43–6. 139

7. Grant A, Gay CG, Lillehoj HS. Bacillus spp. as direct-fed microbial antibiotic alternatives to enhance growth, immunity, and gut health in poultry. Avian Pathol. (2018) 47:339–51. doi: 10.1080/03079457.2018.1464117

8. Ivanov II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U, et al. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell. (2009) 139:485–98. doi: 10.1016/j.cell.2009.09.033

9. Hunter T. Protein kinases and phosphatases: the yin and yang of protein phosphorylation and signaling. Cell. (1995) 80:225–36. doi: 10.1016/0092-8674(95)90405-0

10. Jalal S, Kindrachuk J, Napper S. Phosphoproteome and kinome analysis: unique perspectives on the same problem. Curr Anal Chem. (2007) 3:1–15. doi: 10.2174/157341107779314253

11. Jalal S, Arsenault R, Potter AA, Babiuk LA, Griebel PJ, Napper S. Genome to kinome: species- specific peptide arrays for kinome analysis. Sci Signal. (2009) 2:pl1. doi: 10.1126/scisignal.254pl1

12. Arsenault RJ, Trost B, Kogut MH. A comparison of the chicken and turkey proteomes and phosphoproteomes in the development of poultry-specific immuno-metabolism kinome peptide arrays. Front Vet Sci. (2014) 1:22. doi: 10.3389/fvets.2014.00022

13. Umesaki Y, Okada Y, Matsumoto S, Imaoka A, Setoyama H. Segmented filamentous bacteria are indigenous intestinal bacteria that activate intraepithelial lymphocytes and induce MHC class II molecules and fucosyl asialo GM1 glycolipids on the small intestinal epithelial cells in the ex- germ-free mouse. Microbiol Immunol. (1995) 39:555–62. doi: 10.1111/j.1348- 0421.1995.tb02242.x

14. Rubin BER, Sanders JG, Hampton-Marcell J, Owens SM, Gilbert JA, Moreau CS. DNA extraction protocols cause differences in 16S rRNA amplicon sequencing efficiency but not in community profile composition or structure. MicrobiologyOpen. (2014) 3:910–21. doi: 10.1002/mbo3.216

15. Suzuki K, Meek B, Doi Y, Muramatsu M, Chiba T, Honjo T, et al. Aberrant expansion of segmented filamentous bacteria in IgA-deficient gut. Proc Natl Acad Sci USA. (2004) 101:1981–6. doi: 10.1073/pnas.0307317101

16. Curtiss R, Kelly SM, Hassan JO. Live oral avirulent Salmonella vaccines. Vet Microbiol. (1993) 37:397–405. doi: 10.1016/0378-1135(93)90038-9

17. Fricke WF, McDermott PF, Mammel MK, Zhao S, Johnson TJ, Rasko DA, et al. Antimicrobial resistance-conferring plasmids with similarity to virulence plasmids from avian pathogenic Escherichia coli strains in Salmonella enterica serovar Kentucky isolates from poultry. Appl Environ Microbiol. (2009) 75:5963–71. doi: 10.1128/AEM.00786-09

140

18. Trost B, Kindrachuk J, Määttänen P, Napper S, Kusalik A. PIIKA 2: an expanded, web-based platform for analysis of kinome microarray data. PLoS ONE. (2013) 8:e80837. doi: 10.1371/journal.pone.0080837

19. Szklarczyk D, Franceschini A, Wyder S, Forslund K, Heller D, Huerta-Cepas J, et al. STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. (2015) 43:447–52. doi: 10.1093/nar/gku1003

20. Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K. KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res. (2017) 45:353–61. doi: 10.1093/nar/gkw1092

21. Emerson JB, Adams RI, Román CMB, Brooks B, Coil DA, Dahlhausen K, et al. Schrödinger's microbes: tools for distinguishing the living from the dead in microbial ecosystems. Microbiome. (2017) 5:86. doi: 10.1186/s40168-017-0285-3

22. Li R, Tun HM, Jahan M, Zhang Z, Kumar A, Dilantho Fernando WG, et al. Comparison of DNA- , PMA-, and RNA-based 16S rRNA Illumina sequencing for detection of live bacteria in water. Sci Rep. (2017) 7:5752. doi: 10.1038/s41598-017-02516-3

23. Rahimi S, Grimes JL, Fletcher O, Oviedo E, Sheldon BW. Effect of a direct-fed microbial (prima- lac) on structure and ultrastructure of small intestine in turkey poults. Poult Sci. (2009) 88:491– 503. doi: 10.3382/ps.2008-00272

24. Liao N, Yin Y, Sun G, Xiang C, Liu D, Yu HD, et al. Colonization and distribution of segmented filamentous bacteria (SFB) in chicken gastrointestinal tract and their relationship with host immunity. FEMS Microbiol Ecol. (2012) 81:395–406. doi: 10.1111/j.1574-6941.2012.01362.x

25. Danzeisen JL, Calvert AJ, Noll SL, McComb B, Sherwood JS, Logue CM, et al. Succession of the turkey gastrointestinal bacterial microbiome related to weight gain. PeerJ. (2013) 1:e237. doi: 10.7717/peerj.237

26. Ivanov II, Littman DR. Segmented filamentous bacteria take the stage. Mucosal Immunol. (2010) 3:209–12. doi: 10.1038/mi.2010.3

27. Bohórquez DV, Bohórquez NE, Ferket PR. Ultrastructural development of the small intestinal mucosa in the embryo and turkey poult: a light and electron microscopy study. Poult Sci. (2011) 90:842–55. doi: 10.3382/ps.2010-00939

28. Byles V, Covarrubias AJ, Ben-Sahra I, Lamming DW, Sabatini DM, Manning BD, et al. The TSC-mTOR pathway regulates macrophage polarization. Nat Commun. (2013) 4:2384. doi: 10.1038/ncomms3834

141

29. Cheng SC, Joosten LA, Netea MG. The interplay between central metabolism and innate immune responses. Cytokine Growth Factor Rev. (2014) 25:707–13. doi: 10.1016/j.cytogfr.2014.06.008

30. Kogut MH, Genovese KJ, He H, Arsenault RJ. AMPK and mTOR: sensors and regulators of immunometabolic changes during Salmonella infection in the chicken. Poult Sci. (2016) 95:345–53. doi: 10.3382/ps/pev349

31. Kogut MH, Swaggerty CL, Byrd JA, Selvaraj R, Arsenault RJ. Chicken-specific kinome array reveals that Salmonella enterica serovar enteritidis modulates host immune signaling pathways in the cecum to establish a persistence infection. Int J Mol Sci. (2016) 17:1207. doi: 10.3390/ijms17081207

32. Cobbold SP. The mTOR pathway and integrating immune regulation. Immunology. (2013) 140:391–8. doi: 10.1111/imm.12162

33. Tannahill GM, Curtis AM, Adamik J, Palsson-McDermott EM, McGettrick AF, Goel G, et al. Succinate is an inflammatory signal that induces IL-1β through HIF-1α. Nature. (2013) 496:238– 42. doi: 10.1038/nature11986

34. Thompson CL, Mikaelyan A, Brune A. Immune-modulating gut symbionts are not “Candidatus arthromitus”. Mucosal Immunol. (2013) 6:200–1. doi: 10.1038/mi.2012.91

35. Caselli M, Holton J, Boldrini P, Vaira D, Calò G. Morphology of segmented filamentous bacteria and their patterns of contact with the follicle-associated epithelium of the mouse terminal ileum: implications for the relationship with the immune system. Gut Microbes. (2010) 1:367–72. doi: 10.4161/gmic.1.6.14390

36. Lai NY, Musser MA, Pinho-Ribeiro FA, Baral P, Jacobson A, Ma P, et al. Gut-innervating noci- ceptor neurons regulate peyer's patch microfold cells and SFB levels to mediate Salmonella host defense. Cell. (2020) 180:33–49.e22. doi: 10.1016/j.cell.2019.11.014

37. Klaasen HL, Koopman JP, Van den Brink ME, Bakker MH, Poelma FG, Beynen AC. Intestinal, segmented, filamentous bacteria in a wide range of vertebrate species. Lab Anim. (1993) 27:141– 50. doi: 10.1258/002367793780810441

38. Martín R, Miquel S, Benevides L, Bridonneau C, Robert V, Hudault S, et al. Functional characterization of novel. Front Microbiol. (2017) 8:1226. doi: 10.3389/fmicb.2017.01226

39. Miquel S, Martín R, Bridonneau C, Robert V, Sokol H, Bermúdez-Humarán LG, et al. Ecology and metabolism of the beneficial intestinal commensal bacterium Faecalibacterium prausnitzii. Gut Microbes. (2014) 5:146–51. doi: 10.4161/gmic.27651

40. Eeckhaut V, Van Immerseel F, Teirlynck E, Pasmans F, Fievez V, Snauwaert C, et al. Butyr- icicoccus pullicaecorum gen. nov, sp nov, an anaerobic, butyrate-producing bacterium isolated from the caecal content of a broiler chicken. Int J Syst Evol Microbiol. (2008) 58:2799–802. doi: 10.1099/ijs.0.65730-0 142

41. Geirnaert A, Steyaert A, Eeckhaut V, Debruyne B, Arends JB, Van Immerseel F, et al. Butyr- icicoccus pullicaecorum, a butyrate producer with probiotic potential, is intrinsically tolerant to stomach and small intestine conditions. Anaerobe. (2014) 30:70–4. doi: 10.1016/j.anaerobe.2014.08.010

42. Holmstrøm K, Collins MD, Møller T, Falsen E, Lawson PA. Subdoligranulum variabile gen. nov, sp nov from human feces. Anaerobe. (2004) 10:197–203. doi: 10.1016/j.anaerobe.2004.01.004

43. Duncan SH, Hold GL, Harmsen HJM, Stewart CS, Flint HJ. Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov, comb nov. Int J Syst Evol Microbiol. (2002) 52:2141–6. doi: 10.1099/00207713-52-6-2141

44. Gerritsen J, Fuentes S, Grievink W, van Niftrik L, Tindall BJ, Timmerman HM, et al. Character- ization of Romboutsia ilealis gen. nov., sp. nov., isolated from the gastro-intestinal tract of a rat, and proposal for the reclassification of five closely related members of the genus clostridium into the genera romboutsia gen. nov., Intestini-bacter gen. nov., terrisporobacter gen. nov. and asaccharospora gen. nov. Int J Syst Evol Microbiol. (2014) 64:1600–16. doi: 10.1099/ijs.0.059543-0

45. Browne HP, Forster SC, Anonye BO, Browne HP, Forster SC, Anonye BO, et al. Culturing of 'uncul-turable' human microbiota reveals novel taxa and extensive sporulation. Nature. (2016) 533:543–6. doi: 10.1038/nature17645

46. Rodrigues DR, Wilson KM, Trombetta M, Briggs WN, Duff AF, Chasser KM, et al. A proteomic view of the cross-talk between early intestinal microbiota and poultry immune system. Front Physiol. (2020) 11:20. doi: 10.3389/fphys.2020.00020

47. Wilson KM, Rodrigues DR, Briggs WN, Duff AF, Chasser KM, Bottje WG, et al. Impact of in ovo administered pioneer colonizers on intestinal proteome on day of hatch. Poult Sci. (2020) 99:1254–66. doi: 10.1016/j.psj.2019.10.017

48. Rodrigues DR, Winson E, Wilson KM, Briggs WN, Duff AF, Chasser KM, et al. Intestinal pioneer colonizers as drivers of ileal microbial composition and diversity of broiler chickens. Front Microbiol. (2020) 10:2858. doi: 10.3389/fmicb.2019.02858

49. Saxton RA, Sabatini DM. mTOR signaling in growth, metabolism, and disease. Cell. (2017) 169:361–71. doi: 10.1016/j.cell.2017.03.035

50. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science. (2005) 307:1098–101. doi: 10.1126/science.1106148

51. Punzo C, Kornacker K, Cepko CL. Stimulation of the insulin/mTOR pathway delays cone death in a mouse model of retinitis pigmentosa. Nat Neurosci. (2009) 12:44–52. doi: 10.1038/nn.2234 143

52. Arsenault RJ, Napper S, Kogut MH. Salmonella enterica typhimurium infection causes metabolic changes in chicken muscle involving AMPK, fatty acid and insulin/mTOR signaling. Vet Res. (2013) 44:35. doi: 10.1186/1297-9716-44-35

53. Caricilli AM, Saad MJ. The role of gut microbiota on insulin resistance. Nutrients. (2013) 5:829– 51. doi: 10.3390/nu5030829

54. Noureldein MH, Eid AA. Gut microbiota and mTOR signaling: insight on a new pathophysio- logical interaction. Microb Pathog. (2018) 118:98–104. doi: 10.1016/j.micpath.2018.03.021

55. Mishima Y, Oka A, Liu B, Herzog JW, Eun CS, Fan TJ, et al. Microbiota maintain colonic homeostasis by activating TLR2/MyD88/PI3K signaling in IL-10-producing regulatory B cells. J Clin Invest. (2019) 130:3702–16. doi: 10.1172/JCI93820

56. Rubio LA. Possibilities of early life programming in broiler chickens via intestinal microbiota modulation. Poult Sci. (2019) 98:695–706. doi: 10.3382/ps/pey416

57. Klasing KC. Nutritional aspects of leukocytic cytokines. J Nutr. (1988) 118:1436–46. doi: 10.1093/jn/118.12.1436

58. Koenen ME, Boonstyra-Blom AG, Jeurissen SHM. Immunological differences between layer- and broiler-type chickens. Vet Immunol Immunopathol. (2002) 89:47–56. doi: 10.1016/S0165- 2427(02)00169-1

59. Parmentier HK, Reliingh GV, Freke P, Koopmanschap RE, Lammers A. Immunological and physiological differences between layer and broiler chickens after concurrent intratracheal administration of lipopolysaccharide and human serum albumin. Int J Poultry Sci. (2010) 9:574– 83. doi: 10.3923/ijps.2010.574.583

60. Wilson NL, Forder REA, Tearle RG, Nattrass GS, Hughes RJ, Hynd PI. Evalu-ation of fatty acid metabolism and innate immunity interactions between commercial broiler, F1 layer x broiler cross and commercial layer strains selected for different growth potentials. J Anim Sci Bio- tech. (2017) 8:70. doi: 10.1186/s40104-017-0202-4

61. Davis CP, Savage DC. Habitat, succession, attachment, and morphology of segmented, filamentous microbes indigenous to the murine gastrointestinal tract. Infect Immun. (1974) 10:948–56. doi: 10.1128/IAI.10.4.948-956.1974

62. Albooshoke SN, Bakhtiarizadeh MR. Divergent gene expression through PI3K/akt signalling pathway cause different models of hypertrophy growth in chicken. Ital J Anim Sci. (2019) 18:1161–73. doi: 10.1080/1828051X.2019.1634498

63. Perochon J, Carroll LR, Cordero JB. Wnt signalling in intestinal stem cells: lessons from mice and flies. Genes. (2018) 9:138. doi: 10.3390/genes9030138

144

64. Sun X, Yang Q, Rogers CJ, Du M, Zhu MJ. AMPK improves gut epithelial differentiation and barrier function via regulating Cdx2 expression. Cell Death Differ. (2017) 24:819–31. doi: 10.1038/cdd.2017.14

65. Feng Y, McDunn JE, Teitelbaum DH. Decreased phospho-Akt signaling in a mouse model of total parenteral nutrition: a potential mechanism for the development of intestinal mucosal atrophy. Am J Physiol Gastrointest Liver Physiol. (2010) 298:G833–841. doi: 10.1152/ajpgi.00030.2010

66. Liévin-Le Moal V, Servin AL. The front line of enteric host defense against unwelcome intrusion of harmful microorganisms: mucins, antimicrobial peptides, and microbiota. Clin Microbiol Rev. (2006) 19:315–37. doi: 10.1128/CMR.19.2.315-337.2006

67. Nakajima A, Vogelzang A, Maruya M, Miyajima M, Murata M, Son A, et al. IgA regulates the composition and metabolic function of gut microbiota by promoting symbiosis between bacteria. J Exp Med. (2018) 215:2019–34. doi: 10.1084/jem.20180427

68. Teague KD, Graham LE, Dunn JR, Cheng HH, Anthony N, Latorre JD, et al. In ovo evaluation of FloraMax®-B11 on Marek's disease HVT vaccine protective efficacy, hatchability, microbiota composition, morphometric analysis, and Salmonella Enteritidis infection in broiler chickens. Poult Sci. (2017) 96:2074–82. doi: 10.3382/ps/pew494

69. Batz MB, Hoffmann S, Morris JG. Ranking the disease burden of 14 pathogens in food sources in the United States using attribution data from outbreak investigations and expert elicitation. J Food Prot. (2012) 75:1278–91. doi: 10.4315/0362-028X.JFP-11-418

70. Kogut MH, Tellez GI, McGruder ED, Hargis BM, Williams JD, Corrier DE, et al. Heterophils are decisive components in the early responses of chickens to Salmonella enteritidis infections. Microb Pathog. (1994) 16:141–51. doi: 10.1006/mpat.1994.1015

71. Varmuzova K, Kubasova T, Davidova-Gerzova L, Sisak F, Havlickova H, Sebkova A, et al. Composition of gut microbiota influences resistance of newly hatched chickens to Salmonella enteritidis infection. Front Microbiol. (2016) 7:957. doi: 10.3389/fmicb.2016.00957

72. Crhanova M, Hradecka H, Faldynova M, Matulova M, Havlickova H, Sisak F, et al. Immune response of chicken gut to natural colonization by gut microflora and to Salmonella enterica serovar Enteritidis infection. Infect Immun. (2011) 79:2755–63. doi: 10.1128/IAI.01375-10

73. Park J, Kim M, Kang SG, Jannasch AH, Cooper B, Patterson J, et al. Short-chain fatty acids induce both effector and regulatory T cells by suppression of histone deacetylases and regulation of the mTOR-S6K pathway. Mucosal Immunol. (2015) 8:80–93. doi: 10.1038/mi.2014.44

74. Mao K, Baptista AP, Tamoutounour S, Zhuang L, Bouladoux N, Martins AJ, et al. Innate and adaptive lymphocytes sequentially shape the gut microbiota and lipid metabolism. Nature. (2018) 554:255–9. doi: 10.1038/nature25437

145

Figures and Tables

Figure 5-1. TEM images of bacterial spores in SPORE and CON inocula. (A, B), CON inoculum. (C–F), SPORE inoculum. Atrophied or dead microbes are indicated by faint bodies with contorted outer membranes (white arrows). Spores or viable bacteria are seen as electron-dense (i.e., dark) with discernable membranes (black arrows).

146

Figure 5-2. 16S rRNA reads identified in SPORE and CON inocula. Bacterial taxa from spore-enriched (SPORE) and control (CON) inocula were identified via 16S rRNA gene sequencing and QIIME2 pipeline analysis.

147

Figure 5-3. SEM detection of SFB in the distal ileum. SEM images were taken for CON (A– C) and SPORE (D–F) birds at multiple days post-inoculation (dpi) to track SFB colonization over time. (A,D), 3 dpi. (B,E), 7 dpi. (C,F), 14 dpi. In addition, a table summarizing the total findings is provided.

148

Figure 5-4. SFB detection in ceca content via PCR. SFB-specific primers were used to detect SFB in ceca content at 3, 7, and 14 dpi time points.

149

Figure 5-5. Measures of weight gain and gut morphology. (A) Chick weight was measured at 1- and 11-days post-hatch to assess average weight gain per animal (dot). (B) Intestinal segment lengths were measured via ruler at 14 days post-inoculation (dpi). (C) Gut permeability was measured at 3 dpi via orally-delivered FITC-dextran leakage in serum. *P < 0.05, **, P < 0.01.

150

Figure 5-6. Salmonella resistance assays in vitro. Salmonella enterica resistance was measured using in vitro bactericidal assays against multiple Salmonella isolates (summarized in Table 1). Salmonella killing was performed in small intestinal scrapings taken at 3 (A), 7 (B), and 14 dpi (C) in experimental duplicate. *, P < 0.05; **, P < 0.01; ***, P < 0.001; and ****, P < 0.0001. 151

Figure 5-7. Total IgA production. Endpoint titers for total IgA were measured in small intestinal scrapings from birds (dots) at 3-, 7-, and 14-days post-inoculation (dpi) via ELISA. Assays were performed in experimental duplicate. ****, P < 0.0001.

Figure 5-8. Heatmap and clustering of kinome profiles. The raw kinome signal from the peptide array was input into the custom software package PIIKA2. Red indicates relative increased phosphorylation, whereas green indicates relative decreased phosphorylation of each peptide on the array. 152

Figure 5-9. Net feed intake from CON and SPORE birds for days 1-11.

Figure 5-10. Gut permeability measured between CON and SPORE birds at 7 and 14 dpi. 153

Figure 5-11. Inflammatory scores as measured by H&E staining. 4 indicates most severe pathology, whereas 0 indicates no pathological signs.

154

Table 5-1. Summary of Salmonella isolates tested for in vitro resistance assays. Salmonella enterica Isolation source/bank number; relevant antibiotic-resistance profiles and/or char- Reference/Source serovar acteristics UK-1 (Typhimurium) Highly-virulent “universal killer,” isolated from horse 16

Kentucky Poultry-isolate; TCR, STR, CPR, ammonium-resistance 17

Albert Bank number 0401; STR, TCR, CPR, CAR, SUR, AGR CDC Biorepository

Heidelberg Bank number 0404; CPR CDC Biorepository

Typhimurium Bank number 0408; STR, TCR, CPR, CAR, SUR CDC Biorepository

TC, tetracycline. ST, streptomycin. CP, cephalosporin. CA, chloramphenicol. SU, sulfanomide. AG, aminoglycoside. Subscript “R” indicates resistance.

Table 5-2. KEGG immune pathways enriched from unique peptides in SPORE (compared to CON) birds 3- and 7-days post-inoculation. KEGG Pathway 3 dpi 7 dpi # Proteins p-value (FDR) # Proteins p-value (FDR) PI3K-Akt signaling 56 7.73 10-33 45 1.75 x 10-27 Chemokine signaling 34 3.71 x 10-22 29 4.11 x 10-20 B cell receptor signaling 25 6.10 x 10-22 21 2.39 x 10-19 T cell receptor signaling 26 2.70 x 10-20 25 1.89 x 10-21 Autophagy 28 3.03 x 10 20 23 2.01 x 10-17 Fc epsilon RI signaling 22 4.95 x 10-19 20 1.21 x 10-18 Toll-like receptor signaling 25 5.62 x 10-19 18 1.15 x 10-13 Fc-gamma R-mediated phag- 22 6.25 x 10-17 18 1.56 x 10-14 ocytosis Natural killer cell mediated 24 2.46 X 10-16 19 2.05 X 10-13 cytotoxicity Apoptosis 23 1.09 x 10-14 20 8.23 x 10-13 TNF signaling 21 1.74 x 10-14 22 1.70 x 10-17 JAK-STAT signaling 24 3.12 x 10-14 21 1.51x 10-13 IL-17 signaling 18 1.28 x 10-12 12 3.62 x 10-8 Leukocyte transendothelial 19 2.61 x 10-12 15 4.26 x 10-10 migration Inflammation mediator regu- 16 1.13 x 10-10 14 3.92 x 10-10 lation of TRP channels -10 TH17 cell differentiation NS 15 1.36 x 10 NF-κB signaling 15 1.13 x 10-9 15 4.30 X 10-10 Wnt signaling 17 4.96 x 10-9 13 4.14 x 10-7 NOD-like receptor signaling 17 3.69 x 10-8 12 1.04 x 10-5

155

Table 5-3. KEGG metabolic pathways enriched from unique peptides in SPORE (compared to CON) birds 3- and 7-days post-inoculation. KEGG Pathway 3 dpi 7 dpi # Pro- p-value # Pro- p-value (FDR) teins (FDR) teins Insulin signaling 39 5.43 x 10-31 29 3.72 x 10-23 HIF-1 signaling 31 7.33 x 10-26 27 6.42 x 10-24 AMPK signaling 30 1.42 x 10-22 21 1.22 x 10-15 Insulin resistance 28 1.25 x 10-21 23 1.21 x 10-18 mTOR signaling 31 1.78 x 10-21 25 4.25 x 10-18 Glucagon signaling 22 4.78 x 10-16 16 1.04 x 10-11 cAMP signaling 23 9.38 x 10-12 20 3.30 x 10-11 Glycolysis/gluconeogenesis 14 2.66 x 10-10 10 2.00 x 10-7 cGMP-PKG signaling 18 3.81 x 10-9 15 3.52 x 10-8 Calcium signaling 17 1.01 x 10-7 10 0.00041 PPAR signaling 11 3.41 x 10-7 9 2.88 x 10-6 Propanoate metabolism 8 6.58 x 10-7 NS Starch and sucrose metabo- 8 7.88 x 10-7 4 0.0023 lism Fatty acid degradation 8 4.91 x 10-6 6 9.98 x 10-5 Galactose metabolism 7 6.00 x 10-6 4 0.0019 Fructose and mannose me- 7 8.54 x 10-6 4 0.0023 tabolism Carbohydrate absorption 7 3.30 x 10-5 7 7.81 x 10-6 and digestion Biosynthesis of amino acids 9 1.79 x 10-5 7 0.00016

156

CHAPTER 6. RESERPINE IMPROVES ENTEROBACTERIACEAE RESISTANCE IN CHICKEN INTESTINE VIA NEURO-IMMUNOMETABOLIC SIGNALING AND MEK1/2 ACTIVATION

Modified from a manuscript under review in Nature Foods

Graham A.J. Redweika,b, Michael H. Kogutc, Ryan J. Arsenaultd, Mark Lyteb,e, and Melha Mellataa,b aDepartment of Food Science and Human Nutrition, Iowa State University, Ames, IA, USA; bIn- terdepartmental Microbiology Graduate Program, Iowa State University, Ames, IA, USA; cSouthern Plains Agricultural Research Center, USDA-ARS, College Station, TX, USA; dDe- partment of Animal and Food Sciences, University of Delaware, Newark, DE, USA eDepartment of Veterinary Microbiology and Preventative Medicine, Iowa State University, Ames, IA, USA

Abstract

Salmonella enterica persist in the chicken gut by suppressing inflammatory responses via expansion of intestinal regulatory T cells (Tregs). In humans, T cell activation is controlled by neurochemical signaling in Tregs; however, whether similar neuroimmunological signaling occurs in chickens is currently unknown. In this study, we explore the role of the neuroimmunological axis in intestinal Salmonella resistance using the drug reserpine, which disrupts intracellular storage of catecholamines like norepinephrine. Following reserpine treatment, norepinephrine release was increased in both ceca explant media and Tregs. Similarly, Salmonella killing was greater in reserpine-treated explants, and oral reserpine treatment reduced the level of intestinal

Salmonella Typhimurium and other Enterobacteriaceae in vivo. These antimicrobial responses were linked to an increase in antimicrobial peptide and IL-2 gene expression as well as a decrease in CTLA-4 gene expression. Globally, reserpine treatment led to phosphorylative changes in epidermal growth factor receptor (EGFR), mammalian target for rapamycin (mTOR), and the 157 mitogen-associated protein kinase kinase MEK2. Exogenous norepinephrine treatment alone increased Salmonella resistance, and reserpine-induced antimicrobial responses were blocked using beta-adrenergic receptor inhibitors, suggesting norepinephrine signaling is crucial in this mechanism. Furthermore, EGF treatment reversed reserpine-induced antimicrobial responses, whereas mTOR inhibition increased antimicrobial activities, confirming the roles of metabolic signaling in these responses. Finally, MEK1/2 inhibition suppressed reserpine, norepinephrine, and mTOR-induced antimicrobial responses. Overall, this study demonstrates a central role for

MEK1/2 activity in reserpine induced neuro-immunometabolic signaling and subsequent antimicrobial responses in the chicken intestine, providing a novel means of reducing of bacterial colonization in chickens, thus improving food safety.

Significance. Salmonella enterica cause severe human disease, and the chicken intestine is a major reservoir for foodborne Salmonella. Due to Salmonella intestinal immunotolerance and increasing antibiotic resistance, novel means of eradicating Salmonella from poultry are required.

Our study demonstrates that reserpine can alter intestinal immunological responses via neurochemical and metabolic pathways to improve Salmonella resistance. These findings provide compelling evidence that targeting the neuroimmunological axis via reserpine treatment can be an effective strategy to minimize Salmonella persistence in poultry to improve food safety.

Introduction

Poultry products are the primary vehicle for broad-host, nontyphoidal Salmonella enterica contamination and foodborne disease in the United States (1, 2), causing 1.35 million infections and costing approximately $400 million annually (3). Although extensive efforts have been made to minimize Salmonella incidence in poultry via antimicrobials, the spread of resistance genes has caused an emergence of Salmonella isolates resistant to essential antibiotics (3, 4). 158

Furthermore, live Salmonella vaccines and probiotics are commonly implemented as prophylactics in commercial poultry to reduce Salmonella load, however their individual efficacies against

Salmonella resistance are inconsistent (5-7). Altogether, current methods are insufficient in the reduction of Salmonella in chickens, suggesting that a deeper understanding of biological factors affecting Salmonella colonization is needed to develop more successful treatments.

In chickens, broad host Salmonella serovars induce an immunotolerant state in the chicken intestine via increased regulatory T cells (Tregs), which suppress the inflammatory immune responses necessary to clear Salmonella (8, 9). Thus, interfering with Treg activities in the gut may improve antibacterial responses against Salmonella. A largely-understudied field in chicken biology is neuroimmunology, or the interactions between the nervous and immune systems (10). The intestine is highly-innervated with neurons and immune cell populations, which can then interact via neurochemical signaling (11). In mammals, Tregs synthesize their own stores of catecholamine neurochemicals like norepinephrine, and disrupting these intracellular stores via reserpine inhibits Treg function (12). However, whether chicken Tregs have similar neurochemical stores and if they too are affected by reserpine have not been investigated.

In this report, using a chicken intestinal explant model, we found that reserpine causes release of intracellular norepinephrine stores from ceca and intestinal Tregs, driving increased antimicrobial responses against Salmonella. This ex vivo antimicrobial responses were recapitulated in vivo, as birds orally treated with reserpine exhibited reduced gut Enterobacteriaceae and

Salmonella post-challenge compared to control birds. Furthermore, we found that reserpine treatment induced T cell activation, reduced CTLA-4 gene expression, and deactivated metabolic 159 pathways like epidermal growth factor receptor (EGFR) signaling and mammalian target of rapamycin (mTOR) signaling, which were linked to antimicrobial responses. Lastly, we found that

MEK1/2 activation plays a central role in reserpine-induced antimicrobial activities.

Results

Reserpine treatment induces norepinephrine release from intestinal explants and CD4+CD25+ cells

In an intestinal explant model (13) (Figure 6-3), we demonstrated neurochemical release in ceca tissues at 1 hr post-reserpine treatment (1 µM) using U-HPLC. Culture media from reserpine-treated explants had increased levels of norepinephrine and no changes in serotonergic metabolites compared to controls (Figure 6-1A). However, this norepinephrine release did not induce inflammatory damage in the explants, as pathological scores were statistically identical between groups (Figure 6-4A). Using flow cytometry to sort lymphocyte populations (Figure 6-1B) potentially responsible for norepinephrine release in the ceca, Tregs (i.e., CD4+CD25+) had significantly greater intracellular norepinephrine stores versus naïve T helper (TH) cells (i.e.,

CD4+CD25-), and reserpine treatment reduced intracellular norepinephrine levels in Tregs alone

(Figure 6-1C). However, intracellular stores of serotonergic metabolites were unaffected by reserpine treatment (Figures 6-4B and 6-4C).

Reserpine treatment increases Salmonella resistance in ex vivo and in vivo conditions

In ceca explants, supernatant from reserpine-treated group had higher killing ability against Salmonella compared to that of control explants regardless of strains tested, e.g., Salmo- nella Typhimurium and Salmonella Kentucky (Figure 6-1D). However, reserpine itself was not bactericidal (Figure 6-4D), confirming that Salmonella killing was mediated by host factors. In 160 vivo, birds orally treated with 0, 0.5, or 5 mg reserpine/kg body weight from 1-3 days post-hatch

(dph) were more resistant to S. Typhimurium oral challenge compared to control birds.). At two days post-Salmonella challenge, fecal shedding of total Enterobacteriaceae and Salmonella was significantly reduced by reserpine treatment regardless of concentration (Figure 6-1E). Similarly, total Enterobacteriaceae and Salmonella CFUs in ceca content were reduced by reserpine treatment at four days post-challenge (Figure 6-1F). Additionally, reserpine treatment did not affect the chicken weight gain at pre- (Figure 6-4E) nor post-Salmonella challenge (Figure 6-4F).

Reserpine treatment increases antimicrobial peptide expression while decreasing CTLA-4 expression

To determine underlying mechanisms responsible for improved antimicrobial responses upon reserpine treatment, we measured gene expression through transcriptional changes via RT- qPCR. Expression of the anti-inflammatory cytokine IL-10 (14), was unchanged (Figure 6-2A); however, the expression of CTLA-4, a surface-bound protein associated with Tregs that down- regulates immune responses (15), was downregulated in reserpine-treated explants versus controls (Figure 6-2A). In line with this downregulated immunosuppressive factor, reserpine increased antimicrobial peptide (AMP) gene expression versus controls (Figure 6-2A). Further- more, expression of IL-2, a cytokine released by activated T cells (16, 17), was also increased nearly 100-fold by reserpine versus control (Figure 6-2A).

Reserpine-treated explants undergo massive immunometabolic shifts

To determine what global immunometabolic pathways were affected by reserpine, we used a chicken-specific kinome peptide array, which measures changes in phosphorylation activ- 161 ities within several signaling pathways (18). Overall, reserpine treatment altered several immunological and metabolic pathways (Table 6-1 In total, 414 proteins from the top 25 KEGG pathways were differentially phosphorylated upon reserpine treatment (Table 6-1). Within these pathways, several were involved in the epidermal growth factor receptor (EGFR) signaling pathway and T cell receptor (TCR) signaling pathway, and these pathways were further analyzed. EGFR was dephosphorylated at the Tyr869 residue (Table 6-2). Furthermore, in the EGFR signaling pathway, mTOR was phosphorylated at Ser2448 and Thr2446 but was dephosphorylated at

Ser2481 (Table 6-2). Uniquely, mitogen-activated protein (MAP) kinase 2 (MEK2), a component of the MEK1/2 signaling pathway (19), was phosphorylated at the Ser306 residue (Table 6-

2), important for MEK2 activation (20). Similarly, MEK2 is also involved in the TCR signaling pathway, in which CD28, a T cell co-receptor crucial for T cell activation (21), was phosphorylated (Table 6-2).

Reserpine-induced antimicrobial responses are dependent on norepinephrine and metabolic signaling

Given that reserpine 1) increased intracellular norepinephrine release and 2) induced changes in EGFR and mTOR phosphorylation, we investigated the roles of these responses in antimicrobial resistance. Explants treated with norepinephrine alone similarly induced antibacterial responses in a dose-dependent manner (Figure 6-2B), which was blocked by inhibiting beta- adrenergic receptors 2 and 3 (Figure 6-2C). Treatment of explants with recombinant EGF alone prevented reserpine-induced antimicrobial responses (Figure 6-2D). However, treatment with

EGFR inhibitor AG1478 alone did not trigger antimicrobial responses (Figure 6-2D). Addition- 162 ally, treatment of explants with rapamycin, an inhibitor of the mTOR pathway, increased bactericidal responses (Figure 6-2E). Overall, these findings demonstrate that reserpine induces antimicrobial responses through multiple signaling pathways.

MEK1/2 signaling plays a central role in reserpine-induced antimicrobial responses

In our kinome analyses, we found that these immunometabolic signaling changes were associated with MEK2 phosphorylation, suggesting MEK1/2 signaling plays a vital role in these responses. Using the MEK1/2 signaling inhibitor U0126, MEK1/2 signaling inhibition reversed the antimicrobial response induced by reserpine (Figure 6-2D). Similarly, MEK1/2 inhibition in norepinephrine-treated explants prevented antimicrobial responses (Figure 6-2E). Finally, antimicrobial responses in rapamycin-treated explants were partially reversed upon MEK1/2 inhibition (Figure 6-2E). Overall, these data demonstrate a central role for MEK1/2 signaling in antimicrobial response induced by reserpine and other neuro-immunometabolic signaling pathways.

Discussion

Chicken products like meat and eggs are primary vehicles for salmonellosis (1, 2). Re- ducing Salmonella colonization in the chicken intestine is paramount to mitigating salmonellosis in humans. In this study, we demonstrate that reserpine treatment releases intracellular stores of norepinephrine and induces large changes in immunometabolism in chicken ceca, resulting in increased antibacterial responses against Salmonella. The ex vivo explant model used in this study allows for preserving the totality of intestinal cell populations present in vivo while maintaining spatial organization, which provides a more accurate representation of in vivo conditions

(13). In support of the utility of this model, we found that reserpine treatment induces antimicrobial responses against Salmonella ex vivo and in vivo. In our study, reserpine treatment increased 163 expression of several AMPs, including beta-defensins 12 and 14 as well as fowlicidin-1. Beta- defensins are crucial to regulating the gut microbiota and homeostasis (22). Thus, strategies that increase host beta-defensin production are viable replacements for antibiotic treatment (23). Alt- hough these molecules are directly bactericidal, they have additional functions as well. For example, fowlicidin-1 can neutralize bacterial lipopolysaccharide (LPS) (24), a gram negative bacterial outer-membrane component that potently induces inflammation (25). Furthermore, beta- defensins reduce intestinal apoptotic signals in LPS-treated animals (26). Thus, improving production of these AMPs may both increase resistance against bacterial pathogens as well as mitigate host damage induced by these antibacterial responses. In support of this, we found no differences in pathological scores between groups despite a clear elevation in immunological responses in reserpine-treated explants. However, the transcriptional factors responsible for reserpine-induced antimicrobial peptide production are unclear at this time. Activation of the transcription factor c-FOS increases antimicrobial responses in macrophages (27) while suppressing excessive inflammatory responses (28-30). Given these findings were reflected in our study, reserpine-induced c-FOS activation may be driving these antimicrobial responses, although this remains to be determined.

This reserpine-driven increase in AMP production was associated with increased IL-2 expression and reduced CTLA-4 expression. Upon activation of naïve T cells, IL-2 production is increased, which induces further T cell proliferation, promotes CD4+ differentiation, and facili- tates effector and memory CD8+ T cell formation (16). This activation process is dependent on the interaction between costimulatory ligand CD28, expressed on naïve T cells, and CD80/86, expressed on antigen presenting cells (APCs) (31). However, Tregs can interfere with this inter- 164 action via CTLA-4, which outcompetes CD28 for CD80/86 binding, inhibiting IL-2 accumulation and thus preventing T cell activation (21, 32). One of the mechanisms in which Salmonella persists in the chicken gut is by increasing intestinal Tregs, which prevents the inflammatory responses necessary to clear Salmonella (9). Thus, we hypothesized that reserpine treatment could inactivate chicken Tregs as shown in human Tregs (12), which would permit anti-Salmonella responses in the gut. As expected, reserpine decreased CTLA-4 expression, which is constitutively expressed on Tregs (33). We found that CD28 was phosphorylated in reserpine-treated explants, suggesting that CD28 activation and IL-2 production were occurring due to reduced CTLA-4 levels. Furthermore, NFATC1 (but not NFATC2) was phosphorylated upon reserpine treatment.

Activation of these transcription factors have been linked to IL-2 production in memory CD4+ T cells (34), suggesting that reserpine is increasing IL-2 gene expression through NFATC1 activation.

In humans, reserpine inhibits intracellular vesicle storage of catecholamines like norepinephrine, which induce autocrine/paracrine signaling loops that suppress Treg function and stimulate immune activation (12). In this study on chickens, reserpine treatment increased norepinephrine release from both explants and intestinal Tregs. Thus, Tregs at least partially contribute to the total pool of norepinephrine released by intestinal cells. However, in our hands and due to limited reagents and methods for primary chicken cell cultures, we could not culture chicken intestinal Tregs for longer than six hours, preventing any direct examination of reserpine on Treg immunosuppressive function. However, we did find that treatment with norepinephrine alone at the physiological concentration released after one hour of reserpine treatment could stimulate antibacterial responses, which was dependent on beta-adrenergic receptors. Norepinephrine is a 165 well-known mediator of neuroimmunological responses, inducing cytokine production, cell proliferation, and antibody secretion by lymphocytes (35, 36) and has been demonstrated to improve antibacterial responses via cross-talk between sympathetic ganglia and resident tissue macrophages (37). Overall, intracellular release of norepinephrine drives antimicrobial responses via autocrine/paracrine signaling of intestinal cell populations. Future work should determine which specific cellular populations (i.e., enterocytes, enteric neurons, regulatory T cells, APCs) are involved in this mechanism.

Given the clear immunological stimulation induced by reserpine treatment, we hypothesized that several metabolic pathways might also be affected due to the interplay between host metabolism and the immune system (10). To this end, we used the chicken kinome peptide array, which measures immunometabolic signaling at the post-translational level (18) and thus enables a more accurate evaluation of which processes are affected by reserpine. EGFR signaling is crucial for goblet cell-associated antigen passage (GAP) formation in the mammalian intestine (38), and inhibiting EGFR increases beta-defensin production in intestinal cells in vitro (39). In this study, we found that EGFR was dephosphorylated in reserpine-treated explants, and using recombinant EGF reversed reserpine-induced antimicrobial responses in vitro, demonstrating the importance EGFR signaling in this system. Additionally, the mTOR pathway is conserved among eukaryotic organisms and has received vast attention due to its diverse involvement in nutrient sensing, immunity, and aging in animals (40). Rapamycin, originally derived from the soil bacterium Streptomyces hygroscopicus, is commonly used as an mTOR inhibitor (40). In this study, reserpine induced differential mTOR phosphorylation at multiple sites upon reserpine treatment. Phosphorylation of S2448 and T2446 is carried out by the kinase S6K (41), and pS2448 drives mTORC1 activation (42). Furthermore, mTORC1 may have been activated upon 166 reserpine treatment, as these two mTOR sites, S6K, and raptor (i.e., RPTOR) were all phosphorylated. However, mTORC1 activation does not play a role in these antimicrobial responses, as deactivating mTOR via rapamycin treatment induced similar antimicrobial responses as reserpine treatment. Although these mTOR sites were phosphorylated, S2481 was uniquely dephosphorylated upon reserpine treatment. The sole site for mTOR autophosphorylation (43),

S2481 has been the only site determined to regulate intrinsic mTOR activities (44, 45). Thus,

S2481 dephosphorylation deactivates mTOR function, and our study finds that mTOR inhibition increases antimicrobial responses in this ceca explant model. This finding is supported by previous work demonstrating rapamycin treatment increases anti-Campylobacter responses in the murine intestine and directly stimulates antimicrobial responses in splenocytes (46). Thus, in addition to inducing norepinephrine signaling, reserpine also deactivates EGFR and mTOR, and all three of these pathways contribute to antimicrobial responses in chickens.

Although we identified several pathways that differed in phosphorylation patterns,

MEK1/2 signaling is well-established as an essential component of beta-defensin production at mucosal barriers (39, 47, 48). However, MEK1/2 signaling has never been previously described to be involved in reserpine activity. Here, upon reserpine treatment, MEK2 was phosphorylated at S306. Using the inhibitor U0126, we found that inhibiting MEK1/2 signaling reversed reserpine induced antimicrobial responses as well as those induced by norepinephrine and rapamycin treatment alone, suggesting that pS306 is a central component of this signaling pathway induced by reserpine and is critical to achieving an antimicrobial response.

In summary, we found that reserpine increases AMP production and immune activation in the chicken intestine by inducing norepinephrine release and beta-adrenergic receptor activation. These changes are correlated with reduced CTLA-4 expression as well as EGFR and mTOR 167 deactivation, and these antimicrobial responses were dependent on MEK1/2 activation. Thus, we propose that targeting the neuroimmunological axis via oral reserpine treatment could be a viable strategy for increasing Salmonella resistance in poultry. Furthermore, since oral reserpine treatment also increased resistance against total Enterobacteriaceae populations, this treatment may also increase resistance against other bacterial pathogens.

Materials and Methods

Ethics statement

Animal experiments were approved by Iowa State University Institutional Animal Care and Use Committee (IACUC) (protocol #18-386). Animal enrichments were added to open floor pens to minimize stress during experimental procedures. Euthanasia techniques (CO2 asphyxiation) followed the American Veterinary Medical Association Guidelines (2013).

Ceca explant model and treatment

Methods for chicken ceca explant cultures were adapted from an ex vivo colon explant model for mice (13) and are summarized in Supplemental Figure 1. Briefly, 0.1 g tissue pieces from the chicken ceca were incubated in antibiotic-treated Dulbecco’s modified eagle medium

(DMEM) for 30-minutes at 39.5°C (5% CO2). Explant tissues were then washed with antibiotic- free DMEM to remove residual antibiotics, individually transferred to 24-well plates and incubated in DMEM with 0 or 1 µM reserpine for six hours at 39.5°C (5% CO2). Alternatively, to confirm reserpine-mediated signaling pathways, tissues were incubated with norepinephrine

(1.32 mg/ml or 1.32 µg/ml), beta-adrenergic receptor inhibitors ICI-118551 (훽2; 1 µM; Med-

ChemExpress, LLC) or L-748337 (훽3; 1 µM; R&D Systems), U0126 (MEK1/2 inhibitor; 20 µM; 168

Invivogen), human recombinant EGF (200 ng/ml; Biotang Inc), AG-1478 (EGFR tyrosine kinase inhibitor; 1 µM; BiovVision), or rapamycin (mTOR pathway inhibitor; 10 ng/ml or 1000 ng/ml).

Ultra-high pressure liquid chromatography

To assess neurochemical release from explants, media from explant cultures were centrifuged at 12,000 x g for 5 minutes at 4°C, and supernatants were pre-treated with 2 M perchloric acid (100:1 sample-acid ratio), flash-frozen, and stored at -80°C. Upon thawing, ultra-high-performance liquid chromatography with electrochemical detection (UHPLC-ED) was performed on media supernatants as previously described (38). To assess neurochemical release from lymphocyte populations, regulatory T cells (CD4+CD25+) or naïve T cells (CD4+CD25-) were sorted via flow cytometry (see methods section) and treated with 0 or 1 µM reserpine for 30 minutes at

39.5°C. Cells were then pelleted via centrifugation at 300 x g for 10 minutes at 4°C, and 10 mg pellets were resuspended in 0.2 M perchloric acid, flash-frozen and stored at -80°C. Upon thawing, UHPLC-ED was performed on cellular as described earlier.

Intestinal lymphocyte extraction and flow cytometry

T cells were extracted from the chicken lamina propria as previously described (39, 40).

To sort for specific T cell populations, 106-7 cells were resuspended in Zombie violet dye (1:100 solution) and incubated for 20 minutes at room temperature in the dark. Cells were then centrifuged at 300 x g for 5 minutes at room temperature, and pellets were resuspended via sorting buffer (PBS with 1% FBS) and incubated for 10 minutes at 4°C for a blocking step. Thereafter, cells were centrifuged for 5 minutes at 300 x g, and then resuspended with 10 µg/ml anti-CD4

(Southern Biotech) and 10 µg/ml anti-µg/ml anti-CD25 (BioRad) manually conjugated with

Alexa-555 or Alexa-488 fluorophores, respectively. Following a 30-minute incubation in the 169 dark at 4°C, cells were then washed with sorting buffer, and viable CD4+CD25+ and CD4+CD25- populations were sorted via FACSAria III (BD Bioscences) at Iowa State University’s core facility.

Bactericidal assays against Salmonella

Following explant incubation, media from individual explants were centrifuged at 12000 x g for 5 minutes at 4°C, and supernatant was stored at -80°C until ready for use. S. enterica strains (Table 6-3) were grown overnight on LB agar (0.1% glucose), and individual colonies

2 were added to PBS until OD600 0.1. This inoculum was subsequently diluted in PBS until 10

CFU/100 µl was reached. Explant supernatants were added to Salmonella inoculum at 1:1 ratio and incubated for six hours at 39.5°C. Solutions were then serially diluted and plated on Mac-

Conkey for bacterial enumeration. All bactericidal assays were run in triplicate.

In vivo reserpine treatment and Salmonella challenge

One-day-old white leghorn chicks (Valo BioMedia, IA) were orally gavaged daily with 0,

0.5, or 5 mg reserpine per kg body weight (100 µl) for three days. At four day old, chicks were orally inoculated with 100 µl (109 CFU) Salmonella Typhimurium strain UK-1 (Table 6-3). Prior to reserpine treatment and Salmonella challenge, birds were fasted from food and water for at least 4 hours, and food and water were returned to pens 30 min post-treatment and challenge, respectively. Two days post-challenge, feces were serially diluted and plated onto MacConkey agar for Enterobacteriaceae and Salmonella enumeration. Four days post-challenge, ceca contents were collected and plated onto MacConkey agar. Chicken weights were collected daily throughout the study.

170

Intestinal pathology scoring

Explants were placed into 4% paraformaldehyde (PFA) and stored at RT. Subsequently, 5

μm paraffin-embedded cross sections were stained with hematoxylin and eosin (H&E) to assess gut inflammation. Parameters measuring inflammation (i.e., focal, multifocal, diffuse), infiltrate

(i.e., presence of heterophils, lymphocytes, macrophages as well as hemorrhages), necrosis (i.e., focal, multifocal, diffuse), and location (i.e., lamina propria, villous lamina propria, crypt lamina propria) were used. All analyses were performed by a certified pathologist at Iowa State Univer- sity.

RT-qPCR

Total RNA was extracted from explant tissues using the PureLink RNA Mini Kit (Life

Technologies), and high quality RNAs (A260/A280 ratios ~ 2.0) were assessed via Nanodrop

2000 and quantified via Qubit 2.0 Fluorometer. Reverse transcription assays were performed via

High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) to attain cDNA. Thereafter,

SYBR Green (Thermo Scientific) three-step cycling qPCR reactions were performed on

StepOnePlus for individual genes (Table 6-4) for 45 cycles. Differences in gene expression were assessed via 2-훥훥Ct method using the housekeeping gene encoding glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a control (41).

Chicken-Specific Immunometabolic Kinome Peptide Array

Following incubation, ceca explants were flash-frozen, stored at -80°C, and transported overnight on dry ice to the University of Delaware. Peptide array protocol and analyses were car- 171 ried out as previously described (18). The resulting data output was then used in downstream applications such as STRING (43) and KEGG (44) databases used to pinpoint changes in the protein–protein interactions and signal transduction pathways.

Statistical analyses

Statistical comparisons for U-HPLC and Salmonella resistance data were performed via

Student’s t-test or one-way ANOVA on GraphPad Prism software. For the kinome array, signal intensities from scanned array images were arranged into the PIIKA2 input format in Excel, and resultant data were subsequently analyzed via PIIKA2 peptide array analysis software

(http://saphire.usask.ca/saphire/piika/index.html). After normalizing these data, we performed comparisons between reserpine-treated and un-treated explants, calculating fold change (= treatment/control) and a significance P-value, which was calculated by conducting a one-sided paired t-test between treatment and control values for a given peptide. The resultant fold change and significance values were used to generate optional pathway analysis via standard R statistical functions or online analysis platforms.

Data Availability Statement

The datasets presented in this article are not readily available; data were generated and are maintained by MK. Requests to access the datasets should be directed to [email protected].

Acknowledgements

This work was supported by the USDA-National Institute of Food and Agriculture

(NIFA) project #021069-00001 (GAJR), Iowa State University Start-up funding and the United 172

States Department of Agriculture (USDA) Hatch project IOW03902 (MM), and USDA-Agricul- tural Research Service Project #3091-32000-034-00 (MK). We thank Karrie Daniels (ML techni- cian), Jared Jochum and Logan Ott (MM graduate students), and Jack Peterson and Sasha Celada

(MM undergraduates) for technical assistance in this study.

References

1. Batz MB, Hoffmann S, Morris JG. Ranking the disease burden of 14 pathogens in food sources in the United States using attribution data from outbreak investigations and expert elicitation. J Food Prot. (2012) 75(7):1278-91. doi: 10.4315/0362-028X.JFP-11-418.

2. Antunes P, Mourao J, Campos J, Peixe L. Salmonellosis: the role of poultry meat. Clin Microbiol Infect. (2016) 22(2):110-21. doi: 10.1016/j.cmi.2015.12.004.

3. Center for Disease Control and Prevention (2019) Antibiotic Resistance Threats Report.

4. Fricke W, McDermott P, Mammel M, Zhao S, Johnson T, Rasko D, Fedorka-Cray P, Pedroso A, Whichard J, LeClerc J, et al. Antimicrobial Resistance-Conferring Plasmids with Similarity to Virulence Plasmids from Avian Pathogenic Escherichia coli Strains in Salmonella enterica Serovar Kentucky Isolates from Poultry. Appl Environ Microbiol. (2009) 75(18):5963-71. doi: 10.1128/AEM.00786-09.

5. Redweik GAJ, Stromberg ZR, Van Goor A, Mellata M. Protection against avian pathogenic Escherichia coli and Salmonella Kentucky exhibited in chickens given both probiotics and live Salmonella vaccine. Poult Sci. (2020) 99(2):752-62. doi: 10.1016/j.psj.2019.10.038.

6. McWhorter AR, Chousalkar KK. A Long-Term Efficacy Trial of a Live, Attenuated Salmonella Typhimurium vaccine in Layer Hens. Front Microbiol. (2018) 9:1380. doi: 10.3389/fmicb.2018.01380.

7. Redweik GAJ, Jochum J, Mellata M. Live Bacterial Prophylactics in Modern Poultry. Front Vet Sci. (2020) 7:592312. doi: 10.3389/fvets.2020.592312.

8. Kogut MH, Arsenault RJ. Immunometabolic Phenotype Alterations Associated with the Induction of Disease Tolerance and Persistent Asymptomatic Infection of Salmonella in the Chicken Intestine. Front Immunol. (2017) 8:372. doi: 10.3389/fimmu.2017.00372

9. Shanmugasundaram R, Kogut M, Arsenault R, Swaggerty C, Cole K, Reddish J, Selvaraj R. Effect of Salmonella infection on cecal tonsil regulatory T cell properties in chickens. Poult Sci. (2015) 94(8):1828-35. doi: 10.3382/ps/pev161.

173

10. Nutma E, Willison H, Martino G, Amor S. Neuroimmunology - the past, present and future. Clin Exp Immunol. (2019) 197(3):278-93. doi: 10.1111/cei.13279.

11. Brinkman DJ, Ten Hove AS, Vervoordeldonk MJ, Luyer MD, de Jonge WJ. Neuroimmune Interactions in the Gut and Their Significance for Intestinal Immunity. Cells. (2019) 8(7). doi: 10.3390/cells8070670.

12. Cosentino M, Fietta AM, Ferrari M, Rasini E, Bombelli R, Carcano E, Saporiti F, Meloni F, Marino F, Lecchini S. Human CD4+CD25+ regulatory T cells selectively express tyrosine hydroxylase and contain endogenous catecholamines subserving an autocrine/paracrine inhibitory functional loop. Blood. (2007) 109(2):632-42. doi: 10.1182/blood-2006-01-028423.

13. Udden SM, Waliullah S, Harris M, Zaki H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J Vis Exp. (2017) 120. doi: 10.3791/55347.

14. Couper KN, Blount DG, Riley EM. IL-10: the master regulator of immunity to infection. J Immunol. (2008) 180(9):5771-7. doi: 10.4049/jimmunol.180.9.5771.

15. Wing K, Onishi Y, Prieto-Martin P, Yamaguchi T, Miyara M, Fehervari Z, Nomura T, Sakaguchi S. CTLA-4 control over Foxp3+ regulatory T cell function. Science. (2008) 322(5899):271-5. doi: 10.1126/science.1160062.

16. Liao W, Lin JX, Leonard WJ. Interleukin-2 at the crossroads of effector responses, tolerance, and immunotherapy. Immunity. (2013) 38(1):13-25. doi: 10.1016/j.immuni.2013.01.004.

17. Pol JG, Caudana P, Paillet J, Piaggio E, Kroemer G. Effects of interleukin-2 in immunostimulation and immunosuppression. J Exp Med. (2020) 217(1). doi: 10.1084/jem.20191247.

18. Arsenault RJ, Trost B, Kogut MH. A Comparison of the Chicken and Turkey Proteomes and Phosphoproteomes in the Development of Poultry-Specific Immuno-Metabolism Kinome Peptide Arrays. Front Vet Sci. (2014) 1:22. doi: 10.3389/fvets.2014.00022.

19. Zheng CF, Guan KL. Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J Biol Chem. (1993) 268(15):11435-9.

20. Procaccia S, Ordan M, Cohen I, Bendetz-Nezer S, Seger R. Direct binding of MEK1 and MEK2 to AKT induces Foxo1 phosphorylation, cellular migration, and metastasis. Sci Rep. (2017) 7:43078.

21. Rudd CE, Taylor A, Schneider H. CD28 and CTLA-4 coreceptor expression and signal transduction. Immunol Rev. (2009) 229(1):12-26. doi: 10.1111/j.1600- 065X.2009.00770.x. 174

22. Meade KG, O'Farrelly C. β-Defensins: Farming the Microbiome for Homeostasis and Health. Front Immunol. (2018) 9:3072. doi: 10.3389/fimmu.2018.03072.

23. Sechet E, Telford E, Bonamy C, Sansonetti PJ, Sperandio B. Natural molecules induce and synergize to boost expression of the human antimicrobial peptide β-defensin-3. Proc Natl Acad Sci USA. (2018) 115(42):E9869-E78. doi: 10.1073/pnas.1805298115.

24. Xiao Y, Cai Y, Bommineni YR, Fernando SC, Prakash O, Gilliland SE, Zhang G. Identification and functional characterization of three chicken cathelicidins with potent antimicrobial activity. J Biol Chem. (2006) 281(5):2858-67. doi: 10.1074/jbc.M507180200.

25. Kogut M, He H, Kaiser P. Lipopolysaccharide binding protein/CD14/TLR4-dependent recognition of Salmonella LPS induces the functional activation of chicken heterophils and up-regulation of pro-inflammatory cytokine and chemokine gene expression in these cells. Anim Biotechnol. (2005) 16(2):165-81. doi: 10.1080/10495390500264896.

26. Xie K, Xie H, Su G, Chen D, Yu B, Mao X, Huang Z, Yu J, Luo J, Zheng P, et al. β- Defensin 129 Attenuates Bacterial Endotoxin-Induced Inflammation and Intestinal Epithelial Cell Apoptosis. Front Immunol. (2019) 10:2333. doi: 10.3389/fimmu.2019.02333.

27. Hop H, Arayan LT, Huy TXN, Reyes AWB, et al. The Key Role of c-FOS for Immune Regulation and Bacterial Dissemination in Brucella Infected Macrophage. Front Cell Infect Microbiol. (2018) 8:287.

28. Ray N, Kuwahara M, Takada Y, Maruyama K, et al. C-Fos suppresses systemic inflammatory response to endotoxin. Int Immunol. (2006) 18:671–677.

29. Okada S, Obata S, Hatano M, Tokuhisa T. Dominant negative effect of the c-fos family gene products on inducible NO synthase expression in macrophages. Int Immunol. (2003) 15:1275–1282.

30. Maruyama K, Sano G, Ray N, et al. c-Fos-deficient mice are susceptible to Salmonella enterica serovar Typhimurium infection. Infect Immun. (2007) 75:1520–1523.

31. Appleman LJ, Berezovskaya A, Grass I, Boussiotis VA. CD28 costimulation mediates T cell expansion via IL-2-independent and IL-2-dependent regulation of cell cycle progression. J Immunol. (2000) 164(1):144-51. doi: 10.4049/jimmunol.164.1.144.

32. Krummel MF, Allison JP. CTLA-4 engagement inhibits IL-2 accumulation and cell cycle progression upon activation of resting T cells. J Exp Med. (1996) 183(6):2533-40. doi: 10.1084/jem.183.6.2533.

175

33. Walker LS. Treg and CTLA-4: two intertwining pathways to immune tolerance. J Autoimmun. (2013) 45:49-57. doi: 10.1016/j.jaut.2013.06.006.

34. Dienz O, Eaton SM, Krahl TJ, Diehl S, et al. Accumulation of NFAT mediates IL-2 expression in memory, but not naïve, CD4+ T cells. Proc Natl Acad Sci USA. (2007) 104(17):7175-7180.

35. Kasprowicz DJ, Kohm AP, Berton MT, Chruscinski AJ, Sharpe A, Sanders VM. Stimulation of the B cell receptor, CD86 (B7-2), and the beta 2-adrenergic receptor intrinsically modulates the level of IgG1 and IgE produced per B cell. J Immunol. (2000) 165(2):680-90. doi: 10.4049/jimmunol.165.2.680.

36. Kohm AP, Sanders VM. Norepinephrine and beta 2-adrenergic receptor stimulation regulate CD4+ T and B lymphocyte function in vitro and in vivo. Pharmacol Rev. (2001) 53(4):487-525.

37. Gabanyi I, Muller PA, Feighery L, Oliveira TY, Costa-Pinto FA, Mucida D. Neuro- immune Interactions Drive Tissue Programming in Intestinal Macrophages. Cell. (2016) 164(3):378-91. doi: 10.1016/j.cell.2015.12.023.

38. Knoop KA, Coughlin PE, Floyd AN, Ndao IM, Hall-Moore C, Shaikh N, Gasparrini AJ, Rusconi B, Escobedo M, Good M, et al. Maternal activation of the EGFR prevents translocation of gut-residing pathogenic. Proc Natl Acad Sci USA. (2020) 117(14):7941- 9. doi: 10.1073/pnas.1912022117.

39. Bonamy C, Sechet E, Amiot A, Alam A, Mourez M, Fraisse L, Sansonetti PJ, Sperandio B. Expression of the human antimicrobial peptide β-defensin-1 is repressed by the EGFR- ERK-MYC axis in colonic epithelial cells. Sci Rep. (2018) 8(1):18043. doi: 10.1038/s41598-018-36387-z.

40. Saxton R, Sabatini D. mTOR Signaling in Growth, Metabolism, and Disease. Cell. (2017) 168(6):960-76. doi: 10.1016/j.cell.2017.02.004.

41. Chiang GG, Abraham RT. Phosphorylation of mammalian target of rapamycin (mTOR) at Ser-2448 is mediated by p70S6 kinase. J Biol Chem. (2010) 280(27):25485- 25490.

42. Rosner M, Siegel N, Valli A, et al. mTOR phosphorylated at S2448 binds to raptor and rictor. Amino Acids. (2010) 38:223–228.

43. Foster KG, Fingar DC. Mammalian target of rapamycin (mTOR): conducting the cellular signaling symphony. J Bio Chem. (2010) 285(19):14071-14077.

44. Soliman GA, Acosta-Jaquez HA, Dunlop EA. mTOR Ser-2481 autophosphorylation mon- itors mTORC-specific catalytic activity and clarifies rapamycin mechanism of action. J Biol Chem. (2010) 285(11):7866-7879. 176

45. Caron E, Ghosh S, Matsuoka Y, et al. A comprehensive map of the mTOR signaling network. Mol Systems Biol. (2010) 6:435.

46. Sun X, Threadgill D, Jobin C. Campylobacter jejuni induces colitis through activation of mammalian target of rapamycin signaling. Gastroenterology. (2012) 142(1):86-95.e5. doi: 10.1053/j.gastro.2011.09.042.

47. Krisanaprakornkit S, Kimball JR, Dale BA. Regulation of human beta-defensin-2 in gingival epithelial cells: the involvement of mitogen-activated protein kinase pathways, but not the NF-kappaB transcription factor family. J Immunol. (2002) 168(1):316-24. doi: 10.4049/jimmunol.168.1.316.

48. Moon SK, Lee HY, Li JD, Nagura M, Kang SH, Chun YM, Linthicum FH, Ganz T, Andalibi A, Lim DJ. Activation of a Src-dependent Raf-MEK1/2-ERK signaling pathway is required for IL-1alpha-induced upregulation of beta-defensin 2 in human middle ear epithelial cells. Biochim Biophys Acta. (2002) 1590(1-3):41-51. doi: 10.1016/s0167- 4889(02)00196-9.

49. Villageliú DN, Rasmussen S, Lyte M. A microbial endocrinology-based simulated small intestinal medium for the evaluation of neurochemical production by gut microbiota. FEMS Microbiol Ecol. (2018) 94(7). doi: 10.1093/femsec/fiy096.

50. Qiu Z, Sheridan BS. Isolating Lymphocytes from the Mouse Small Intestinal Immune System. J Vis Exp. (2018) 132. doi: 10.3791/57281.

51. Trapecar M, Khan S, Roan NR, Chen TH, Telwatte S, Deswal M, Pao M, Somsouk M, Deeks SG, Hunt PW, et al. An Optimized and Validated Method for Isolation and Characterization of Lymphocytes from HIV+ Human Gut Biopsies. AIDS Res Hum Retroviruses. (2017) 33(1):31-9. doi: 10.1089/AID.2017.0208.

52. Achanta M, Sunkara LT, Dai G, Bommineni YR, Jiang W, Zhang G. Tissue expression and developmental regulation of chicken cathelicidin antimicrobial peptides. J Anim Sci Biotechnol. (2012) 3(1):15. doi: 10.1186/2049-1891-3-15.

53. Szklarczyk D, Franceschini A, Wyder S, Forslund K, Heller D, Huerta-Cepas J, Simonovic M, Roth A, Santos A, Tsafou KP, et al. STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res. (2015) 43:447-52. doi: 10.1093/nar/gku1003.

54. Kanehisa M, Furumichi M, Tanabe M, Sato Y, Morishima K. KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Res. (2017) 45(1):353-61. doi: 10.1093/nar/gkw1092.

177

55. Curtiss R, Kelly SM, Hassan JO. Live oral avirulent Salmonella vaccines. Vet Microbiol. (1993) 37(3-4):397-405. doi: 10.1016/0378-1135(93)90038-9.

56. Parvizi P, Andrzejewski K, Read LR, Behboudi S, Sharif S. Expression profiling of genes associated with regulatory functions of T-cell subsets in Marek's disease virus-infected chickens. Avian Pathol. (2010) 39(5):367-73. doi: 10.1080/03079457.2010.508776.

57. Lee MO, Jang HJ, Rengaraj D, Yang SY, Han JY, Lamont SJ, Womack JE. Tissue expression and antibacterial activity of host defense peptides in chicken. BMC Vet Res. (2016) 12(1):231. doi: 10.1186/s12917-016-0866-6.

Figures and Tables

Figure 6-1. Intracellular norepinephrine release by reserpine increased Salmonella resistance. Neurochemical release from explants (A) and sorted T cells (B, C) was evaluated via U- HPLC. Reserpine treatment (1 µM) increased bactericidal responses against Salmonella in explants (D) and against total Enterobacteriaceae and S. Typhimurium UK-1 challenge in chickens in vivo (E, F). Significant differences indicated by asterisks: *, P < 0.05; **, P < 0.01; ***, P < 0.001.

178

Figure 6-2. Reserpine treatment increased antimicrobial peptide (AMP) gene expression, and reserpine-induced antibacterial responses were dependent on mTOR, EGFR, and MEK1/2 signaling. AMP and IL-2 gene expression was increased by reserpine treatment while CTLA-4 gene expression was decreased (A). Norepinephrine treatment alone increased anti-Sal- monella responses in explants (B), and the effect of reserpine was blocked using beta-adrenergic receptor inhibitors ICI-118551 (훽2) or L-748337 (훽3) (C). Reserpine-induced antibacterial activities were inhibited by MEK1/2 kinase inactivation and EGF treatment (D), and norepinephrine- induced bactericidal responses are dependent on MEK1/2 signaling (E). Finally, norepinephrine- induced bactericidal responses are dependent on MEK1/2 signaling (F). Significant differences indicated by asterisks: *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

179

Figure 6-3. Graphical overview of ex vivo ceca explant model used in this study. Created using BioRender.com.

180

Figure 6-4. Summary of inflammatory scoring, serotonergic responses to reserpine treated T cells, bactericidal assays with reserpine-treated media only, and weight gain in in vivo study. A, scoring of explant inflammation via H&E staining. B, serotonin concentrations in naïve (CD4+CD25-) or regulator (CD4+CD25+) T cell pellets. C, 5-hydroxyindolacetic acid (5-HIAA) concentrations in naïve (CD4+CD25-) or regulator (CD4+CD25+) T cell pellets. D, Salmonella bactericidal assays in 0 or 1 µM reserpine-treated media alone. E, weight gain (g) of chicks from 0 to 4 days post-hatch. F, weight gain (g) of chicks from 4 to 8 days post-hatch (i.e., post-Salmonella challenge).

181

Table 6-1. Top 25 KEGG pathways in reserpine-treated explants compared to non-treated controls. with reserpine. The rows in bold in indicate the immune or metabolic pathways focused on in this study.

KEGG Pathway Observed False discovery protein rate count MAPK signaling 54 2.00 x 10-35 Insulin signaling 41 3.14 x 10-34 Pathways in cancer 63 7.96 x 10-33 PI3K-Akt signaling 51 1.22 x 10-29 ErbB signaling 29 2.58 x 10-27 EGFR signaling pathway 29 2.58 x 10-27 Neurotrophin signaling 32 8.41 x 10-26 Focal adhesion 38 8.41 x 10-26 AMPK signaling 32 1.55 x 10-25 MicroRNAs in cancer 34 2.76 x 10-25 Central carbon metabolism 26 1.69 x 10-24 in cancer T cell receptor signaling 29 3.38 x 10-24 Proteoglycans in cancer 35 4.09 x 10-23 Insulin resistance 28 2.62 x 10-22 Ras signaling 35 3.65 x 10-21 HIF-1 signaling pathway 24 1.22 x 10-18 Autophagy - animal 26 1.22 x 10-18 Regulator of actin cytoskel- 31 1.22 x 10-18 eton Hepatitis C 26 2.93 x 10-18 FoxO signaling 25 2.61 x 10-17 Chemokine signaling 28 3.59 x 10-17 Toll-like receptor signaling 22 2.97 x 10-16 mTOR signaling 25 3.18 x 10-16 Adipocytokine signaling 19 8.75 x 10-16 B cell signaling 19 1.29 x 10-15

182

Table 2. Phosphorylation status of proteins in the T cell receptor and epidermal growth factor signaling pathways in ceca explants treated with reserpine. The phosphorylation status of each significant protein in ceca explant after treatment with reserpine was determined by enter- ing the respective Uniprot accession into phosphorylation site, finding the annotation of the site of interest and accounting for the phosphorylation fold change (increased or decreased) of that site. Uniprot IDs and phosphorylation sites listed are human orthologs of chicken peptides. Bolded peptides indicate targets of interest in this study. Peptide Uniprot ac- Phosphorylation Fold change p-value cession site

T cell receptor signaling pathway PLCG2 P19174 Y783 -1.470 0.00001 RAF1 P04049 S338/S259 1.24191/2.08925 0.00001/0.00016 MEK2 P36507 S306/S222 1.510/-1.323 0/0.0003 MAP3K8 (TPL2) P41279 S400/T290 -1.471/-1.26824 0/0.00059 AKT3 Q9Y243 T305 -1.839 0 ZAP70 P43403 Y319 -1.510 0 PAK1 Q13153 T423 1.236 0.0003 NFATC3 Q12968 S344 -1.413 0.0003 c-FOS P01100 S362 1.195 0.00001 CD28 P10747 Y191 1.286 0.00121 LCK P06239 Y505 1.116 0.00003 PDPK1 O15530 S241 1.283 0.00003 TAK1 O43318 S439 1.277 0.006 IKK-B O15111 S180 -1.247 0 JUN P05412 S63/S73 -1.447/-1.734 0/0 GRB2 P62993 Y209 1.390 0.001 NFATC1 O95644 S269/S245 1.757/1.169 0/0.00161 SOS1 O07889 S1167 1.234 0.00098 h-RAS P01112 T35 -1.234 0.0001 PTPRC P08575 Y1216 -1.161 0.005 NF-kB p105 P19838 S337/S932 -1.147/-1.141 0.001/0.009 PI3KR1 P27986 Y476/Y556 1.121/1.114 0.0006/0.014 IL6R P40189 S782/Y915 -1.169/1.259 0.0142/0.00005 IL7R P16871 Y449 -1.177 0.0335 IL23R Q5VWK5 S121 -1.321 0.00007 Il12BR P29460 Y314 1.175 0.001 SOCS Q14543 Y221/Y204 -1.303/-1.157 0.0003/0.0026 JAK2 O60674 Y966/Y1007 1.226/-1.260 0.00006/0.0006 JAK1 P23458 Y993/Y1034 -1.384/-1.174 0.002/0.002 STAT1 P42224 Y701 -1.277 0 STAT4 P42228 S722 -1.338 0.002 STAT3 P40763 S727 -1.302 0.0004

Epidermal growth factor receptor signaling pathway RPS6KB1 P23445 T412 1.256 0.0003 PLCG1 P10174 Y783 -1.97 0.00001 RAF1 P04049 S338/S258 1.242/2.089 0.0006/0 PDGFRA P16234 Y1018/Y720 -2.174/-1.135 0.00001/0.01 PDGFRB P00619 Y579/Y751 -1.414/-1.127 0/0.008 MEK2 P36507 S306/S222 1.51/1.327 0/0.03 AKT3 Q94243 T305 -1.839 0 KDR P35968 Y1214 -1.496 0 STAT3 P40763 S727 -1.302 0.0004 183

Table 2 continued. Peptide Uniprot ac- Phosphorylation Fold change p-value cession site EGFR P00533 Y869 -1.242 0.007 BRAF P15056 S729/S446 1.492/-1.338 0/0.0004 PIK3CB P42338 Y425/S1070 1.636/1/430 0.00001/0.0002 MET (HGFR) P08581 Y1349/Y1356 -1.180/-1.178 0.01/0.01 GSK3B P49841 S389 1.161 0.005 FGFR3 P22607 Y760/Y724 -1.258/-1.194 0.015/0.016 EIF4ERP1 Q13541 T37 1.116 0.04 JAK1 P23458 Y993/Y1034 -1.384/-1.174 0.002/0.002 mTOR P42345 S2448/T2446/S2481 1.721/1.411/-1.672 0/0.00001/0.006 RPTOR Q8N122 S863 1.245 0.00025 PTEN P60484 S380/Y240 -1.14/1.247 0.025/0.002 SRC P12931 S17 1.154 0.004 SHC3 P29353 Y427 -1.208 0.02 JAK2 O60674 Y966/Y1007 1.226/-1.26 0.00006/0.0006 GRB2 P62993 Y209 1.390 0.001 SHC1 P29335 Y262 -1.208 0.02 HRAS P01112 T35 -1.234 0.0001 PRKCA P17252 S657/T638 -1.135/-1.204 0.005/0.03 FGFR2 P21802 S782 -1.190 0.02

184

Table 6-3. Summary of Salmonella enterica isolates used for in vitro bactericidal assays. TC, tetracycline. ST, streptomycin. Subscript “R” indicates resistance. Salmonella enterica Relevant antibiotic-resistance profiles and/or characteristics Source serovar UK-1 (Typhimurium) Highly-virulent “universal killer” (55)

Kentucky TCR, STR, CPR, ammonium-resistance (4)

Table 6-4. Summary of primers and conditions used for qPCR. F, forward primer. R, reverse primer. Gene Target Primer sequence (5’ – 3’) F/R Annealing Source Temp (°C) IL-2 CTGGGAGAAGTGGTTACTCTGA F 59 (9) CCCGTAAGACTCTTGAGGTTC R IL-10 CATGCTGCTGGGCCTGAA F 55 (9) CGTCTCCTTGATCTGCTTGATG R CTLA-4 CAAGATGGAGCGGATGTACC F 51 (56) TGGCTGAGATGATGATGCTG R Fowlicidin-1 GCTGTGGACTCCTACAACCAAC F 55 (52) GGAGTCCACGCAGGTGACATC R GAPDH GCACGCCATCACTATCTTCC F 55 (52) CATCCACCGTCTTCTGTGTG R Beta-defensin 14 ATGGGCATATTCCTCCTGT F 55 (57) CACTTTGCCAGTCCATTGT R Beta-defensin 12 AGACAGCTGTAACCACGACA F 55 (57) CTGCAGTTCGGACACCTTCA R 185

CHAPTER 7. GENERAL CONCLUSION

Summary

Pathogenic Enterobacteriaceae like E. coli and Salmonella are a major detriment to the poultry industry, due to animal mortality caused by infections, and product contamination, or foodborne illness in humans (1-4). In this dissertation, we show that several prophylactic strategies (i.e., probiotics, live Salmonella vaccine, ileal spores, and reserpine) mitigate the abundances and virulence activities of Enterobacteriaceae in chickens, providing evidence for their utility in commercial practice. Although many studies have associated Enterobacteriaceae colonization with reduced animal productivity (5-7), it must be emphasized that Enterobacteriaceae are not inherently detrimental to host health and, in some instances, are associated with improved productivity (8, 9). For example, E. coli Nissle 1917 is a commercially available probiotic that was originally isolated from a German soldier who remained healthy during a shigellosis outbreak in World War I (10). Nissle has since become the most widely studied example of beneficial Enterobacteriaceae, improving host gastrointestinal function while directly antagonizing pathogenic Enterobacteriaceae via several mechanisms like microcin production and iron se- questration (11). This demonstrates that Enterobacteriaceae exist on a spectrum, ranging from deleterious to mutualistic strains of bacteria. Therefore, identifying the mechanisms by which intestinal Enterobacteriaceae colonization is affected as well as factors influencing virulence potential is important for selectively reducing harmful strains while maintaining (or enhancing) the colonization of beneficial strains in the intestine. To this end, by investigating different prophylactic strategies, we identified several pathways in which Enterobacteriaceae colonization and virulence can be reduced in chickens (e.g., altering the commensal microbiota, reducing intesti- 186 nal smRNAs, increasing bactericidal responses in blood, and modulating the neuro-immuno-metabolic axis). These findings open several future research avenues, as the identification of these pathways permits the specific targeting of pathogenic Enterobacteriaceae activities in poultry, other food animals, and potentially humans.

Given that probiotics and live Salmonella vaccines are widely used in commercial poultry

(12-17), we sought to explore their potential to antagonize Enterobacteriaceae in Chapters 2-4.

In Chapter 2, given that probiotics and live Salmonella vaccines are generally given orally, we investigated the effects these prophylactics may have on the gut environment, specifically the gut microbiome and neurochemical production. This study was the first to demonstrate that probiotics and live vaccines affect gut neurochemical production in chickens. Additionally, we found that probiotic treatment alone increased Enterobacteriaceae fecal shedding compared to non- treated and vaccinated birds. Conversely, immunization with the live Salmonella vaccine reduced Enterobacteriaceae irrespective of probiotic supplementation. Using 16S rRNA sequencing data, these changes in Enterobacteriaceae colonization were positively associated with the levels of several fermentative populations of commensal bacteria, which were similarly decreased upon vaccination. This finding supports the “restaurant hypothesis,” in which fermentative bacteria feed Enterobacteriaceae like E. coli by breaking down complex carbohydrates into mono- and disaccharides, which are readily metabolized by Enterobacteriaceae (18). Addition- ally, using U-HPLC and R software, the study shows that intestinal norepinephrine levels were positively correlated with Enterobacteriaceae. This finding is supported from previous studies, finding that Enterobacteriaceae directly increase norepinephrine yields in the intestine (19), and norepinephrine has been demonstrated to serve as a signaling factor for increased virulence in 187

Enterobacteriaceae (20-23). Finally, intestinal IgA were positively associated with Enterobacte- riaceae levels, suggesting that the intestinal immune system is highly responsive to commensal

Enterobacteriaceae.

Large IncF plasmids carrying antibiotic resistance and virulence genes are significant sources of genetic diversity in Enterobacteriaceae like E. coli and play a crucial role in the prop- agation of virulent bacteria. Currently, no treatment or prophylactic able to mitigate the spread of antibiotic resistance in the animal intestine exists, which is notable given that antibiotic resistance is primarily spread in the intestine of food animals (24). Given the work in Chapter 2 only demonstrated changes in total Enterobacteriaceae levels, we sought to determine whether probiotics and live Salmonella vaccine affected virulence potential. In Chapter 3, we found that several phenotypic attributes, such as antibiotic resistance and (siderophore production) and

APEC virulence genes (iutA, hylfA, iss) were uniquely absent in fecal E. coli derived from bird given both probiotics and a live Salmonella vaccine (i.e., P+V). Coincidentally, this finding was associated with a marked loss of large virulence plasmids, specifically IncF and ColV. Further- more, the loss of virulence potential in P+V E. coli was associated with reduced intestinal smR-

NAs in P+V birds, suggesting that smRNAs may play a role. To investigate causality, we treated

E. coli conjugation mating pairs with smRNAs from each treatment group and found that greater smRNA concentrations increased IncF plasmid transfer, regardless of treatment group source.

Lastly, using predictive hybridization analyses, we found that Gallus gallus miRNA species may hybridize with transfer and pilus genes on the IncF plasmid pAPEC-O2R. This suggests that secreted chicken miRNAs may facilitate plasmid transfer, although we cannot rule out the possibil- ity that commensal bacterial small RNAs may also drive plasmid transfer. Overall, this study is the first to identify a potential strategy to reduce spread of antibiotic resistance in the intestinal 188 tract. Furthermore, this is the first study to identify smRNAs as a potential driver of intestinal plasmid transfer, making them a novel target for mitigating large virulence plasmid transfer.

Given Enterobacteriaceae are a major component of the gut microbiota and that probiotics and live Salmonella vaccines are given orally, it is clearly important to investigate responses of intestinal Enterobacteriaceae to these treatments. However, APEC can invade internal tissues and cause sepsis in poultry, resulting in high mortality as well as carcass condemnation (25-27).

Thus, although combining these live prophylactics both reduces intestinal Enterobacteriaceae levels and mitigates the spread of virulence genes, it was unclear what effect this combination might have on extraintestinal Enterobacteriaceae resistance. In Chapter 4, we sought to answer this question by measuring extraintestinal responses induced by these prophylactics. Using an airsac challenge model to induce APEC colibacillosis in vivo, we found that the combination of probiotics and live Salmonella vaccine reduced lesion scores and APEC enumeration in the blood compared to non-treated controls. Using in vitro bactericidal assays to identify a mechanis- tic link, we found that the combination treatment increased antimicrobial activities by blood cells. Notably, although anti-LPS IgY production was enhanced upon live Salmonella vaccination, these antibody responses were independent of APEC killing, suggesting this combination treatment uniquely stimulated bactericidal activities of innate immune cells like heterophils and monocytes. However, the specific cell populations responsible for these responses are not clear and warrant future investigation. Overall, this study demonstrated the ability for orally delivered probiotics and live vaccines to confer extraintestinal responses against pathogenic bacteria.

Although probiotics and live vaccines are currently used in commercial poultry, there are some major concerns. For example, in my work, live Salmonella vaccination depleted abundances of fermentative bacteria that produce short chain fatty acids, which have been extensively 189 reviewed to improve intestinal health and immunity (28, 29). Although probiotics are useful in conferring numerous benefits to the host (feed conversion, competitive exclusion, etc), they must be given daily to confer a consistent effect and typically reduce inflammation (30, 31), an important point given that sufficient inflammation is crucial to clear intestinal Salmonella (32, 33).

In Chapter 5, we propose the novel use of a single-dose inoculum containing ileal spores at day- of-hatch to induce early, immunological maturation in the chicken intestine. Inoculation with ileal spores increased SFB colonization in the distal ileum as early as 3 days post-hatch. This is the earliest recorded observation of SFB attachment to any animal epithelium, which is important given that SFB attachment is required for the potent immunological responses induced by SFB

(35). Using the chicken kinome peptide array, we found that ileal spores drastically altered immunometabolic pathways, which were associated with several phenotypic differences compared to controls. For example, differential changes in Wnt signaling were associated with reduced gut permeability, and Wnt signaling is crucial for epithelial regeneration and turnover (35). Further- more, differential changes in TH17 differentiation signaling were associated with increased Sal- monella killing, suggesting these antimicrobial responses may be related to an expansion of TH17 cells induced by ileal spores. Overall, we found that early inoculation with ileal spores dramatically improved maturation of the intestinal immune system, which was associated with increased

SFB colonization in the distal ileum. In our lab, current work is underway to isolate SFB to determine its immunostimulatory potential in chickens.

In Chapter 2 and Chapter 5, we found that neurochemicals and immunometabolism could be major parameters for assessing gut health in poultry. However, the neuro-immuno-metabolic axis in chickens has been poorly investigated, resulting in an insufficient understanding of how to better mitigate Enterobacteriaceae colonization at the molecular level. One scenario in which 190 this axis may play a role is in Salmonella colonization, in which Salmonella induces an immuno- tolerigenic environment via expansion of intestinal Tregs (33, 36). This is notable given Treg expansion would suppress the immunological responses necessary to clear Salmonella from the intestine (32). Notably, disruption of intracellular catecholamine stores in human Tregs via reserpine treatment inhibits their immunosuppressive function (37). Thus, in Chapter 6, we hypothesize that reserpine could be used as a prophylactic to increase Salmonella resistance by disrupting the immunosuppressive functions of intestinal Tregs. Using an ex vivo ceca explant model, reserpine pre-treatment increased Salmonella resistance by increasing norepinephrine release in both explants and CD4+CD25+ cells (i.e., Tregs). Furthermore, reserpine decreased CTLA-4 gene expression while increasing AMP gene expression, suggesting that reducing immunosuppressive functions increased the inflammatory responses necessary to increase Salmonella killing. Using the kinome peptide array and protein inhibitors/ligands, EGFR and TCR signaling pathways were shown to be directly involved in reserpine activity. Finally, inhibiting MEK1/2 activation ablated antimicrobial responses, demonstrating the central role of MEK1/2 signaling in these reserpine-induced changes in neuro-immuno-metabolic signaling. Overall, this study demonstrates the prospective use of reserpine as a novel prophylactic to improve Salmonella resistance in poultry.

Conclusion

In conclusion, we identify several prophylactic treatment options to antagonize Entero- bacteriaceae in chickens. As a result of these studies, we have elucidated several factors which affect Enterobacteriaceae colonization, virulence, and exchange of virulence genes. Given the exploratory nature of these studies, future work should investigate the molecular basis for Enter- obacteriaceae resistance. Given the success of the explant model developed in Chapter 6, this 191 model could be used to similarly investigate signaling pathways induced by the live prophylactics examined in this dissertation. In Chapters 2 and 5, changes in the gut microbiota were clearly associated with Enterobacteriaceae colonization and resistance. Fecal transplant experiments are a feasible means to isolate the effect of the gut microbiota by inoculating naïve chicks with the fecal homogenates of prophylactic-treated animals (38). Furthermore, individual bacteria like

SFB should also be isolated to study their individual effects on host health, and this work is currently being performed in our lab. Lastly, just as its important to determine host factors and genes involved in Enterobacteriaceae resistance, it is crucial to understand the molecular ligands which live prophylactics use to stimulate host responses. Bacteria are rich sources of immuno- genic compounds like MAMPs, which stimulate host TLRs (39-41), metabolites like SCFAs

(28), and formylated peptide motifs, which are crucial signals for intestinal epithelium regeneration (42). Thus, using live prophylactics with genetic knockouts as well as treating animals with individual microbial compounds will elucidate the role of these microbial factors in host responses.

References

1. Mellata M. Human and avian extraintestinal pathogenic Escherichia coli: infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog Dis. (2013) 10:916–32. doi: 10.1089/fpd.2013.1533

2. Food and Agriculture Organization of the United Nations. FAOSTAT: Live Animals Data. (2017). Available online from: http://www.fao.org/faostat/en

3. Antunes P, Mourão J, Campos J, Peixe L. Salmonellosis: the role of poultry meat. Clin Microbiol Infect. (2016) 22:110–21. doi: 10.1016/j.cmi.2015. 12.004

4. Center for Disease Control and Prevention (2021). Salmonella homepage. Accessed Feb- ruary 2021. https://www.cdc.gov/Salmonella/inde.html

192

5. Olsen RH, Frantzen C, Christensen H, Bisgaard M. An investigation on first-week mortality in layers. Avian Dis. (2012) 56:51–57.

6. Rubio LA, Peinado MJ, Ruiz R, Suárez-Pereira E, Ortiz Mellet C, García Ferná JM. Cor- relations between changes in intestinal microbiota composition and performance parameters in broiler chickens. J Anim Physiol Anim Nutr. (2015) 99:418–423.

7. Johnson TJ, Youmans BP, Noll S, Cardona C, Evans NP, Karnezos TP, Ngunjiri JM, Abundo MC, Lee CW. A Consistent and Predictable Commercial Broiler Chicken Bacte- rial Microbiota in Antibiotic-Free Production Displays Strong Correlations with Perfor- mance. Appl Environ Microbiol. (2018) 84:e00362-18.

8. Metzler-Zebeli BU, Siegerstetter SC, Magowan E, Lawlor PG, Petri RM, O’Connell NE, Zebeli Q. Feed Restriction Modifies Intestinal Microbiota-Host Mucosal Networking in Chickens Divergent in Residual Feed Intake. mSystems. (2019) 4:e00261-18.

9. Siegerstetter SC, Petri RM, Magowan E, Lawlor PG, Zebeli Q, O’Connell NE, Metzler- Zebeli BU. Feed Restriction Modulates the Fecal Microbiota Composition, Nutrient Re- tention, and Feed Efficiency in Chickens Divergent in Residual Feed Intake. Front Micro- biol. (2018) 9:2698.

10. Singh KM, Shah T, Deshpande S, Jakhesara SJ, Koringa PG, Rank DN, Joshi CG. High through put 16S rRNA rRNA gene-based pyrosequencing analysis of the fecal microbiota of high FCR and low FCR broiler growers. Mol Biol Rep. (2012) 39:10595–10602.

11. Nissle, A. Weiteres u¨ber die Grundlagen und Praxis der Mutaflorbehandlung. Dtsch Med Wochenschr. (1925) 44, 1809–1813.

12. Deriu E, Liu JZ, Pezeshki M, Edwards RA, Ochoa RJ, Contreras H, et al. Probiotic bacteria reduce Salmonella typhimurium intestinal colonization by competing for iron. Cell Host Microbe. (2013) 14:26–37. doi: 10.1016/ j.chom.2013.06.007

13. Fuller R. Probiotics in man and animals. J Appl Bacteriol. (1989) 66:365–378. doi: 10.1111/j.1365-2672.1989.tb05105.x

14. Patterson JA, and Burkholder KM. Application of prebiotics and probiotics in poultry production. Poult Sci. (2003) 82:627–631. doi: 10.1093/ps/82.4.627

15. Kabir, S. M. (2009). The role of probiotics in the poultry industry. Int. J. Mol. Sci. 10, 3531–3546. doi: 10.3390/ijms10083

16. Hassan JO, Curtiss R III. Efficacy of a live avirulent Salmonella typhimurium vaccine in preventing colonization and invasion of laying hens by Salmonella typhimurium and Sal- monella enteritidis. Avian Dis. (1997) 41:783–791. doi: 10.2307/1592330 193

17. Muniz EC, Verdi R, Leão JA, Back A, Nascimento VPD. Evaluation of the effectiveness and safety of a genetically modified live vaccine in broilers challenged with Salmonella Heidelberg. Avian Pathol. (2017) 46:676–82. doi: 10.1080/03079457.2017.1348598

18. Dórea FC, Cole DJ, Hofacre C, Zamperini K, Mathis D, Doyle MP, Lee MD, Maurer JJ. Effect of Salmonella vaccination of breeder chickens on contamination of broiler chicken carcasses in integrated poultry operations. Appl Environ Microbiol. (2010) 76(23):7820-5. doi: 10.1128/AEM.01320-10

19. Conway T, Cohen PS. (2015) Commensal and pathogenic Escherichia coli metabolism in the gut. Microbiol Spectr. (2015) 3:1–24. doi: 10.1128/microbiolspec.MBP-0006-2014

20. Asano Y, Hiramoto T, Nishino R, Aiba Y, Kimura T, Yoshihara K, et al. Critical role of gut microbiota in the production of biologically active, free catecholamines in the gut lumen of mice. Am J Physiol Gastrointest Liver Physiol. (2012) 303:1288–95. doi: 10.1152/ajpgi.00341.2012

21. Freestone PP, Haigh RD, Lyte M. Blockade of catecholamine-induced growth by adrenergic and dopaminergic receptor antagonists in Escherichia coli O157:H7. BMC Microbiol. (2007) 7:8. doi: 10.1186/1471-2180-7-8

22. Freestone PP, Haigh RD, Lyte M. Specificity of catecholamine-induced growth in Esche- richia coli O157:H7. FEMS Microbiol Lett. (2007) 269:221–28. doi: 10.1111/j.1574- 6968.2006.00619.x

23. Clarke MB, Hughes DT, Zhu C, Boedeker EC, Sperandio V. The QseC sensor kinase: a bacterial adrenergic receptor. Proc Natl Acad Sci USA. (2006) 103:10420–25. doi: 10.1073/pnas.0604343103

24. Pasupuleti S, Sule N, Cohn WB, MacKenzie DS, Jayaraman A, Manson MD. Chemotaxis of Escherichia coli to norepinephrine (NE) requires conversion of NE to 3,4-dihydroxymandelic acid. J Bacteriol. (2014) 196, 3992–4000. doi: 10.1128/JB.02065-14

25. Rolain JM. Food and human gut as reservoirs of transferable antibiotic resistance encoding genes. Front Microbiol. (2013) 4:173. doi: 10.3389/fmicb.2013. 00173

26. Yogaratnam V. Analysis of the causes of high rates of carcass rejection at a poultry pro- cessing plant. Vet Rec. (1995) 137:215–217.

27. Vandekerchove, D., P. De Herdt, H. Laevens, and F. Pasmans. 2004. Colibacillosis in caged layer hens: characteristics of the disease and the aetiological agent. Avian Pathol. 33:117–125.

194

28. Olsen RH, Frantzen C, Christensen H, Bisgaard M. An investigation on first-week mortality in layers. Avian Dis. (2012) 56:51–57.

29. Koh A, De Vadder F, Kovatcheva-Datchary P, Bäckhed F. From dietary fiber to host phys- iology: short-chain fatty acids as key bacterial metabolites. Cell. (2016) 165:1332–1345. doi: 10.1016/j.cell.2016.05.041

30. Wu W, Xiao Z, An W, Dong Y, Zhang B. Dietary sodium butyrate improves intestinal development and function by modulating the microbial community in broilers. PLoS ONE (2018) 13:e0197762. doi: 10.1371/journal. pone.0197762

31. Schmidt C. The startup bugs. Nat Biotechnol. (2013) 31:279–81. doi: 10.1038/nbt.2544

32. Tarradas J, Tous N, Esteve-Garcia E, Brufau AJ. The Control of Intestinal Inflammation: A Major Objective in the Research of Probiotic Strains as Alternatives to Antibiotic Growth Promoters in Poultry. Microorganisms. (2020) 8(2). doi:10.3390/microorganisms8020148

33. Kogut MH, Tellez GI, McGruder ED, Hargis BM, Williams JD, Corrier DE, et al. Hetero- phils are decisive components in the early responses of chickens to Salmonella enteritidis infections. Microb Pathog. (1994) 16:141– 51. doi: 10.1006/mpat.1994.1015

34. Kogut MH, Swaggerty CL, Byrd JA, Selvaraj R, Arsenault RJ (2016) Chicken-Specific Kinome Array Reveals that Salmonella enterica Serovar Enteritidis Modulates Host Im- mune Signaling Pathways in the Cecum to Establish a Persistence Infection. Int J Mol Sci 17 (8). doi:10.3390/ijms17081207

35. Ivanov II, Atarashi K, Manel N, Brodie EL, Shima T, Karaoz U, et al. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell. (2009) 139:485–98. doi: 10.1016/j.cell.2009.09.033

36. Perochon J, Carroll LR, Cordero JB. Wnt signalling in intestinal stem cells: lessons from mice and flies. Genes. (2018) 9:138. doi: 10.3390/genes9030138

37. Shanmugasundaram R, Kogut M, Arsenault R, Swaggerty C, Cole K, Reddish J, Selvaraj R. Effect of Salmonella infection on cecal tonsil regulatory T cell properties in chickens. Poult Sci. (2015) 94(8):1828-35. doi: 10.3382/ps/pev161.

195

38. Cosentino M, Fietta AM, Ferrari M, Rasini E, Bombelli R, Carcano E, Saporiti F, Meloni F, Marino F, Lecchini S. Human CD4+CD25+ regulatory T cells selectively express tyrosine hydroxylase and contain endogenous catecholamines subserving an autocrine/paracrine inhibitory functional loop. Blood. (2007) 109(2):632-42. doi: 10.1182/blood-2006-01-028423.

39. Niederwerder MC. Fecal microbiota transplantation as a tool to treat and reduce susceptibility to disease in animals. Vet Immunol Immunopathol. (2018) 206:65-72. doi: 10.1016/j.vetimm.2018.11.002

40. Brownlie R, Allan B. Avian toll-like receptors. Cell Tissue Res. (2011) 343(1):121-130. doi:10.1007/s00441-010-1026-0

41. Roach JC, Glusman G, Rowen L, Kaur A, Purcell MK, Smith KD, Hood LE, Aderem A. The evolution of vertebrate Toll-like receptors. Proc Natl Acad Sci USA. (2005) 102(27):9577-9582. doi:10.1073/pnas.0502272102

42. Carpenter S, O'Neill LA. Recent insights into the structure of Toll-like receptors and post- translational modifications of their associated signalling proteins. Biochem J. (2009) 422:(1):1-10. doi:10.1042/BJ20090616

43. Alam A, Leoni G, Wentworth C, et al. Redox signaling regulates commensal-mediated mucosal homeostasis and restitution and requires formyl peptide receptor 1. Mucosal Im- munol. (2014) 7:645–655. doi: 10.1038/mi.2013.84