Belief Propagation in Genotype-Phenotype Networks
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach
Mafalda Rita Avó Bacalhau Establishing the Pathogenicity of Novel Mitochondrial DNA Sequence Variations: a Cell and Molecular Biology Approach Tese de doutoramento do Programa de Doutoramento em Ciências da Saúde, ramo de Ciências Biomédicas, orientada pela Professora Doutora Maria Manuela Monteiro Grazina e co-orientada pelo Professor Doutor Henrique Manuel Paixão dos Santos Girão e pela Professora Doutora Lee-Jun C. Wong e apresentada à Faculdade de Medicina da Universidade de Coimbra Julho 2017 Faculty of Medicine Establishing the pathogenicity of novel mitochondrial DNA sequence variations: a cell and molecular biology approach Mafalda Rita Avó Bacalhau Tese de doutoramento do programa em Ciências da Saúde, ramo de Ciências Biomédicas, realizada sob a orientação científica da Professora Doutora Maria Manuela Monteiro Grazina; e co-orientação do Professor Doutor Henrique Manuel Paixão dos Santos Girão e da Professora Doutora Lee-Jun C. Wong, apresentada à Faculdade de Medicina da Universidade de Coimbra. Julho, 2017 Copyright© Mafalda Bacalhau e Manuela Grazina, 2017 Esta cópia da tese é fornecida na condição de que quem a consulta reconhece que os direitos de autor são pertença do autor da tese e do orientador científico e que nenhuma citação ou informação obtida a partir dela pode ser publicada sem a referência apropriada e autorização. This copy of the thesis has been supplied on the condition that anyone who consults it recognizes that its copyright belongs to its author and scientific supervisor and that no quotation from the -
Efficacy and Mechanistic Evaluation of Tic10, a Novel Antitumor Agent
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2012 Efficacy and Mechanisticv E aluation of Tic10, A Novel Antitumor Agent Joshua Edward Allen University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Oncology Commons Recommended Citation Allen, Joshua Edward, "Efficacy and Mechanisticv E aluation of Tic10, A Novel Antitumor Agent" (2012). Publicly Accessible Penn Dissertations. 488. https://repository.upenn.edu/edissertations/488 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/488 For more information, please contact [email protected]. Efficacy and Mechanisticv E aluation of Tic10, A Novel Antitumor Agent Abstract TNF-related apoptosis-inducing ligand (TRAIL; Apo2L) is an endogenous protein that selectively induces apoptosis in cancer cells and is a critical effector in the immune surveillance of cancer. Recombinant TRAIL and TRAIL-agonist antibodies are in clinical trials for the treatment of solid malignancies due to the cancer-specific cytotoxicity of TRAIL. Recombinant TRAIL has a short serum half-life and both recombinant TRAIL and TRAIL receptor agonist antibodies have a limited capacity to perfuse to tissue compartments such as the brain, limiting their efficacy in certain malignancies. To overcome such limitations, we searched for small molecules capable of inducing the TRAIL gene using a high throughput luciferase reporter gene assay. We selected TRAIL-inducing compound 10 (TIC10) for further study based on its induction of TRAIL at the cell surface and its promising therapeutic index. TIC10 is a potent, stable, and orally active antitumor agent that crosses the blood-brain barrier and transcriptionally induces TRAIL and TRAIL-mediated cell death in a p53-independent manner. -
Studies of Mitochondrial Dysfunction in Models of Rett Syndrome
Studies of Mitochondrial Dysfunction in Models of Rett Syndrome by Natalya O. Shulyakova A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Physiology University of Toronto © Copyright by Natalya O. Shulyakova 2016 Studies of Mitochondrial Dysfunction in Models of Rett Syndrome Natalya O. Shulyakova Doctor of Philosophy Department of Physiology University of Toronto 2016 Abstract Rett syndrome (RTT) is a neurodevelopmental disorder affecting primarily females that is predominantly caused by mutations in the MECP2 gene. RTT is characterized by a loss of previously acquired skills, ambulatory deficits, respiratory problems and overall retarded growth. Mitochondrial dysfunction and oxidative stress identified in MeCP2-deficient tissues raised the possibility that mitochondrial impairments may play role in the pathogenesis of RTT. To further investigate the role of mitochondrial dysfunction in the absence of MeCP2, I analyzed mitochondrial function and morphology in Mecp2-deficient mouse adult skin fibroblasts (ASF) and in Mecp2-null mouse ESC derived neurons using an array of fluorescent dyes coupled with flow cytometry and confocal microscopy. The heterogeneity of cellular responses in ASF prevented identification of consistent changes in mitochondrial function, making them an unsuitable model for studying mitochondrial dysfunctions. Mecp2-null mouse ESC were differentiated into enriched population of neurons. Mecp2-null neurons displayed hyperpolarized mitochondria, high levels of ROS, low ATP and impaired mitochondrial trafficking. Resveratrol and mitochondrial cocktail that target expression of mitochondrial genes and mitochondrial metabolism, but not simple ROS scavengers, were successful at ameliorating ROS levels and normalizing mitochondrial membrane potential. Since oxidative stress was reported in RTT ii mice, I tested whether resveratrol and mitochondrial cocktail could reverse or improve behavioral phenotype in RTT mice. -
Supplementary Materials
1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No. -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
551978V2.Full.Pdf
bioRxiv preprint doi: https://doi.org/10.1101/551978; this version posted February 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 A high-resolution, chromosome-assigned Komodo dragon genome reveals adaptations in the 2 cardiovascular, muscular, and chemosensory systems of monitor lizards 3 4 Abigail L. Lind1, Yvonne Y.Y. Lai2, Yulia Mostovoy2, Alisha K. Holloway1, Alessio Iannucci3, Angel 5 C.Y. Mak2, Marco Fondi3, Valerio Orlandini3, Walter L. Eckalbar4, Massimo Milan5, Michail 6 Rovatsos6,7, , Ilya G. Kichigin8, Alex I. Makunin8, Martina J. Pokorná6, Marie Altmanová6, Vladimir 7 A. Trifonov8, Elio Schijlen9, Lukáš Kratochvíl6, Renato Fani3, Tim S. Jessop10, Tomaso Patarnello5, 8 James W. Hicks11, Oliver A. Ryder12, Joseph R. Mendelson III13,14, Claudio Ciofi3, Pui-Yan 9 Kwok2,4,15, Katherine S. Pollard1,4,16,17,18, & Benoit G. Bruneau1,2,19 10 11 1. Gladstone Institutes, San Francisco, CA 94158, USA. 12 2. Cardiovascular Research Institute, University of California, San Francisco, CA 94143, USA. 13 3. Department of Biology, University of Florence, 50019 Sesto Fiorentino (FI), Italy 14 4. Institute for Human Genetics, University of California, San Francisco, CA 94143, USA. 15 5. Department of Comparative Biomedicine and Food Science, University of Padova, 35020 16 Legnaro (PD), Italy 17 6. Department of Ecology, Charles University, 128 00 Prague, Czech Republic 18 7. Institute of Animal Physiology and Genetics, The Czech Academy of Sciences, 277 21 19 Liběchov, Czech Republic 20 8. -
Mitochondrial Atpif1 Regulates Haem Synthesis in Developing Erythroblasts
LETTER doi:10.1038/nature11536 Mitochondrial Atpif1 regulates haem synthesis in developing erythroblasts Dhvanit I. Shah1, Naoko Takahashi-Makise2, Jeffrey D. Cooney1{, Liangtao Li2, Iman J. Schultz1{, Eric L. Pierce1{, Anupama Narla1,3, Alexandra Seguin2, Shilpa M. Hattangadi3,4{, Amy E. Medlock5, Nathaniel B. Langer1{, Tamara A. Dailey5, Slater N. Hurst1, Danilo Faccenda6, Jessica M. Wiwczar7{, Spencer K. Heggers1, Guillaume Vogin1{, Wen Chen1{, Caiyong Chen1, Dean R. Campagna8, Carlo Brugnara9,YiZhou3, Benjamin L. Ebert1, Nika N. Danial7, Mark D. Fleming8, Diane M. Ward2, Michelangelo Campanella6, Harry A. Dailey5, Jerry Kaplan2 & Barry H. Paw1,3 Defects in the availability of haem substrates or the catalytic activ- and band-3 (data not shown). On the basis of red cell indices, the ity of the terminal enzyme in haem biosynthesis, ferrochelatase erythrocytes from pnt embryos that survive to adult stage exhibited (Fech), impair haem synthesis and thus cause human congenital hypochromic, microcytic anaemia (Supplementary Fig. 1a). Histolo- anaemias1,2. The interdependent functions of regulators of mito- gical analysis of adult pnt haematopoietic tissues showed no gross chondrial homeostasis and enzymes responsible for haem synthesis morphological defects (Supplementary Fig. 1b). are largely unknown. To investigate this we used zebrafish genetic To identify a candidate gene for the pnt locus we carried out posi- screens and cloned mitochondrial ATPase inhibitory factor 1 tional cloning and chromosomal walk, which identified the most (atpif1) from a zebrafish mutant with profound anaemia, pinotage (pnt tq209). Here we describe a direct mechanism establishing that a b Atpif1 regulates the catalytic efficiency of vertebrate Fech to syn- z42828bz15222 z160 z67416 z13215 thesize haem. -
ITRAQ-Based Quantitative Proteomic Analysis of Processed Euphorbia Lathyris L
Zhang et al. Proteome Science (2018) 16:8 https://doi.org/10.1186/s12953-018-0136-6 RESEARCH Open Access ITRAQ-based quantitative proteomic analysis of processed Euphorbia lathyris L. for reducing the intestinal toxicity Yu Zhang1, Yingzi Wang1*, Shaojing Li2*, Xiuting Zhang1, Wenhua Li1, Shengxiu Luo1, Zhenyang Sun1 and Ruijie Nie1 Abstract Background: Euphorbia lathyris L., a Traditional Chinese medicine (TCM), is commonly used for the treatment of hydropsy, ascites, constipation, amenorrhea, and scabies. Semen Euphorbiae Pulveratum, which is another type of Euphorbia lathyris that is commonly used in TCM practice and is obtained by removing the oil from the seed that is called paozhi, has been known to ease diarrhea. Whereas, the mechanisms of reducing intestinal toxicity have not been clearly investigated yet. Methods: In this study, the isobaric tags for relative and absolute quantitation (iTRAQ) in combination with the liquid chromatography-tandem mass spectrometry (LC-MS/MS) proteomic method was applied to investigate the effects of Euphorbia lathyris L. on the protein expression involved in intestinal metabolism, in order to illustrate the potential attenuated mechanism of Euphorbia lathyris L. processing. Differentially expressed proteins (DEPs) in the intestine after treated with Semen Euphorbiae (SE), Semen Euphorbiae Pulveratum (SEP) and Euphorbiae Factor 1 (EFL1) were identified. The bioinformatics analysis including GO analysis, pathway analysis, and network analysis were done to analyze the key metabolic pathways underlying the attenuation mechanism through protein network in diarrhea. Western blot were performed to validate selected protein and the related pathways. Results: A number of differentially expressed proteins that may be associated with intestinal inflammation were identified. -
The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation
The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32 -
Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7, -
MALE Protein Name Accession Number Molecular Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean H Mean PDAC Mean T-Test PDAC Vs. H T-Test
MALE t-test t-test Accession Molecular H PDAC PDAC vs. PDAC vs. Protein Name Number Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean Mean Mean H CP PDAC/H PDAC/CP - 22 kDa protein IPI00219910 22 kDa 7 5 4 8 1 0 6 6 1 0.1126 0.0456 0.1 0.1 - Cold agglutinin FS-1 L-chain (Fragment) IPI00827773 12 kDa 32 39 34 26 53 57 36 30 55 0.0309 0.0388 1.8 1.5 - HRV Fab 027-VL (Fragment) IPI00827643 12 kDa 4 6 0 0 0 0 5 0 0 - 0.0574 - 0.0 - REV25-2 (Fragment) IPI00816794 15 kDa 8 12 5 7 8 9 10 6 8 0.2225 0.3844 1.3 0.8 A1BG Alpha-1B-glycoprotein precursor IPI00022895 54 kDa 115 109 106 112 111 100 112 109 105 0.6497 0.4138 1.0 0.9 A2M Alpha-2-macroglobulin precursor IPI00478003 163 kDa 62 63 86 72 14 18 63 79 16 0.0120 0.0019 0.2 0.3 ABCB1 Multidrug resistance protein 1 IPI00027481 141 kDa 41 46 23 26 52 64 43 25 58 0.0355 0.1660 2.4 1.3 ABHD14B Isoform 1 of Abhydrolase domain-containing proteinIPI00063827 14B 22 kDa 19 15 19 17 15 9 17 18 12 0.2502 0.3306 0.7 0.7 ABP1 Isoform 1 of Amiloride-sensitive amine oxidase [copper-containing]IPI00020982 precursor85 kDa 1 5 8 8 0 0 3 8 0 0.0001 0.2445 0.0 0.0 ACAN aggrecan isoform 2 precursor IPI00027377 250 kDa 38 30 17 28 34 24 34 22 29 0.4877 0.5109 1.3 0.8 ACE Isoform Somatic-1 of Angiotensin-converting enzyme, somaticIPI00437751 isoform precursor150 kDa 48 34 67 56 28 38 41 61 33 0.0600 0.4301 0.5 0.8 ACE2 Isoform 1 of Angiotensin-converting enzyme 2 precursorIPI00465187 92 kDa 11 16 20 30 4 5 13 25 5 0.0557 0.0847 0.2 0.4 ACO1 Cytoplasmic aconitate hydratase IPI00008485 98 kDa 2 2 0 0 0 0 2 0 0 - 0.0081 - 0.0