Human Cytidine Deaminase: Purification of Enzyme, Cloning, and Expression of Its Complementary DNA1

(CANCER RESEARCH54, 5401-5407, October 15, 19941 Human Cytidine Deaminase: Purification of Enzyme, Cloning, and Expression of Its Complementary DNA1

JosÃ©eLalibertÃ© and Richard L. Mompar1er@

DÃ©partementde Pharmacologic, UniversitÃ©de MontrÃ©aland Centre de Recherche PÃ©diatrique,HÃ´pital Ste-Justine, MontrÃ©al,QuÃ©becH3T 1C5, Canada

ABSTRACT enzyme have been detected at the time of relapse following therapy with these agents (13, 14). Cytidine (CR) deaminase was purified 47,000-fold to homogeneity from Treatment of myeloid cells with certain agents that induce differ human placenta. The molecular mass of CR deaminase was estimated to entiation of leukemic cells such as 5-AZA-CdR, vitamin D3, or be 48.7 kDa by gel filtration and 16.1 kDa by sodium dodecyl sulfate dimethyl sulfoxide produce an induction of CR deaminase activity polyacrylamide gel electrophoresis, suggesting that it contains three or four Identicalsubunits. We determined the amino acid sequence of several (15, 16, 17). However, the genetic alterations responsible for the peptide fragments and designed 5'-primers to amplify, by the polymerase induction of the CR deaminase activity are unknown. Mature human chain reaction, a SpeCifiC364-base pair DNA fragment using human liver granulocytes contain much higher levels of CR deaminase than leu complementary DNA (eDNA) as the template. This DNA fragment, which kemic myeloblasts (18). In order to investigate the genetic mecha contains the codons of one peptide, was used as a probe to screen a cDNA nisms that control the expression of CR deaminase, the gene for this library from human liver. We isolated and sequenced a cDNA clone of 910 enzyme should be isolated. base pairs that contained a 5' nontranslated region, a 438-base pair coding We purified the human CR deaminase from placenta and used the region, and a 3' nontranslated region with a polyadenylated tail. The amino acid sequence to design primers for PCR cloning using the translated region of the clone contained a deduced sequence of 146 amino 3'-RACE protocol (19). We isolated and sequenced a cDNA clone for acids, with a predicted molecular mass of 162 kDa and the sequences of CR deaminase from a human liver library. Expression of this cDNA our peptides. The cDNA was ligated in pGEX vector and expressed in Escherichia coli. The expressed protein had a high CR deaminase activity in Escherichia coli produced a protein with very high CR deaminase and molecular mass of 16.3 kDa. These data demonstrate clearly that the activity and molecular mass of predicted size. We have also localized open reading frame of our cDNA clone codes for a functional human CR the gene for human CR deaminase to chromosome 1 by PCR analysis deaminase. Polymerase chain reaction amplifications of gene-specific of DNA from human/rodent cells. DNA fragments from human/rodent hybrid cells indicate the localization of CR deaminase gene to human chromosome 1. The cDNA for CR deaminase will be a useful molecular probe to investigate the importance MATERIALS AND METHODS of this enzyme in chemotherapy. Materials. 5-[3H]CR and 5-AZA-CdR were obtained from Moravek Bio INTRODUCTION chemicals, Inc. and Mack Co., respectively. Taq DNA polymerase and buffer, restriction enzymes, and random primed labeling kit were obtained from CR3 deaminase (EC 3.5.4.5) catalyzes the deamination of CR or CdR Boehringer Mannheim. a-[32P]dCTP was obtained from ICN Canada. Mob to UR or UdR, respectively (1). This enzyme can also catalyze the ney murine leukemia virus reverse transcriptase was obtained from GIBCO/ deamination of cytosine nucleoside analogues used as antileukemic BRL. Oligonucleotides were synthesized at the Institut Armand-Frappier using drugs, such as ARA-C or 5-AZA-CdR (2â€”4).The deamination of Pharmacia Gene Assembler Plus instrument. The human liver cDNA library (ADR2) and human placenta and liver cDNA were obtained from Cbontech. ARA-C results in a significant loss of antineoplastic activity (5). The Molecular size markers (1000, 700, 500, 400, 300, 200, 100, and 50 base pairs) presence of high levels of CR deaminase in liver is responsible for the for PCR were obtained from Research Genetics. All other chemicals were short half-life of CdR analogues in humans (6, 7). Several specific ultrapure grade. inhibitors of CR deaminase have been synthesized, and the kinetics have Enzyme Assay. CR deaminase activity was determined by either radio been investigated using deoxycytidine analogues as the substrate (8, 9). chemical or spectrophotometric assay, as described previously with slight The CR deaminase inhibitor, THU. reduced the in vitro concentration of modifications (9, 15). For fractions IV to VII, the assay was performed in the ARA-C required to produce 50% growth inhibition of KB cells (10). presence of 1 mg/mI of BSA to stabilize the enzyme. The spectrophotometric Thu also increasedARA-CTPlevelsin leukemiccells from patients assay was performed in 50 mM Tris-HC1 (pH 7.4) and 100 @.tMCRwith diluted incubated in vitro with ARA-C (11). The CR deaminase inhibitors have enzyme. One unit of enzyme activity is defined as the amount of enzyme that the potential for clinical use since THU was shown to increase the catalyzes the deamination of 1 nmol cytidine/min at 37Â°Cunder the above conditions. concentration and half-life of ARA-C in patients with cancer (12). CR Deaminase Purification. All initialpurificationstepswere performed CR deaminase may also be implicated in drug resistance to deoxy at 4Â°C,unlessindicated otherwise. Human placenta (700 g) was homogenized cytidine analogues since leukemic cells with high levels of this in 20 mt@iTris-HC1 (pH 7.5), 5 mM KCI, and 1 mM DTF. Streptomycin sulfate and phenylmethylsulfonyl fluoride were added to the homogenate to a final Received 5/17/94; accepted 8/18/94. concentration of 0.5% and 0.5 mr@t,respectively, before centrifugation at The costs of publication of this article were defrayed in part by the payment of page 20,000 x g for 30 mm (fraction I). CR deaminase was precipitated by charges. This article must therefore be hereby marked advertisement in accordance with 18U.S.C.Section1734solelyto indicatethisfact. ammonium sulfate between 40 and 55% of saturation. The precipitate was 1 This work was supported by a grant from the Cancer Research Society. J. L was resuspended in 20 mM Tris-HC1 (pH 7.5), 5 mM DTF, and 1 mM phenylmeth supported by a studentship from the Medical Research Council of Canada. ylsulfonyl fluoride (fraction II). Aliquots (50 ml) of fraction II were incubated To whom requests for reprints should be addressed, at Centre de Recherche PÃ©di in a 75Â°Cwater bath for 12 mm and rapidly cooled. Supernatant was recovered atrique, HÃ´pitalSte-Justine, 3175 CÃ´teSte-Catherine, MontrÃ©al,QuÃ©becH3T1C5, Canada. after a centrifugation at 25,000 X g for 30 mist and concentrated (Amicon 3 The abbreviations used are: CR, cytidine; CdR, deoxycytidine; ARA-C, 1-@-o- Centriprep-30) to give fraction HI. Fractions III to VI were purified by column arabinofuranosylcytosine; 5-AZA-CdR, 5-aza-2'-deoxycytidine; UR, uridine; UdR, de chromatography using the fast protein liquid chromatography system (Phar oxyuridine; TI-lU, 3,4,5,6-tetrahydrouridine; PCR, polymerase chain reaction; RACE, macia) and performed at room temperature. Column chromatography consisted rapid amplification of cDNA ends; BSA, bovine serum albumin; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; SSC, standard saline citrate; GST, of Sephacryl S-200 gel filtration, PAE-1000 ion exchange, and Mono-Q ion glutathione-S-transferase; poly(A)@,polyadenylated; Dli', dithiothreitol; cDNA, comple exchange chromatography at pH 6.2 and 7.5 (Fig. 1). The final step used in mentary DNA. column chromatography yielded a single peak of CR deaminase activity to 5401

0 c'j

E D 0 @3. >@ .@2. 0

01.a

0. Fraction no. (0.5 ml) Fraction no. (0.5 ml) Fig. 1. Purification of CR deaminase by column chromatography. Fraction III was purified by gel filtration chromatography on Sephacryl 5-200 (a), fraction IV was purified by ion exchange chromatography on PAE-1000 (b), fractions V and VI were purified by ion exchange chromatography on Mono-Q pH 6.2 (c) and Mono-Q pH 7.5 (d), respectively. Column eluates were assayed for CR deaminase activity by spectrophotometricassay (0) and by absorbance at 280 nm (â€”). For ion exchange chromatography elution was performed with a gradient of KC1(---). CD. CR deaminase.

give fraction VII and a 47,000-fold purification (Fig. ld). Protein concentra oligodeoxythymidylic acid priming and Moboney murine leukemia virus re tion was determined by the method of Bradford (20). BSA was used as verse transcriptase. standard. The protein concentration for the pure enzyme (fraction VII) was cDNA Amplification. The PCR 5'-primers(P1 to P3) for CR deaminase estimated by silver staining (Bio-Rad Silver Stain Plus kit) after SDS-PAGE. were designed from the amino sequence of peptide E (Fig. 3) using optimum This estimation was performed by comparison with the staining of protein codon choice (23). The sequences ofthese primers were: P1, GGCACCAACT standards and the 16.1 kDa band from fraction VI. This estimation was GGCCFGTCTACATGAC(nucleotides451â€”476;Fig.5); P2, GTGTACAT subsequently confirmed by the amino acid composition analysis. GACAGAGCCTGATGG (nucleotides 466â€”488;Fig.5); and P3, GAGCCI' Molecular Mass Estimation. The molecular mass of the native CR deami GATGGCACCTACATFGTGATG(nucleotides 478-504, Fig. 5). The nase from fraction III was determined by gel filtration using the Sephacryl reaction mixture (50 s.d) contained 5 gxl of lOX PCR buffer, 200 giM of each 5-200 chromatography, as described above. A standard curve was established with deoxynucleotide triphosphate, 50 pmol of each primer, and 2 @xlofcDNA BSA(66 kDa), ovalbumin (45 kDa), lysozyme (14.4 kDa) and cytochrome C(12.4 from HL-60 cells or 50 pg of cDNA from human placenta or human kDa). The purity of the enzyme and the molecular mass of its subunits were liver. Amplification, using oligo(dT)19 containing a XbaI linker (5'- determined by SDS-PAGE as described by Laemmli (21) using 12 or 15% GC'FCrAGAGC(F)1@,A-3')as3'-primer, was initiated after a hot start by the acrylamide and the Mini Protean H apparatus (Bio-Rad; gel size, 7 x 8 x 0.75 cm). addition of 1.25 units of Taq DNA polymerase to the reaction mixture. Markers were GIBCO low molecular mass and Rainbow standards markers Amplification consisted of 20â€”35cyclesusing the following protocol: dena (Amersham). Proteins were stained with Coomassie blue or silver. turation for 30 s at 95Â°C, annealing for 30 s at 42Â°C or 45Â°C, elongation for 1 Amino Acid Composition and Peptide Sequencing. Fraction VII (250 mm at 72Â°C,anda fmal incubation for 7 min at 72Â°C.PCRamplification using pmol) was diluted and concentrated several times in 20 mM KHPO4-20 mM the sense primer (P4) and antisense primer (PS) with exact sequence for the KC1using Centrifree to exchange the buffer. The amino acid composition was human CR deaminase (Fig. 5) was performed at an annealing temperature of determined using an Alpha Plus amino acid analyzer. For determination of the 58Â°C.Amplifiedproducts were separated electrophoretically on 2% agarose cysteine content, the protein was oxidized with performic acid. Peptides were gels containing ethidium bromide. generated by Cbostripain digestion or by mild acid cleavage and were either DNA Sequencing. The PCRproductwas purifiedusing MagicPCRPreps directly purified or reduced and alkylated before purification by reverse phase DNA PurificationSystem(Promega),followinganagarosegel electrophoresis, high performance liquid chromatography (Applied Biosystems; 130A separa and cloned in pCRII plasmid using the TA Cloning kit (Invitrogen). The insert tion system) using a Brownlee C8-RP300, 7 j.@mcolumn (2.1 x 30 mm) with was sequenced using Sequenase 2.0 kit (USB). pDR2â€”1was sequenced in both a linear gradient of 0â€”70% acetonitrile in 0.085% trifluoroacetic acid. The orientation by the chain termination method using fluoro-dATP and a Phar purified peptides were submitted to automated Edman degradation in a Porton macia A.L.F. automatic sequencer. Protein/Peptide MicroSequencer. Some peptides were cleaved with cyanogen Synthesis ofDNA Probe and Screening cDNA Library. The DNA insert bromide prior to sequencing. from pCRII plasmid containing the partial sequence for CR deaminase cDNA cDNA Synthesis. HL-60 humanmyeboidleukemiccells were treatedwith was used to design the exact sequence 5'- and 3'-primers (P4 and P5; Fig. 5). 5-AZA-CdR (1 p.M for 72 h), and total RNA was isolated by the method of These primers were used with human liver cDNA to amplify a specific DNA Chomczynski and Sacchi (22) using a kit from Promega. The 5-AZA-CdR probe, which was radiolabeled using random oligonucleotide priming (24). treatment produced induction of CR deaminase activity in these leukemic cells The radioactive probe was purified through a 0-50 Sephadex spin column (15). cDNA synthesis(1 h at42Â°C)wasperformedon2 @.tgoftotalRNAusing (Boehringer Mannheim). 5402

cDNA CLONINGAND EXPRESSIONOF HUMAN CR DEAMINASE

4theA humanliver cDNA libraryin ADR2phage(Clontech)was screenedwith1 2 3 filtersr(Hybond-N;radiolabeled DNA probe. Plaques (1 X 106)were blotted on Nylon Amersham). The filters were prehybridized in 6X SSC, 2X @@ Denhart's solution, and 1% SDS at 68Â°Cfor2 h. The denatured 32P-labeled @ probe was added to the hybridization solution to give 2 X 106 cpm/ml. The â€˜ 43@ .@â€˜ hybridization was performed overnight at 68Â°C.Thefilters were washed once at room temperature for 15 mm with 2X SSC/0.1% SDS and then twice with 0.2X SSC/0.1% SDS at 58Â°Cfor 15 mm. The filters were wrapped and 29â€” exposed to Fuji X-ray films with intensifying screen at â€”70Â°C.Onepositive @ clone was isolated and converted to pDR2 plasmid using the method of â€˜ ,. @ @to â€¢@ . jjl@ $@@* Clontech. The DNA insert was sequenced and digested with XbaI and BamHIkDa determine its length by agarose gel electrophoresis. @ Expression of CR Deaminase in E. coli Using pGEX. The coding region 1__ i@i@i@ (nucleotides@PCR 124â€”561; Fig. 5) of the CR deaminase cDNA was amplified by18.4.___.... 14.3...... sites(ACGGGATCCATGGCCCAGAAGCGTCCFG)technique using a 5'-primer (P6) containing BamHl restriction a6.2@XhoI and a 3'-primer (P7) with DNAwassite (CCGCfCGAGTCAC1@GAGTmCTGCAG). The amplified intoDH5asubcboned into vector pGEX-4T-1 (Pharmacia) and transformed control3.0â€”.-â€”forcompetent E. coli. The pGEX-4T-1 vector alone was used as a inducedwithGST production. The fusion protein (GST-CR deaminase) was affinitychromatographyisopropyl43-D-thiogalactoside and purified using glutathione CRExpressed column from the GST Purification Module (Pharmacia).Fig. 2. SDS-PAGE analysis of fractions at different stages of purification of proteins were analyzed on SDS-PAGE.deaminase. Electrophoresis was performed on a SDS 15% polyacrylamide gel as de Chromosomal Localization. Genomic DNA from 24 human/rodent cell in â€œMaterialsand Methods.â€•Samples are: Sephacryl S-200, 0.3 @xgfraction IV @ lines (Conch; mapping panel no. 2) and from human, mouse, and hamster cell 1); PAE-1000, 0.3 g.@gfraction V (Lane 2); Mono-Q pH 6.2, 0.3 @xgfraction VI (lime 3); and Mono-Q pH 7.5, 0.2 pg fraction VII (Lane 4). Proteins were visualized by band.reactionlines was screened for the presence of CR deaminase gene using PCR. Theu@ silver staining. Arrow, CR deaminase primerAATGCCCACrGCCTGTAACAGCCACmixture (50 ,.d) contained 150 ng DNA, 0.2 @.&Mofsense andantisense (nucleotides 574-598; Fig. 5), by3'-nontranslatedprimer PS (nucleotides 842â€”865; Fig. 5) of CR deaminase cDNAdeaminase from fraction VII was found to be homogeneous, shown region, PCR reaction mixture, and 1.25 units of Taq DNA single band at 16.1 kDa after SDS-PAGE (Fig. 2, Lane 4). polymerase (Promega). The first three cycles consisted of denaturation at 95Â°C CR deumin@ was purified 46,800-fold with a recovery of 14% for 2 mm, annealing at 60Â°Cfor1 min, and extension at 72Â°Cfor1 mm. This enzyme activity. The presence of D'VF was required to stabilize the was followed by 27 cycles of 95Â°Cfor 1 min, 60Â°Cfor 1 min, and 72Â°Cfor 1 mm. The reaction products were analyzed on 2% agarose gel and stained enzyme during purification. The final specific activity of the pure with ethidium bromide. Based on the primers chosen for PCR, the predicted enzyme was about 150,000 units/mg. size of amplified DNA was 292 base pairs (nucleotides 574â€”865; Fig. 5).a Mo1ecU1IWMass Characterization of CR Deaminase. The mo wastissuesNorthern Blotting. Northern blot of poly(A)@ RNA from different humanlecular mass of the native protein as estimated by gel filtration suggestednase.(Cbontech) was hybridized with the cDNA for human liver CR deami 48.7 kDa. The single 16.1 kDa-band from the SDS-PAGE identicalofThe cDNA was radiolabeled using a reaction mixture containing 20 pmolthat the enzyme is composed of three or four apparently antisenseprimerC1'CFGGCFGTCACFGGGTCTTCTG(nucleotides550â€” If the native protein is spherical in shape, the true molecular 573; Fig. 5), denatured 2.4 @gpBluescript containing CR deaminase cDNA, size may be greater than 48.7 kDa. SDS-PAGE analysis performed in dATP, d'fl'P, dGTP, and a-[32P]dCFP, and 2.5 units Klenow DNA polymer the presence or in the absence of @3-mercaptoethanolproducedsimilar am. The mixture was incubated at 37Â°Cfor 60 mm, and the radioactive DNA patterns, suggesting that there were no disulfide bonds between the was isolated as described above. Hybridization was performed at 68Â°Cin ExpressHyb solution (Cbontech)overnight. After washing the membrane in 2X subunits. SSC/0.1% SDS at room temperatureand 1X SSC/0.1% SDS at 50Â°C,the Amino Acid Composition and Sequencing. The amino acid com membrane was exposed to X-ray film for 72 h.subunits. position of CR deaminase is shown in Table 2. There was good theRESULTSchemical agreement with the number of amino acid residues obtained from analysis of the composition and the deduced amino acid whichPurification sequence, as predicted by the nucleotide sequence of the cDNA 3).the of CR Deaminase. Table 1 summarizes the results ofcontained codons for 146 amino acids (Fig. theheatpurification of the CR deaminase from the human placenta. TheSince the amino terminus of CR deaminase was blocked, theremovedtreatment step was very effective, since 96% of the proteins wereprotein was fragmented by enzymatic or chemical methods, and liquidto with only a loss of 20% of the enzyme activity. Subsequentpeptides were isolated by reverse phase high performance the four different types of column chromatography (Fig. 1), CRchromatography. Fig. 3 shows the amino acid sequences of the major

placentd'TotalTotalSpecificActivityproteinactivityactivityPurificationrecoveryFractionStep(mg)(units)(units/mg)(fold)(%)IHomogenateTable1Purificationof CR deaninase from human

sulfate27,50092,6203.41100IIAmmoniumandStreptomycin 40â€”55%267080,66030987IIIHeatsulfate treatment9565,50069020371IVSephacryl 5-2002055,3002,76081060VPAE-10001.423,50016,8004,94025VIMono-Q

6.20.2319,0008260024,30020.5VIIpH pH 7.5

a For experimentMono-Qal details, see â€œMaterialsandMethods.â€•0.0812,700159,00046,80013.7 5403

Table 2 Amino acid composition of human placental CR deaminase CR deaminase. A few disagreements were found mostly at the posi Amino Residues Predicted values tions of the cysteine (C) and the lysine (K) residues. acid per subunitâ€• from cDNA library PCR Amplification of a Nucleic Sequence Specific to the Hu Ala 12.8 14 man CR Deaminase. The amino acid sequence of peptide E (Fig. 3) Mg 5.5 6 Asp+Asn 9.5 9 was used to design nested primers for PCR amplification of specific Cys 112b 9 sequences of CR deaminase using the method of Lathe (23) for the Glu + GIn 21.5 20 selection of the optimal codons. The 5'-primers P1, P2, and P3 were Gly 7.7 9 His 1.4 1 used in combination with the oligo(dT')19 3'-primer, according to a Ile 7.4 8 modified 3'-RACE protocol (19). We used DNA template from hu Leu 9.1 9 Lys 8.6 9 man placenta or liver. In addition, we used cDNA isolated from Met 3.7 5 human HL-60 leukemic cells after treatment with 5-AZA-CdR, an Phe 5.6 7 agent which induces CR deaminase in these cells (15). Pro 9.6 10 Ser 6.6c 8 The first PCR amplification using primers P1 and oligo(dT)19 did Thr 75C 8 not produce specific DNA bands (Fig. 4, A-C). An aliquot of this Tip 0.92(SET) Tyr 5.8 6 reaction mixture was used in a second PCR amplification with nested Val 11.0 7 primer P2 and oligo(dT)19 and produced a DNA product of about 16.1 kDa 16.2 kDa 470 base pairs in each group. A third PCR was performed using an 145.4as 146 as aliquot of the reaction mixture from the second amplification with a All calculations based on a molecular maas of 16.1 kDa. bDeterminedascysteicacidafterperformicacidoxidation. the nested primer P3 and oligo(dT)19 and showed specific DNA C Values were extrapolated to zero time of hydrolysis. product of about 460 base pairs. The difference in size of the amplified DNA, 10 base pairs, was predicted by the position of the PeptideA codons for these primers in peptide E. HL-60 cells that were not MAQK1IE'ACTL @PECV00LLVCSQEAKKSAY t1'YSHFPVG)J 43 treated with 5-AZA-CdR did not show a specific DNA band after SKS X IES X C C P the third PCR. The 470 base pairs PCR product obtained with primer P2, PeptideB PeptideC TQBG1UF@GCNIENACYPUG ICAB1IrAIQE AVSEGYKDFBJ 83 oligo(dT)19, and cDNA from HL-60 cells (Fig. 4C) was purified Is S CC CC and cloned in pCRII plasmid. The DNA insert was partially Se quenced from the 5 â€˜-endand contained the codons for peptide E, @pfld@eD ____Peptide E 123 additional codons for amino acids up to the stop codon, and a 3'-nontranslated sequence (nucleotides 489â€”600; Fig. 5). The par tial sequence obtained from the 3'-end contained part of the YIVMTVQELL PSSP@*'EDLQ RTQ 146 3'-nontranslated region and the poly(A)@ tail (nucleotides 827â€” x 916; Fig. 5). These data indicated that Peptide E was at the Fig. 3. Deduced amino acid sequence of cDNA clone pDR2â€”1forhuman liver CR deaminase. The open reading frame of pDR2â€”1cDNAencodes for an 146-amino acid COOH-terminal end of CR deaminase. The DNA sequence of the protein. In boxes, determined amino acid sequence of purified peptide fragments from insert was used to design 5' and 3'-primers (P4 and PS) with the human placenta CR deaminase. Letters under boxes, amino acids in disagreement with exact nucleotide sequence (Fig. 5). These primers were used to deduced sequence or due to weak signals during experimental analysis. X, unknown residue. amplify by PCR a specific DNA probe (364 base pairs) from liver cDNA. Isolation of a Human Cytidine Deaminase cDNA Clone. The peptide peaks obtained by the Edman degradation. The five peptide DNA probe obtained with primers P4 and PS was used to screen a fragments from the purified protein were found to be present in the human liver cDNA library in ADR2 for CR deaminase. One positive deduced amino acid sequence of the cDNA clone for the human liver clone was detected by hybridization after screening more than 106

A B C

Fig. 4. Analysis of PCR products from 3'- RACE protocol by agarose gel electrophoresis. 700 k@ Sense nested primers P1, P2, and P3 designed from the codons of peptide E were used for the first, second, and third PCR, respectively, in combina 500 tion with antisense oligo(dT). The template for the I @-â€˜ first PCR was cDNA from liver (A), placenta (B), and HL-60 cells treated with 5-AZA-CdR (C). 300 Aliquots from first and second PCR were used as templates for second and third PCR, respectively. M, DNA size markers. 100

5404

60 I 2 3 gccccagccaggctggccggagctcctgtttccgctgctctgctgcctgcccggggtacc 120 kDa aacATGGCCCAGAAGCGTCCTGCCTGCACCCTG1@AGCCTGAGTGTGTCCAGCAGCTGCTG 180 MAQ K K P ACT L K P ECVQQ LL 19 â€”@46 GTTTGCTCCCAGGAGGCCAAGAAGTCAGCCTACTGCCCCTACAGTCACTTTCCTGTGGGG 240 vC SQEAKKSAYC PYSH F PVG 39 GST-CD @â€˜ GCTGCCCTGCTCACCCAGGAGGGGAGAATCTTCAAAGGGTGCAACATAGAAAATGCCTGC 300 AALLTQEGRIFKGCNIKNAC 59

TACCCGCTGGGCATCTGTGCTGAACGGACCGCTATCCAG&AGGCCGTCTCAGM@GGGTAC 360 Y P L G I C A E R 1' A I Q K A V S E G 79 â€” 30 AGGATTTCAGGGCAAT'FGCTATCGCCAGTGACATGCAAGATGATrFTATCTCTCCATGT 420 @, KDFRAIAIASDM0DDFISPC 99 GST >1

GGGGCCTGCAGGCAAGTCATGAGAGAGTTTGGCACCAACTGGCCCGTGTACATGACCAAG 480 TJ G AC R Q VM R E F G T NW PV Y M T K 119

CCGGATGGTACGTATATTGTCATGACGGTCCAGGAGCTGCTGCCCTCCTCCTTTGGGCCT 540 @ P D 0 T Y I V H T V 0 E L L P S S F G P 139 21.5

GAGGACCTGCAGAAGACTCAGTGAcagccagagaat qcccactgcctgtaacagccacct 600 E D L Q K T 0 smr 146 @T@:j@: @@ 660 CD @ ggagaacttcataaagatgtctcacagccctggggncacctgcccagtggccCCagccta . ..@ @@@@ cagggactgggcaaagatgatgtttccagattacactccagcctgagtcagcacccctcc 720 -. . 14.3

7 80 ______840 aggttctatcctgttccgagcaacttttctaattataaacatcacagaacatcctggaaa 900 Fig. 6. Analysis by SDS-PAGE of expression of CR deaminase in E. coli using pGEX-4T-1 vector. The coding region for CR deaminase from pDR2-1 was ligated in aaaaaaaaaaaaaaaaTCTAGA 922 pGEX-4T-1. After transformation, the GST-CR deaminase fusion protein was induced in E. coli with isopropyl-1-thio-@-o-galactopyranoside. The proteins were purified from Fig. 5. Nucleic acid and deduced protein sequence of human liver CR deaminase. bacterial extracts by glutathione affinity chromatography. Analysis was performed on Nucleotide sequence of pDR2â€”1(upper line) and deduced 146 amino acid sequence 12% polyacrylamide gel. Pattern from 5 @.tgproteinshowing 27 kDa OST band from (lower line). Nucleotides in the open reading frame are capitalized. The 5'-terminal pGEX-4T-1 containing no insert (Lane 1). Pauern from 5 @gproteinof pGEX-4T-1 BamHI site and 3'-terminal XbaI site of pDR2â€”1are in italic letters. The DNA probe to containing insert and showing 42.4 kDa GST-CR deaminase fusion protein (Lane 2). screen the cDNA library was synthesized by PCR using sense P4 primer (nucleotides Pattern after cleavage of 5 pg fusion protein with thrombin and showing 16.3 kDa CR 502â€”523)and antisense primer PS (nucleotides 842-865) with human liver cDNA. deaminase (Lane 3). Proteins were stained with Coomassie Blue. CD, CR deaminase. Codons for peptide E are in position 108â€”138(nucleotides445â€”537).

Chromosomal Localization of Human CR Deaminase. Genomic plaques. After conversion of the clone to a plasmid (jDR2â€”1), the DNA from human, mouse, and hamster cell lines and from human/ insert size was estimated to be approximately 950 base pairs and was rodent hybrid cell lines was screened for the presence of the CR sequenced in both orientations (Fig. 5). The 910-base pair clone deaminase gene by PCR. A single DNA band of 292 base pairs as contained a 117-base pair 5'-nontranslated sequence, an open reading predicted by the location of the primers in the 3'-nontranslated region frame of 438 base pairs, and a 336-base pair 3'-nontranslated region of CR deaminase cDNA (Fig. 5) was detected in the human cell line ending with a poly(A)@ tail.4 The translated region coded 146 amino and in rodent/human hybrid cell line GM/NA07299 (Fig. 7). This acids, predicting a molecular mass of 16.2 kDa, which is almost rodent/human cell line contains human chromosomes 1 and X. No identical to the molecular mass of CR deaminase that we isolated from bands were detected in the mouse and hamster cell lines and in human placenta (16.1 kDa; Fig. 2). The codons for all the peptide rodent/human hybrid cell lines that do not contain human chromo fragments that we sequenced (Fig. 3) were present in the coding some 1. The CR deaminase gene, therefore, appears to be localized on region (Fig. 5). In addition, the DNA sequence of the coding region human chromosome 1. This assignment was confirmed with a second predicted the codons for the amino acids present in peptide fragments human chromosome mapping panel (Bios Laboratories) using the which were not sequenced. PCR method.5 Expression of CR Deaminase in E. coli Using pGEX Vector. Expression of CR Deaminase in Human Tissues. A Northern The cDNA of the clone pDR2â€”1was ligated into pGEX-4T, a plasmid blot of poly(A)@ RNA from different human tissues when hybridized used for expression of GST fusion proteins in E. coli. After 3 h of with radiolabeled CR deaminase cDNA showed a single band at about isopropyl-@-D-thiogalactoside induction of transformed bacteria, a 1 kilobase for both placenta and liver (Fig. 8). The mRNA species significant increase in a 42.4 kDa protein (GST-CR deaminase) was detected are similar in size to the cDNA of CR deaminase (Fig. 5). observed by SDS-PAGE analysis (Fig. 6, Lane 2). pGEX-4T-1 con Human liver was reported to contain high levels of CR deaminase trol produced a large amount of 27.5 kDa GST (Fig. 6, Lane 1). The activity (3). We choose human placenta to purify CR deaminase, since fusion protein was purified by affinity chromatography using gluta it contained significant levels of this enzyme. We did not detect the thione-affinity chromatography. The eluate from pGEX-4T-1 control presence of mRNA for CR deaminase in heart, brain, and muscle, showed only basal CR deaminase activity (1.6 units/mg). The bacteria which correlated with the very low activity of this enzyme in these transformed with pGEX-4T-1 containing the CR deaminase cDNA tissues as reported by Ho (3). insert possessed a marked increase in CR deaminase activity (1950 units/mg), an induction of 1200-fold. Following the cleavage of the DISCUSSION fusion protein by its thrombin recognition site and removal of the GST, the expressed CR deaminase showed an increase in specific CR deaminase catalyzes the deamination of cytosine nucleosides activity of 72-fold (141,360 units/mg) and had a molecular mass of and their respective analogues. This enzyme plays a major role in the 16.3 kDa as estimated by SDS-PAGE (Fig. 6, Lane 3). metabolism of cytosine nucleoside analogues used in the therapy of leukemia since their deamination results in a loss of activity (2, 4, 5).

4 The nucleotide sequence reported in this paper has been submitted to the GenBank with accession number L27943. 5 i. Lalibert@ and R. L Momparler, unpublished data. 5405

cDNA CLONING AND EXPRESSION OF HUMAN CR DEAMINASE

@ z 0@EE 0 0 @ @c E ,- cii

Fig. 7. Assignment of human CR deaminase gene to chromosome 1. Genomic DNA from hu man, mouse, and hamster cell lines and rodent/ .4â€”292bp human hybrid cell lines was screened by PCR for thepresenceofCRdeaminasegeneusingspecific p@. â€˜..â€˜ primers to amplify a 292-base pair fragment from the 3'-nontranslated region of its cDNA. The prod ucts of the reaction were subjected to agarose gel i:: electrophoresis and stained with ethidium bromide. DNAfromcelllinesandfromrodent/humanhybrid cii c@@u CD Fâ€•@ @@ cell lines are presented with their assigned human ,- I- @- I- 1- chromosome. M, DNA size markers; numbers and letters, specific human chromosomes. Cell hybrid lx contains both chromosomes 1 and X. 1000 500 300 200 100 @â€˜@.1,$

Steuart and Burke (13) demonstrated that leukemic cells from patients mRNA for this enzyme may be a useful tool to evaluate the response that responded to ARA-C therapy contained six times less CR deami in leukemic patients to cytosine analogues. nase than found in leukemic cells from nonresponders. These results We have purified 47,000-fold the human CR deaminase from suggest that drug resistance to ARA-C in some patients may be related placenta (Table 1; Fig. 1). SDS-PAGE analysis of the enzyme after to the activity of CR deaminase. Our laboratory observed that in a the final step of purification showed that it was homogeneous and had patient with acute myeloid leukemia that relapsed after therapy with a molecular mass of 16.1 kDa (Fig. 2). Since gel filtration of the ARA-C, following treatment with 5-AZA-CdR there was a 9-fold placenta enzyme showed a molecular mass of 48.7 kDa, the enzyme increase in CR deaminase in the leukemic cells as compared to the is composed of three or four identical subunits. Molecular masses of analysis before therapy (14). The level of the CR deaminase in 51 kDa and 49 kDa, estimated by gel ifitration, were reported for CR leukemic cells before treatment may be one of the parameters that deaminase from human granulocytes and from human acute myelo determines the response to the therapy. In order to understand the blastic leukemia cells, respectively (10, 18). Cacciamani et a!. (25) genetic mechanisms that control the expression of CR deaminase, we also purified the human CR deaminase from human placenta and have cloned its cDNA. In addition, a method for detection of the reported a molecular mass of 52 kDa. However, the amino acid composition of their enzyme is different from our values obtained by chemical analysis and from the codons of our cDNA sequence. These differences could be due to a genetic variant form of the enzyme or due to the presence of trace proteins in their enzyme preparation. We used a modified 3'-RACE protocol of Frohman (19) to isolate the cDNA for the human CR deaminase. The amino acid sequence of peptide E from the enzyme was used to design 5'-oligonucleotide primers by selection of the preferred codons as described by Lathe (23). Using cDNA from human liver, placenta, and HL-60 leukemic cells (treated with 5-AZA-CdR to induce CR deaminase) and a series 2.4-: of nested 5'-primers, we amplified a DNA band of identical size for the three cell types, indicating specificity of the PCR. Determination of the sequence of this DNA showed that it contained the codons of peptide 1.35 - E from CR deaminase and additional sequence data This correct nude otide sequence was used to design specific primers for PCR amplification using human liver cDNA as the template of a specific DNA probe (364 Fig. 8. Hybridization of CR deaminase cDNA to a Northern blot of poly(A)@ RNA from different human tissues. Northern blot containing 2 @.tgofeach poly(A)@ RNA from base pairs) to be used to screen a cDNA hlrary. different human tissues on charge-modified nylon membrane (Clontech) was hybridized Over 106 plaque-forming units from human liver ADR2 cDNA with 32P-labeled CR deazninase cDNA prepared as described under â€œMaterialsand Methods.â€•Themolecular size markers (M) in kb are indicated on the left and the specific library were screened with the specific 364 base pair DNA probe to human tissue on the top. obtain one positive clone, pDR2â€”1. We obtained the DNA sequence 5406

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 1994 American Association for Cancer Research. cDNA CLONING AND EXPRESSION OF HUMAN CR DEAMINASE of the clone and demonstrated that it contained a 5 â€˜-nontranslated 2. Camiener, G. W. Studies of the enzymatic deamination of cytosine arabinoside. II. region, an open reading frame of 438 base pair with an initiation Met, Properties of the deaminase of human liver. Biochem. Pharmacol., 16: 1681â€”1689, 1967. and 3'-nontranslated region (Fig. 5). In the 5'-region, two Met codons 3. Ho, D. H. W. Distribution of kinase and deaminase of 1-@-D-arabinofuranosyky at positions 23 and 124 can serve as the initiation codon. The first Met tosine in tissues of man and mouse. Cancer Res., 33: 2816-2820, 1973. will translate a short peptide of 43 amino acids, and the corresponding 4. Chabot, G. 0., Bouchard, J., and Momparler, R. L. Kinetics of deamination of 5-aza-2'-deoxycytidine and cytosine arabinoside by human liver cytidine deaminase sequence does not agree with the peptide sequence from the protein. and its inhibition by 3-deazauridine, thymidine or uracil arabinoside. Biochem. The second Met has a consensus sequence for initiation proposed by Pharmacol.,32:1327â€”1328,1983. Kozak (26) and the deduced sequence of 146 amino acids predicted a 5. Muller, W. E. G., and Zahn, R. K. Metabolism of 1-@-o-arabinofuranosyluracilin mouse L5178Y cells. Cancer Res., 39: 1102â€”1107,1979. molecular mass of 16.2 kDa, which agrees with the mass of the 6. Ho, D. H. W., and Frei, E., III. aimcal pharmacology of 1-@-r-arabinofuranosyl subunit of the purified protein (Fig. 2, Lane 4). In the deduced cytosine. Clin. Pharmacol. Ther., 12: 944â€”954,1972. 146-amino acid sequence of the CR deaminase cDNA, we identified 7. Momparler, R. L., Labitan, A., and Rossi, M. Enzymatic estimation and metabolism all of the peptide fragments in which we determined the amino acid of 1-13-D-arabinofuranosylcytosine in man. Cancer Res., 32: 408â€”412, 1972. 8. Liu, P. 5., Marquez, V. E., Driscoll, J. S., and Fuller, R. W. Cyclic urea nucleosides: sequences (Figs. 3 and 5). PCR amplification of human genomic DNA cytidine deaminase activity as a function of aglycon ring size. J. Med. Chem., 24: and DNA from human/rodent hybrid cells produced a 292-base pair 662â€”666,1981. fragment as predicted by the primers in the 3'-nontranslated region of 9. LalibertÃ©,J.,Marquez, V. E., and Momparler, R. L Potent inhibitors for the deami nation of cytosine arabinoside and 5-aza-2'-deoxycytidine by human deaminase. our cDNA clone and showed the localization of the CR deaminase on Cancer Chemother. Pharmacol., 30: 7â€”11,1992. chromosome 1 (Fig. 7). Northern blot analysis of CR deaminase in 10. Cheng, Y-C., Tan, R-S., Ruth, J. L., and Dutschman, G. Cytotoxicity of 2'-fiuoro human tissues showed expression of its mRNA in liver and placenta, 5-iodo-1-f3-o-arabinofuranosylcytosineandits relationshiptodeoxycytidinedeami organs that contain significant levels of this enzyme, and a molecular nase. Biochem. Pharmacol., 32: 726â€”729,1983. 11. Chou, T-C., Arlin, Z., Clarkson, B. D., and Philips, F. S. Metabolism of 1-@-D- size similar to our cDNA (Fig. 8). arabinofuranosylcytosine in human leukemic cells. Cancer Res., 37: 3561-3570, By screening a subtractive library, Kuhn et a!. (27) isolated an 1977. incomplete cDNA sequence for CR deaminase from U937 monocy 12. Kreis, W., Chan, K, Budman, D. R., et aL Effect of tetrahydrouridine on the clinical pharmacology of 1-@-i-arabinofuranosylcytosinewhen both drugs are coinfused over toid leukemic cells. However, they are missing the 120 base pairs three hours. Cancer Res., 48: 1337â€”1342,1988. from the 5'-nontranslated region and the initial methionine of our 13. Steuart, C. D., and Burke, P. J. Cytidine deaminase and the development of resistance protein sequence (nucleotides 7â€”126;Fig. 5). In addition, part of the to arabinosyl cytosine. Nature New Biol., 233: 109â€”110,1971. 3'-nontranslated including the poly(A)@ tail (nucleotides 862â€”916) 14. Onetto, N., Momparler, R. L, Momparler, L. F., and Gyger, M. In vitro biochemical tests to evaluate the response to therapy of acute leukemia with cytosine arabinoside were also absent in the U937 cDNA sequence. The homology of the or 5-aza-2'-deoxycytidine. Semin. Oncol., 14: 231â€”237,1987. coding region of their cDNA and their deduced amino acid sequence 15. Momparler, R. L, and LalibertÃ©,J.Induction ofcytidine deaminasein HL-60 myeloid was 99% identical to our sequences. leukemic cells by 5-aza-2'-deoxycytidine. Leuk. Res., 14: 751â€”754,1990. 16. Mejer, J., and Mortensen, B. T. Changes in the activities of cytidine deaminase during The liver cDNA when cloned in pGEX expression vector produced, differentiation of HL-60 cells induced by 1,25-dihydroxy-D3. Leuk. Res., 12: after thrombin cleavage, a protein with a molecular mass of 16.3 kDa, 405â€”409,1988. which is almost identical as deduced from the coding region and from 17. Chiba, P., Tihan, T., Eher, R., KÃ¶ller,U., Wallner, C., Gobl, R., and Linkesch, W. Changes in the activities of cytidine deaminase during differentiation of HL-60 cells the subunit of the purified protein (Fig. 2, Lane 4; Fig. 6, Lane 3). In induced by 1,25-dihydroxy-D3. Br. J. Haematol., 71: 451â€”455,1989. addition, the 16.3 kDa protein had a high specific activity, similar to 18. Chabner, B. A., Johns, D. 0., Coleman, C. N., Drake, J. C., and Evans, W. H. homogeneous enzyme from placenta (Table 1, fraction VII). This Purification and properties of cytidine deaminase from normal and leukemic granu expression system in pGEX vector can be used to produce large locytes. J. Clin. Invest., 53: 922â€”931,1974. 19. Frohman,M.A., Dush,M. K, and Marie,G. R. Rapidproductionof full length amounts of the pure CR deaminase protein for antibody production. cDNAs from rare transcripts: amplification using a single gene-specific oligonucleo The purification of the pure enzyme from tissues gives a yield that is tide primer. Proc. Nail. Acad. Sci. USA, 85: 8998â€”9002,1988. too low. The antibodies can be used as a diagnostic tool to detect the 20. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities protein utilizing the principle of protein-dye binding. Anal. Biochem., 72: presence of CR deaminase in cells from patients. 248â€”254,1976. The cloning of the cDNA for the human CR deaminase will provide 21. Laemmli, U. K. Cleavage of structural proteins during the assembly of the head the molecular probes to investigate the importance of this enzyme in bacteriophage T4. Nature (Land.), 277: 680â€”685,1970. 22. Chomczynski, P., and Sacchi, N. Single-step method of RNA isolation by acid the therapy of leukemia with cytosine nucleoside analogues. Prelim guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem., 162: mary data indicate that there are differences in the rate of deamination 156â€”159,1987. of ARA-C in patients with leukemia (28). 23. Lathe, R. Synthetic oligonucleotide probes deduced from amino acid sequence data: theoretical and practical consideration. J. Mol. Biol., 183: 1â€”12,1985. 24. Feinberg, A. P., and Vogelstein, B. A technique for radiolabeling DNA restriction ACKNOWLEDGMENTS endonuclease fragments to high specific activity. Anal. Biochem., 132: 6â€”13, 1983. 25. Cacciamani, T., Vita, A., Cristalli, G., Vincenzetti, S., Natalini, P., Ruggieri, S., We thankDr. A. W. Bell of McGill University (Sheldon Biotechnology Amici, A., and Magni, 0. Purification of human cytidine deaminase: molecular and Center) for his valuable assistance in amino acid composition and sequencing. enzymatic characterization and inhibition by synthetic pyrimidine analogs. Arch. We thank Dr. Grant A. Mitchell, Marie-France Robert, and Dr. Shupei Wang Biochem. Biophys., 290: 285-292, 1991. for helpful comments on cDNA cloning; and Nicoletta Eliopoulos, ChristÃªledu 26. Kozak, M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger Souich, and Louise F. Momparler for technical assistance. RNAs. Nucleic Acids Res., 15: 8125â€”8148,1987. 27. Kuhn, K., Bertling, W. M., and Emmrich, F. Cloning ofa functional cDNA for human cytidine deaminase (CDD) and its use as a marker of monocyte/ macrophage differ REFERENCES entiation. Biochem. Biophys. Res. Commun., 190: 1â€”7,1993. 28. Kreis, W., Lesser, M., Budman, D. R., Arlin, Z., DeAngelis, L, Baskind, P., Felmand, 1. Camiener,G.W.,andSmith,C.G.Studiesoftheenzymaticdeaminationofcytosine E.J.,andAkerman,S.Phenotypicanalysisof1-@-i>.arabinofuranosylcytosinedeami arabinoside. I. Enzyme distribution and species specificity. Biochem. Pharmacol., 14: nation in patients treated with high doses and correlation with response. Cancer 1405â€”1416,1965. Chemother. Pharmacol., 30: 126â€”130,1992.

5407

Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 1994 American Association for Cancer Research. Human Cytidine Deaminase: Purification of Enzyme, Cloning, and Expression of Its Complementary DNA

Josée Laliberté and Richard L. Momparler

Cancer Res 1994;54:5401-5407.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/54/20/5401

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/54/20/5401. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.