Low Expression of Citron Kinase Is Associated with Poor Patient Outcomes in Hepatocellular Carcinoma
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics
bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. -
Genome-Wide Association Study to Identify Genomic Regions And
www.nature.com/scientificreports OPEN Genome‑wide association study to identify genomic regions and positional candidate genes associated with male fertility in beef cattle H. Sweett1, P. A. S. Fonseca1, A. Suárez‑Vega1, A. Livernois1,2, F. Miglior1 & A. Cánovas1* Fertility plays a key role in the success of calf production, but there is evidence that reproductive efciency in beef cattle has decreased during the past half‑century worldwide. Therefore, identifying animals with superior fertility could signifcantly impact cow‑calf production efciency. The objective of this research was to identify candidate regions afecting bull fertility in beef cattle and positional candidate genes annotated within these regions. A GWAS using a weighted single‑step genomic BLUP approach was performed on 265 crossbred beef bulls to identify markers associated with scrotal circumference (SC) and sperm motility (SM). Eight windows containing 32 positional candidate genes and fve windows containing 28 positional candidate genes explained more than 1% of the genetic variance for SC and SM, respectively. These windows were selected to perform gene annotation, QTL enrichment, and functional analyses. Functional candidate gene prioritization analysis revealed 14 prioritized candidate genes for SC of which MAP3K1 and VIP were previously found to play roles in male fertility. A diferent set of 14 prioritized genes were identifed for SM and fve were previously identifed as regulators of male fertility (SOD2, TCP1, PACRG, SPEF2, PRLR). Signifcant enrichment results were identifed for fertility and body conformation QTLs within the candidate windows. Gene ontology enrichment analysis including biological processes, molecular functions, and cellular components revealed signifcant GO terms associated with male fertility. -
PDF Hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/48948 Please be advised that this information was generated on 2021-09-28 and may be subject to change. MOLECULAR AND CELLULAR BIOLOGY, Feb. 2005, p. 1402–1414 Vol. 25, No. 4 0270-7306/05/$08.00ϩ0 doi:10.1128/MCB.25.4.1402–1414.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Divergent Mitochondrial and Endoplasmic Reticulum Association of DMPK Splice Isoforms Depends on Unique Sequence Arrangements in Tail Anchors† Rene´ E. M. A. van Herpen,1 Ralph J. A. Oude Ophuis,1 Mietske Wijers,1 Miranda B. Bennink,2 Fons A. J. van de Loo,2 Jack Fransen,1 Be´ Wieringa,1* and Derick G. Wansink1 Department of Cell Biology1 and Rheumatology Research and Advanced Therapeutics,2 Nijmegen Center for Molecular Life Sciences, University Medical Center, Nijmegen, The Netherlands Received 3 September 2004/Returned for modification 23 September 2004/Accepted 10 November 2004 Myotonic dystrophy protein kinase (DMPK) is a Ser/Thr-type protein kinase with unknown function, originally identified as the product of the gene that is mutated by triplet repeat expansion in patients with myotonic dystrophy type 1 (DM1). Alternative splicing of DMPK transcripts results in multiple protein isoforms carrying distinct C termini. Here, we demonstrate by expressing individual DMPKs in various cell ؊/؊ types, including C2C12 and DMPK myoblast cells, that unique sequence arrangements in these tails control the specificity of anchoring into intracellular membranes. -
Kinase Profiling Book
Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28 -
Modulation of NF-Κb Signalling by Microbial Pathogens
REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm. -
Comparing Signaling Networks Between Normal and Transformed Hepatocytes Using Discrete Logical Models
Published OnlineFirst July 8, 2011; DOI: 10.1158/0008-5472.CAN-10-4453 Cancer Integrated Systems and Technologies: Mathematical Oncology Research Comparing Signaling Networks between Normal and Transformed Hepatocytes Using Discrete Logical Models Julio Saez-Rodriguez1,2, Leonidas G. Alexopoulos1,2, MingSheng Zhang1, Melody K. Morris2, Douglas A. Lauffenburger2, and Peter K. Sorger1,2 Abstract Substantial effort in recent years has been devoted to constructing and analyzing large-scale gene and protein networks on the basis of "omic" data and literature mining. These interaction graphs provide valuable insight into the topologies of complex biological networks but are rarely context specific and cannot be used to predict the responses of cell signaling proteins to specific ligands or drugs. Conversely, traditional approaches to analyzing cell signaling are narrow in scope and cannot easily make use of network-level data. Here, we combine network analysis and functional experimentation by using a hybrid approach in which graphs are converted into simple mathematical models that can be trained against biochemical data. Specifically, we created Boolean logic models of immediate-early signaling in liver cells by training a literature-based prior knowledge network against biochemical data obtained from primary human hepatocytes and 4 hepatocellular carcinoma cell lines exposed to combinations of cytokines and small-molecule kinase inhibitors. Distinct families of models were recovered for each cell type, and these families clustered topologically into normal and diseased sets. Cancer Res; 71(16); 5400–11. Ó2011 AACR. Introduction Major Findings The availability of high-throughput interaction data has led Clustering arises from systematic differences in signaling to the creation of methods for summarizing and exploring logic in three regions of the network. -
Lenalidomide Induces Cell Death in an MDS-Derived Cell Line with Deletion of Chromosome 5Q by Inhibition of Cytokinesis
Leukemia (2010) 24, 748–755 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Lenalidomide induces cell death in an MDS-derived cell line with deletion of chromosome 5q by inhibition of cytokinesis A Matsuoka1, A Tochigi1, M Kishimoto1, T Nakahara1, T Kondo1, T Tsujioka1, T Tasaka1, Y Tohyama2 and K Tohyama1 1Department of Laboratory Medicine, Kawasaki Medical School, Okayama, Japan; and 2Division of Biochemistry, Faculty of Pharmaceutical Sciences, Himeji Dokkyo University, Hyogo, Japan Myelodysplastic syndromes (MDS) are a group of hematopoietic higher-risk groups with del(5q) that are susceptible to leukemic stem cell disorders characterized by refractory cytopenias transformation.6 Several hematopoiesis-related genes and tumor and susceptibility to leukemic transformation. On a subset of suppressor genes are located at 5q locus, and SPARC,7 MDS patients with deletion of the long arm of chromosome5 8 9 10 11 (del(5q)), lenalidomide exerts hematological and cytogenetic CTNNA1, EGR1, RPS14 and CDC25C are reported as effects, but the underlying pharmacological mechanisms are the candidate genes of MDS with del(5q) or 5q- syndrome. not fully understood. In this study, we have investigated the Lenalidomide, a derivative of thalidomide, is shown to in vitro effects of lenalidomide on an MDS-derived cell line, exert plenty of biological actions including inhibition of MDS-L, which carries del(5q) and complex chromosome angiogenesis,12 suppression of proinflammatory cytokine abnormalities. We found that the growth of MDS-L cells was production such as TNF-a,13 enhancement of T- and NK-cell specifically suppressed mainly by apoptosis, and in addition, 14–16 multinucleated cells were frequently formed and finally died activation. -
PDF Hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/85871 Please be advised that this information was generated on 2021-09-29 and may be subject to change. ISOFORMS IN MUSCLE AND BRAIN CELLS localization and function • ralph j.a. oude ophuis • 2011 9 789088 912344 > ISBN 978-90-8891234,-4 DMPK ISOFORMS IN MUSCLE AND BRAIN CELLS LOCALIZATION AND FUNCTION Voor het bijwonen van de openbare verdediging van het proefschrift van RALPH J.A. OUDE OPHUIS DMPK ISOFORMS IN MUSCLE AND BRAIN CELLS LOCALIZATION AND FUNCTION op vrijdag 1 april 2011 om 13:00u precies in de Aula van de Radboud Universiteit Nijmegen aan de Comeniuslaan 2 te Nijmegen Na afloop van de verdediging is er een receptie ter plaatse PARANIMFEN Susan Mulders [email protected] Rinske van de Vorstenbosch r.vandevorstenbosch(§) ncmls.ru.nl DMPK ISOFORMS IN MUSCLE AND BRAIN CELLS LOCALIZATION AND FUNCTION ISBN-13 978-90-8891234-4 ISBN-10 90-8891-234-3 Printed by Proefsohriftmaken.nl || Printyourthesis.com Published by Uitgeverij BOXPress, Oisterwijk DMPK ISOFORMS IN MUSCLE AND BRAIN CELLS LOCALIZATION AND FUNCTION Een wetenschappelijke proeve op het gebied van de Medische Wetenschappen Proefschrift ter verkrijging van de graad van doctor aan de Radboud Universiteit Nijmegen op gezag van de rector magnificus prof. mr. S.C.J.J. Kortmann, volgens besluit van het college van decanen in het openbaar te verdedigen op vrijdag 1 april 2011 om 13:00 uur precies door Raphaël Johannes Antonius Oude Ophuis geboren op 24 oktober 1978 te Sint-Oedenrode Promotor Prof. -
Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols
biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth. -
Epigenetic Regulation of Neurogenesis by Citron Kinase Matthew Irg Genti University of Connecticut - Storrs, [email protected]
University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 12-10-2015 Epigenetic Regulation of Neurogenesis By Citron Kinase Matthew irG genti University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Girgenti, Matthew, "Epigenetic Regulation of Neurogenesis By Citron Kinase" (2015). Doctoral Dissertations. 933. https://opencommons.uconn.edu/dissertations/933 Epigenetic Regulation Of Neurogenesis By Citron Kinase Matthew J. Girgenti, Ph.D. University of Connecticut, 2015 Patterns of neural progenitor division are controlled by a combination of asymmetries in cell division, extracellular signals, and changes in gene expression programs. In a screen for proteins that complex with citron kinase (CitK), a protein essential to cell division in developing brain, I identified the histone methyltransferase- euchromatic histone-lysine N-methyltransferse 2 (G9a). CitK is present in the nucleus and binds to positions in the genome clustered around transcription start sites of genes involved in neuronal development and differentiation. CitK and G9a co-occupy these genomic positions in S/G2-phase of the cell cycle in rat neural progenitors, and CitK functions with G9a to repress gene expression in several developmentally important genes including CDKN1a, H2afz, and Pou3f2/Brn2. The study indicates a novel function for citron kinase in gene repression, and contributes additional evidence to the hypothesis that mechanisms that coordinate gene expression states are directly linked to mechanisms that regulate cell division in the developing nervous system. Epigenetic Regulation Of Neurogenesis By Citron Kinase Matthew J. Girgenti B.S., Fairfield University, 2002 M.S., Southern Connecticut State University, 2004 A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy at the University of Connecticut 2015 ii Copyright by Matthew J. -
In Epha4 Signaling in <I>Xenopus Laevis</I>
Eastern Michigan University DigitalCommons@EMU Senior Honors Theses Honors College 2008 The nI volvement of Rho-Associated Kinases (ROCKs) in EphA4 Signaling in Xenopus laevis Ashley Bate Follow this and additional works at: http://commons.emich.edu/honors Recommended Citation Bate, Ashley, "The nI volvement of Rho-Associated Kinases (ROCKs) in EphA4 Signaling in Xenopus laevis" (2008). Senior Honors Theses. 129. http://commons.emich.edu/honors/129 This Open Access Senior Honors Thesis is brought to you for free and open access by the Honors College at DigitalCommons@EMU. It has been accepted for inclusion in Senior Honors Theses by an authorized administrator of DigitalCommons@EMU. For more information, please contact lib- [email protected]. The nI volvement of Rho-Associated Kinases (ROCKs) in EphA4 Signaling in Xenopus laevis Abstract XEphA4 is a cellular receptor that functions to regulate cell and tissue interactions in amphibian embryos via a repulsive mechanism that involves actin cytoskeleton reorganization. Ectopic EphA4 signaling in Xenopus embryos results in a loss of cell-adhesion and rounded cell morphology, and this phenotype is consistent with EphA4 signaling in cultured A6 cells. How EphA4 achieves its effects on the actin cytoskeleton at the molecular level is largely unknown. One known step in the pathway is that EphA4 causes inhibition of the small GTPase RhoA. RhoA has many downstream effectors that cause cytoskeletal reorganization; the most recognized of these are the ROCK proteins (Rho-associated kinases). ROCK exists in two isoforms, ROCKI and ROCKII. We hypothesize that ROCK inhibition is one step in EphA4 signaling. To test our hypothesis we used ROCK inhibitors and mutants.