DOCSLIB.ORG

Atlas Journal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Atlas Journal Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 7, Number 3, Jul-Sep 2003 Previous Issue / Next Issue Genes EVI1 Ecotropic Viral Integration 1 Site (EVI1) and Myelodysplastic Syndrome 1 (MDS1)-EVI1 (3q26.2). Soumen Chakraborty, Silvia Buonamici, Vitalyi Senyuk, Giuseppina Nucifora. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 337-343. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/EVI103q26ID19.html MARK4 (MAP/microtubule affinity-regulating kinase 4) (19q13.2). Alessandro Beghini. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 344-349. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/MARK4ID419.html AF5q31 (ALL1 fused gene from chromosome 5q31) (5q31) - updated. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 350-353. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/AF5q31ID230.html ALEX1 (arm protein lost in epithelial cancers, X chromosome, 1) (Xq22.1). Jean-Loup Huret, Sylvie Senon. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 354-356. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/ALEX1Xq22ID477.html ALEX2 (arm protein lost in epithelial cancers, X chromosome, 2) (Xq22.1). Jean-Loup Huret, Sylvie Senon. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 357-359. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/ALEX2Xq22ID478.html ALEX3 (arm protein lost in epithelial cancers, X chromosome, 3) (Xq22.1). Jean-Loup Huret, Sylvie Senon. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 360-362. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 2003; 3 I URL : http://AtlasGeneticsOncology.org/Genes/ALEX3Xq22ID479.html CAGE-1 (cancer-associated gene-1) (6p24.3). Jean-Loup Huret, Sylvie Senon. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 363-365. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/CAG1ID475.html MAML2 (mastermind-like 2) (11q21-22). Goran Stenman. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 366-369. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/MAML2ID472.html MDS2 (1p36). Jean-Loup Huret, Sylvie Senon. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 370-372. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/MDS2ID476.html MECT1 (mucoepidermoid carcinoma translocated 1) (19p13). Goran Stenman. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 373-375. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/MECT1ID471.html TCF12 (transcription factor 12) (15q21). Goran Stenman. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 376-381. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/TCF12ID406.html NR4A3 (nuclear receptor subfamily 4, group A, member 3) (9q22). Goran Stenman. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 382-387. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/TECID75.html Leukaemias dic(9;12)(p13;p13) - updated. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 388-391. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/dic0912.html ins(5;11)(q31;q13q23) - updated. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 392-393. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/ins511ID1167.html t(1;21)(p32;q22). Charles D. Bangs. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 394-396. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 2003; 3 II URL : http://AtlasGeneticsOncology.org/Anomalies/t0121p32q22ID1259.html + 19 or trisomy 19. Edmond SK Ma, Thomas SK Wan. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 397-398. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/tri19ID1039.html t(1;12)(p36;p13). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 399-400. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t0112p36p13ID1170.html t(X;10)(p10;p10). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 401-402. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t0X10p10p10ID1256.html Solid Tumours Bone: Chondroma. Roberta Vanni. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 403-407. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/ChondromaID5147.html Thyroid: Anaplastic (undifferentiated) carcinoma. Oluwole Fadare, Giovanni Tallini. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 408-411. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/AnaCarciThyroidID5069.html Bone: Giant cell tumour. Ramses G Forsyth, Pancras CW Hogendoorn. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 412-417. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/BoneGiantCellTumID5150.html Thyroid: Oncocytic tumors. Oluwole Fadare, Giovanni Tallini. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 418-423. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/OncocytThyroidID5068.html Kidney: Renal cell carcinoma. Eva van den Berg, Stephan Storkel. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 424-431. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/RenalCellCarcinID5021.html Bone: Chondroblastoma. Salvatore Romeo, Pancras CW Hogendoorn. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 432-437. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 2003; 3 III URL : http://AtlasGeneticsOncology.org/Tumors/ChondroblastomaID5148.html Bone: Chondromyxoid fibroma. Salvatore Romeo, Pancras CW Hogendoorn. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 438-441. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/ChondroMyxoidFibID5149.html Smooth muscle: Intravenous leiomyomatosis. Paola Dal Cin. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 442-443. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/IntravLeiomyomID5158.html Cancer Prone Diseases Deep Insights Case Reports A new case of t(8;14)(q11;q32) in an acute lymphoblastic leukemia. Benoit Quilichini, Helene Zattara, François Casalonga, Laure-Anne Bastide-Alliez, Catherine Curtillet, Chantal Fossat, Gérard Michel.. Atlas Genet Cytogenet Oncol Haematol 2003; 7 (3): 444-447. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/814QuilichiniID100007.html Educational Items © Atlas of Genetics and Cytogenetics in Oncology and Haematology X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching For comments and suggestions or contributions, please contact us [email protected]. Atlas Genet Cytogenet Oncol Haematol 2003; 3 IV Atlas of Genetics and Cytogenetics in Oncology and Haematology EVI1 Ecotropic Viral Integration 1 Site (EVI1) and Myelodysplastic Syndrome 1 (MDS1)-EVI1 Identity Other PRDM3 names Hugo EVI1 Location 3q26.2 DNA/RNA Description EVI1 spans over 100 kb and contains 12 exons with alternative untranslated exons 1a and 1b. Of 12 exons, ten are coding exons. MDS1 is a small gene, 300-400 kb upstream of the first exon of EVI1. MDS1-EVI1 results from the splicing of the second exon of MDS1 to the second exon of EVI1. Transcription Telomere to centromere. Protein Atlas Genet Cytogenet Oncol Haematol 2003; 3 -337- Description EVI1 has 1051 amino acids and is a 145-kDa DNA binding protein. It contains two domains of seven and three sets of repeats of the zinc finger motif, a repression domain between the two sets of zinc fingers, and an acidic domain at the C-terminal end. Predicted translation of MDS1-EVI1 adds 188 amino acids upstream of the start site of EVI1 in the third exon, of which 63 amino acids are derived from the untranslated second exon and from the untranslated part of the third exon of EVI1, and remaining 125 amino acids are from the MDS1 gene. MDS1-EVI1 contains the PR domain that is about 40% homologous to the N-terminus of retinoblastoma-binding protein, RIZ and the PRDI-BF1 transcription factor. Expression In the mouse embryo EVI1 is expressed at high level in the urinary system and Mullerian ducts, in the lung, and in the heart, but at low level in most of the adult tissues. In humans, EVI1 is expressed abundantly in kidney, lung, pancreas and ovaries, and to a lesser extent in several other tissues, including skeletal muscle. The pattern of expression of MDS1-EVI1 in adult tissues is identical to that of EVI1. Localisation Nuclear. Function Because of the spatial and temporal restricted pattern of expression of EVI1, it is suggested that this gene plays an important role in mouse development and could be involved in organogenesis, cell migration, cell growth, and differentiation. Homology The human EVI1 is highly homologous to the murine gene and shows 91% and 94% homology in nucleotide or amino acid sequence respectively. MDS1-EVI1 shares an overall homology with the C. elegans Egl 43 protein that includes the PR domain at the N-terminus and the two zinc-finger domains. Implicated in Entity t(3;3)(q21;q26) or inv(3)(q21q26) Note Syndrome 3q21q26. The EVI1 gene can be activated in Atlas Genet Cytogenet Oncol Haematol 2003; 3 -338- haematopoietic cells by chromosomal rearrangements either in the 5¹ of the gene by t(3;3)(q21;q26) or in the 3¹ of the gene by inv(3)(q21q26). Both these rearrangements juxtaposed the enhancer of the constitutively expressed housekeeping
Load more

Recommended publications
  • ARMCX3 (NM 177948) Human Untagged Clone – SC124834
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC124834 ARMCX3 (NM_177948) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: ARMCX3 (NM_177948) Human Untagged Clone Tag: Tag Free Symbol: ARMCX3 Synonyms: ALEX3; dJ545K15.2; GASP6 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_177948, the custom clone sequence may differ by one or more nucleotides ATGGGCTACGCCAGGAAAGTAGGCTGGGTGACCGCAGGCCTGGTGATTGGGGCTGGCGCCTGCTATTGCA TTTATAGACTGACTAGGGGAAGAAAACAGAACAAGGAAAAAATGGCTGAGGGTGGATCTGGGGATGTGGA TGATGCTGGGGACTGTTCTGGGGCCAGGTATAATGACTGGTCTGATGATGATGATGACAGCAATGAGAGC AAGAGTATAGTATGGTACCCACCTTGGGCTCGGATTGGGACTGAAGCTGGAACCAGAGCTAGGGCCAGGG CAAGGGCCAGGGCTACCCGGGCACGTCGGGCTGTCCAGAAACGGGCTTCCCCCAATTCAGATGATACCGT TTTGTCCCCTCAAGAGCTACAAAAGGTTCTTTGCTTGGTTGAGATGTCTGAAAAGCCTTATATTCTTGAA GCAGCTTTAATTGCTCTGGGTAACAATGCTGCTTATGCATTTAACAGAGATATTATTCGTGATCTGGGTG GTCTCCCAATTGTCGCAAAGATTCTCAATACTCGGGATCCCATAGTTAAGGAAAAGGCTTTAATTGTCCT GAATAACTTGAGTGTGAATGCTGAAAATCAGCGCAGGCTTAAAGTATACATGAATCAAGTGTGTGATGAC ACAATCACTTCTCGCTTGAACTCATCTGTGCAGCTTGCTGGACTGAGATTGCTTACAAATATGACTGTTA CTAATGAGTATCAGCACATGCTTGCTAATTCCATTTCTGACTTTTTTCGTTTATTTTCAGCGGGAAATGA AGAAACCAAACTTCAGGTTCTGAAACTCCTTTTGAATTTGGCTGAAAATCCAGCCATGACTAGGGAACTG CTCAGGGCCCAAGTACCATCTTCACTGGGCTCCCTCTTTAATAAGAAGGAGAACAAAGAAGTTATTCTTA AACTTCTGGTCATATTTGAGAACATAAATGATAATTTCAAATGGGAAGAAAATGAACCTACTCAGAATCA
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Inactive X Chromosome Is Epigenetically Unstable and Transcriptionally Labile in Breast Cancer
    Supplemental Information The inactive X chromosome is epigenetically unstable and transcriptionally labile in breast cancer Ronan Chaligné1,2,3,8, Tatiana Popova1,4, Marco-Antonio Mendoza-Parra5, Mohamed-Ashick M. Saleem5 , David Gentien1,6, Kristen Ban1,2,3,8, Tristan Piolot1,7, Olivier Leroy1,7, Odette Mariani6, Hinrich Gronemeyer*5, Anne Vincent-Salomon*1,4,6,8, Marc-Henri Stern*1,4,6 and Edith Heard*1,2,3,8 Extended Experimental Procedures Cell Culture Human Mammary Epithelial Cells (HMEC, Invitrogen) were grown in serum-free medium (HuMEC, Invitrogen). WI- 38, ZR-75-1, SK-BR-3 and MDA-MB-436 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) containing 10% fetal bovine serum (FBS). DNA Methylation analysis. We bisulfite-treated 2 µg of genomic DNA using Epitect bisulfite kit (Qiagen). Bisulfite converted DNA was amplified with bisulfite primers listed in Table S3. All primers incorporated a T7 promoter tag, and PCR conditions are available upon request. We analyzed PCR products by MALDI-TOF mass spectrometry after in vitro transcription and specific cleavage (EpiTYPER by Sequenom®). For each amplicon, we analyzed two independent DNA samples and several CG sites in the CpG Island. Design of primers and selection of best promoter region to assess (approx. 500 bp) were done by a combination of UCSC Genome Browser (http://genome.ucsc.edu) and MethPrimer (http://www.urogene.org). All the primers used are listed (Table S3). NB: MAGEC2 CpG analysis have been done with a combination of two CpG island identified in the gene core. Analysis of RNA allelic expression profiles (based on Human SNP Array 6.0) DNA and RNA hybridizations were normalized by Genotyping console.
    [Show full text]
  • Anti-ARMCX1 Monoclonal Antibody, Clone FQS23965 (DCABH-6907) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-ARMCX1 monoclonal antibody, clone FQS23965 (DCABH-6907) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Rabbit monoclonal to ARMCX1 - N-terminal Antigen Description This gene encodes a member of the ALEX family of proteins and may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and two Armadillo (arm) repeats. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members, including ALEX2 and ALEX3, on the X chromosome. Immunogen Synthetic peptide (the amino acid sequence is considered to be commercially sensitive) within Human ARMCX1 aa 1-150 (N terminal). The exact sequence is proprietary.Database link: Q9P291 Isotype IgG Source/Host Rabbit Species Reactivity Human Clone FQS23965 Purity Tissue culture supernatant Conjugate Unconjugated Applications WB, ICC/IF Positive Control Human fetal heart or fetal brain lysate, HeLa cells. Format Liquid Size 100 μl Buffer pH: 7.2; Preservative: 0.01% Sodium azide; Constituents: 50% Glycerol, 0.05% BSA, PBS Preservative 0.01% Sodium Azide Storage Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C long term. Avoid freeze / thaw cycle. Ship Shipped at 4°C. 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved GENE INFORMATION
    [Show full text]
  • Atlas of Subcellular RNA Localization Revealed by APEX-Seq
    bioRxiv preprint doi: https://doi.org/10.1101/454470; this version posted October 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Atlas of Subcellular RNA Localization Revealed by APEX-seq Furqan M. Fazal1,2,3,*, Shuo Han3,4,5,*, Pornchai Kaewsapsak3,4,5, Kevin R. Parker1,2,3, Jin Xu1,2,3, Alistair N. Boettiger6, Howard Y. Chang1,2,3,7,†, Alice Y. Ting3,4,5,8,9,† 1Center for Personal Dynamics Regulomes, Stanford University School of Medicine, Stanford, CA, USA 2Department of Dermatology, Stanford University School of Medicine, Stanford, CA, USA 3Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA 4Department of Chemistry, Stanford University, Stanford, CA, USA 5Department of Biology, Stanford University, Stanford, CA, USA 6Department of Developmental Biology, Stanford University School of Medicine, CA, USA 7Howard Hughes Medical Institute 8Chan Zuckerberg Biohub, San Francisco, California, USA 9Lead contact *These authors contributed equally to this work †Corresponding authors. Email: [email protected] (A.Y.T.); [email protected] (H.Y.C.) SUMMARY We introduce APEX-seq, a method for RNA sequencing based on spatial proximity to the peroxidase enzyme APEX2. APEX-seq in nine distinct subcellular locales produced a nanometer-resolution spatial map of the human transcriptome, revealing extensive and exquisite patterns of localization for diverse RNA classes and transcript isoforms. We uncover a radial organization of the nuclear transcriptome, which is gated at the inner surface of the nuclear pore for cytoplasmic export of processed transcripts.
    [Show full text]
  • A Systems Genomics Approach to Uncover Patient-Specific Pathogenic Pathways and Proteins in a Complex Disease
    bioRxiv preprint doi: https://doi.org/10.1101/692269; this version posted July 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A systems genomics approach to uncover patient-specific pathogenic pathways and proteins in a complex disease 1,2,3,4,§ 5,§ 1,4,6,§ 4,7 Johanne Brooks ,​ Dezso Modos ,​ Padhmanand Sudhakar ,​ David Fazekas ,​ Azedine ​ ​ ​ ​ 5 8 4 1,4 6,9 Zoufir ,​ Orsolya Kapuy ,​ Mate Szalay-Beko ,​ Matthew Madgwick ,​ Bram Verstockt ,​ Lindsay ​ ​ ​ ​ ​ 1,2 1,2,3 3 10 6,9 Hall Alastair​ Watson ,​ Mark Tremelling ,​ Miles Parkes ,​ Severine Vermeire ,​ Andreas ​ ​ ​ ​ ​ 5 1,2,* 1,4,* Bender ,​ Simon R. Carding ,​ Tamas Korcsmaros ​ ​ ​ 1 Gut Health and Microbes Programme, The Quadram Institute Bioscience, Norwich Research Park, Norwich, UK 2 ​ Norwich Medical School, University of East Anglia, Norwich, UK 3 ​ Department of Gastroenterology, Norfolk and Norwich University Hospitals, Norwich, UK 4 ​ Earlham Institute, Norwich Research Park, Norwich, UK 5 Centre​ for Molecular Science Informatics, Department of Chemistry, University of Cambridge, Cambridge, UK 6 ​ KU Leuven, Department of Chronic diseases, Metabolism and Ageing, Leuven, Belgium 7 ​ Department of Genetics, Eötvös Loránd University, Budapest, Hungary 8 Department​ of Medical Chemistry, Molecular Biology and Pathobiochemistry, Semmelweis University, Budapest, Hungary 9 University​ Hospitals Leuven, Department of Gastroenterology and Hepatology, KU Leuven, Leuven, Belgium 10 Inflammatory​ Bowel Disease Research Group, Addenbrooke's Hospital, University of Cambridge, Cambridge, UK. § ​ equal contribution * ​ joint corresponding authors bioRxiv preprint doi: https://doi.org/10.1101/692269; this version posted July 4, 2019.
    [Show full text]
  • This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research
    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Al Ahdal, Hadil Title: Investigating the role of miR-21 in adult neurogenesis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. Investigating the role of miR-21 in adult neurogenesis Hadil Mohammad Al Ahdal Faculty of Health Sciences Bristol Medical School A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School 64,598 words Abstract MicroRNAs (miRNAs) are a class of small non-coding RNAs that act as post- transcriptional regulators and play important roles in neurodegenerative diseases and brain disorders (Nelson et al.
    [Show full text]
  • Discovery of Recurrent Structural Variants in Nasopharyngeal Carcinoma
    Method Discovery of recurrent structural variants in nasopharyngeal carcinoma Anton Valouev,1,5,6 Ziming Weng,2,3,5 Robert T. Sweeney,2 Sushama Varma,2 Quynh-Thu Le,4 Christina Kong,2 Arend Sidow,2,3,6 and Robert B. West2,6 1Division of Bioinformatics, Department of Preventive Medicine, University of Southern California Keck School of Medicine, Los Angeles, California 90087, USA; 2Department of Pathology, Stanford University School of Medicine, Stanford, California 94305, USA; 3Department of Genetics, Stanford University School of Medicine, Stanford, California 94305, USA; 4Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California 94305, USA We present the discovery of genes recurrently involved in structural variation in nasopharyngeal carcinoma (NPC) and the identification of a novel type of somatic structural variant. We identified the variants with high complexity mate-pair libraries and a novel computational algorithm specifically designed for tumor-normal comparisons, SMASH. SMASH combines signals from split reads and mate-pair discordance to detect somatic structural variants. We demonstrate a >90% validation rate and a breakpoint reconstruction accuracy of 3 bp by Sanger sequencing. Our approach identified three in-frame gene fusions (YAP1-MAML2, PTPLB-RSRC1, and SP3-PTK2) that had strong levels of expression in corre- sponding NPC tissues. We found two cases of a novel type of structural variant, which we call ‘‘coupled inversion,’’ one of which produced the YAP1-MAML2 fusion. To investigate whether the identified fusion genes are recurrent, we performed fluorescent in situ hybridization (FISH) to screen 196 independent NPC cases. We observed recurrent rearrangements of MAML2 (three cases), PTK2 (six cases), and SP3 (two cases), corresponding to a combined rate of structural variation re- currence of 6% among tested NPC tissues.
    [Show full text]
  • Carcinoma Discovery of Recurrent Structural Variants in Nasopharyngeal
    Downloaded from genome.cshlp.org on February 28, 2014 - Published by Cold Spring Harbor Laboratory Press Discovery of recurrent structural variants in nasopharyngeal carcinoma Anton Valouev, Ziming Weng, Robert T. Sweeney, et al. Genome Res. 2014 24: 300-309 originally published online November 8, 2013 Access the most recent version at doi:10.1101/gr.156224.113 Supplemental http://genome.cshlp.org/content/suppl/2013/11/21/gr.156224.113.DC1.html Material References This article cites 44 articles, 17 of which can be accessed free at: http://genome.cshlp.org/content/24/2/300.full.html#ref-list-1 Creative This article is distributed exclusively by Cold Spring Harbor Laboratory Press for the Commons first six months after the full-issue publication date (see License http://genome.cshlp.org/site/misc/terms.xhtml). After six months, it is available under a Creative Commons License (Attribution-NonCommercial 3.0 Unported), as described at http://creativecommons.org/licenses/by-nc/3.0/. Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here. To subscribe to Genome Research go to: http://genome.cshlp.org/subscriptions © 2014 Valouev et al.; Published by Cold Spring Harbor Laboratory Press Downloaded from genome.cshlp.org on February 28, 2014 - Published by Cold Spring Harbor Laboratory Press Method Discovery of recurrent structural variants in nasopharyngeal carcinoma Anton Valouev,1,5,6 Ziming Weng,2,3,5 Robert T. Sweeney,2 Sushama Varma,2 Quynh-Thu Le,4 Christina Kong,2 Arend Sidow,2,3,6 and Robert B.
    [Show full text]
  • Joint Profiling of Chromatin Accessibility and CAR-T Integration Site Analysis at Population and Single-Cell Levels
    Joint profiling of chromatin accessibility and CAR-T integration site analysis at population and single-cell levels Wenliang Wanga,b,c,d, Maria Fasolinoa,b,c,d, Benjamin Cattaua,b,c,d, Naomi Goldmana,b,c,d, Weimin Konge,f,g, Megan A. Fredericka,b,c,d, Sam J. McCrighta,b,c,d, Karun Kiania,b,c,d, Joseph A. Fraiettae,f,g,h, and Golnaz Vahedia,b,c,d,f,1 aDepartment of Genetics, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; bInstitute for Immunology, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; cEpigenetics Institute, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; dInstitute for Diabetes, Obesity and Metabolism, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; eDepartment of Microbiology, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; fAbramson Family Cancer Center, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; gCenter for Cellular Immunotherapies, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; and hParker Institute for Cancer Immunotherapy, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104 Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved January 30, 2020 (received for review November 3, 2019) Chimeric antigen receptor (CAR)-T immunotherapy has yielded tumor killing. To determine the extent to which these two sce- impressive results in several B cell malignancies, establishing itself narios occur in vivo, it is essential to simultaneously determine as a powerful means to redirect the natural properties of T lym- T cell fate and map where CAR-T vectors integrate into the phocytes.
    [Show full text]
  • CRTC1/MAML2 Gain-Of-Function Interactions with MYC Create A
    CRTC1/MAML2 gain-of-function interactions with MYC PNAS PLUS create a gene signature predictive of cancers with CREB–MYC involvement Antonio L. Amelioa,1, Mohammad Fallahib, Franz X. Schauba, Min Zhangc, Mariam B. Lawania, Adam S. Alpersteina, Mark R. Southernd, Brandon M. Younge, Lizi Wuf, Maria Zajac-Kayec,g, Frederic J. Kayec, John L. Clevelanda, and Michael D. Conkrighta,d,2 aDepartment of Cancer Biology, bIT Informatics, dTranslational Research Institute and Department of Molecular Therapeutics, and eGenomics Core, The Scripps Research Institute, Jupiter, FL 33458; and Departments of cMedicine, fMolecular Genetics and Microbiology, and gAnatomy and Cell Biology, Shands Cancer Center, University of Florida, Gainesville, FL 32610 Edited* by Marc Montminy, The Salk Institute for Biological Studies, La Jolla, CA, and approved July 8, 2014 (received for review October 11, 2013) Chimeric oncoproteins created by chromosomal translocations are histology. As such, these are a class of epithelial cell malignancies among the most common genetic mutations associated with tu- that originate from mucous/serous glands present at different morigenesis. Malignant mucoepidermoid salivary gland tumors, as locations in the body (6, 8–15). well as a growing number of solid epithelial-derived tumors, can The genesis of these adult solid tumors was thought to be due arise from a recurrent t (11, 19)(q21;p13.1) translocation that gen- to the direct activation of both CREB and NOTCH/RBPJ, the erates an unusual chimeric cAMP response element binding protein transcription factor targets of the CRTC1 and MAML2 coac- (CREB)-regulated transcriptional coactivator 1 (CRTC1)/mastermind- tivators involved in the t (11, 19) translocation, respectively like 2 (MAML2) (C1/M2) oncoprotein comprised of two transcrip- (6, 15).
    [Show full text]