Supplementary Information
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Expression Imputation Across Multiple Brain Regions Provides Insights Into Schizophrenia Risk
VU Research Portal Gene expression imputation across multiple brain regions provides insights into schizophrenia risk iPSYCH-GEMS Schizophrenia Working Group; CommonMind Consortium; The Schizophrenia Working Group of the PsyUniversity of Copenhagenchiatric Genomics Consortium published in Nature Genetics 2019 DOI (link to publisher) 10.1038/s41588-019-0364-4 document version Publisher's PDF, also known as Version of record document license Article 25fa Dutch Copyright Act Link to publication in VU Research Portal citation for published version (APA) iPSYCH-GEMS Schizophrenia Working Group, CommonMind Consortium, & The Schizophrenia Working Group of the PsyUniversity of Copenhagenchiatric Genomics Consortium (2019). Gene expression imputation across multiple brain regions provides insights into schizophrenia risk. Nature Genetics, 51(4), 659–674. https://doi.org/10.1038/s41588-019-0364-4 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. E-mail address: [email protected] Download date: 28. -
Description: Uniprot:P68431 Alternative Names:
TA0863 Histone H3 Antibody Order 021-34695924 [email protected] Support 400-6123-828 50ul [email protected] 100 uL √ √ Web www.ab-mart.com.cn Description: Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post- translational modifications of histones, also called histone code, and nucleosome remodeling. Uniprot:P68431 Alternative Names: H3 histone family, member A; H3/A; H31_HUMAN; H3FA; Hist1h3a; HIST1H3B; HIST1H3C; HIST1H3D; HIST1H3E; HIST1H3F; HIST1H3G; HIST1H3H; HIST1H3I; HIST1H3J; histone 1, H3a; Histone cluster 1, H3a; Histone H3.1; Histone H3/a; Histone H3/b; Histone H3/c; Histone H3/d; Histone H3/f; Histone H3/h; Histone H3/i; Histone H3/j; Histone H3/k; Histone H3/l; ;H3.3A; HIST1 cluster, H3E; H3 histone family, member A; H3.1; H3/l; H3F3; H3FF; H3FJ; H3FL; Histone gene cluster 1, H3 histone family, member E; histone H3.1t; Histone H3/o; FLJ92264; H 3; H3; H3 histone family, member B; H3 histone family, member C; H3 histone family, member D; H3 histone family, member F; H3 histone family, member H; H3 histone family, member I; H3 histone family, member J; H3 histone family, member K; H3 histone family, member L; H3 histone family, member T; H3 histone, family 3A; H3/A; H3/b; H3/c; H3/d; h3/f; H3/h; H3/i; H3/j; H3/k; H3/t; H31_HUMAN; H3F1K; -
Genome-Wide Screen of Cell-Cycle Regulators in Normal and Tumor Cells
bioRxiv preprint doi: https://doi.org/10.1101/060350; this version posted June 23, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Genome-wide screen of cell-cycle regulators in normal and tumor cells identifies a differential response to nucleosome depletion Maria Sokolova1, Mikko Turunen1, Oliver Mortusewicz3, Teemu Kivioja1, Patrick Herr3, Anna Vähärautio1, Mikael Björklund1, Minna Taipale2, Thomas Helleday3 and Jussi Taipale1,2,* 1Genome-Scale Biology Program, P.O. Box 63, FI-00014 University of Helsinki, Finland. 2Science for Life laboratory, Department of Biosciences and Nutrition, Karolinska Institutet, SE- 141 83 Stockholm, Sweden. 3Science for Life laboratory, Division of Translational Medicine and Chemical Biology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, S-171 21 Stockholm, Sweden To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that tumor and normal cells are differentially sensitive to loss of the histone genes transcriptional regulator CASP8AP2. In cancer cells, loss of CASP8AP2 leads to a failure to synthesize sufficient amount of histones in the S-phase of the cell cycle, resulting in slowing of individual replication forks. Despite this, DNA replication fails to arrest, and tumor cells progress in an elongated S-phase that lasts several days, finally resulting in death of most of the affected cells. -
A Systems Genomics Approach to Uncover Patient-Specific Pathogenic Pathways and Proteins in a Complex Disease
bioRxiv preprint doi: https://doi.org/10.1101/692269; this version posted July 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A systems genomics approach to uncover patient-specific pathogenic pathways and proteins in a complex disease 1,2,3,4,§ 5,§ 1,4,6,§ 4,7 Johanne Brooks , Dezso Modos , Padhmanand Sudhakar , David Fazekas , Azedine 5 8 4 1,4 6,9 Zoufir , Orsolya Kapuy , Mate Szalay-Beko , Matthew Madgwick , Bram Verstockt , Lindsay 1,2 1,2,3 3 10 6,9 Hall Alastair Watson , Mark Tremelling , Miles Parkes , Severine Vermeire , Andreas 5 1,2,* 1,4,* Bender , Simon R. Carding , Tamas Korcsmaros 1 Gut Health and Microbes Programme, The Quadram Institute Bioscience, Norwich Research Park, Norwich, UK 2 Norwich Medical School, University of East Anglia, Norwich, UK 3 Department of Gastroenterology, Norfolk and Norwich University Hospitals, Norwich, UK 4 Earlham Institute, Norwich Research Park, Norwich, UK 5 Centre for Molecular Science Informatics, Department of Chemistry, University of Cambridge, Cambridge, UK 6 KU Leuven, Department of Chronic diseases, Metabolism and Ageing, Leuven, Belgium 7 Department of Genetics, Eötvös Loránd University, Budapest, Hungary 8 Department of Medical Chemistry, Molecular Biology and Pathobiochemistry, Semmelweis University, Budapest, Hungary 9 University Hospitals Leuven, Department of Gastroenterology and Hepatology, KU Leuven, Leuven, Belgium 10 Inflammatory Bowel Disease Research Group, Addenbrooke's Hospital, University of Cambridge, Cambridge, UK. § equal contribution * joint corresponding authors bioRxiv preprint doi: https://doi.org/10.1101/692269; this version posted July 4, 2019. -
A Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic Buffering of Doxorubicin Sean M
Santos and Hartman Cancer & Metabolism (2019) 7:9 https://doi.org/10.1186/s40170-019-0201-3 RESEARCH Open Access A yeast phenomic model for the influence of Warburg metabolism on genetic buffering of doxorubicin Sean M. Santos and John L. Hartman IV* Abstract Background: The influence of the Warburg phenomenon on chemotherapy response is unknown. Saccharomyces cerevisiae mimics the Warburg effect, repressing respiration in the presence of adequate glucose. Yeast phenomic experiments were conducted to assess potential influences of Warburg metabolism on gene-drug interaction underlying the cellular response to doxorubicin. Homologous genes from yeast phenomic and cancer pharmacogenomics data were analyzed to infer evolutionary conservation of gene-drug interaction and predict therapeutic relevance. Methods: Cell proliferation phenotypes (CPPs) of the yeast gene knockout/knockdown library were measured by quantitative high-throughput cell array phenotyping (Q-HTCP), treating with escalating doxorubicin concentrations under conditions of respiratory or glycolytic metabolism. Doxorubicin-gene interaction was quantified by departure of CPPs observed for the doxorubicin-treated mutant strain from that expected based on an interaction model. Recursive expectation-maximization clustering (REMc) and Gene Ontology (GO)-based analyses of interactions identified functional biological modules that differentially buffer or promote doxorubicin cytotoxicity with respect to Warburg metabolism. Yeast phenomic and cancer pharmacogenomics data were integrated to predict differential gene expression causally influencing doxorubicin anti-tumor efficacy. Results: Yeast compromised for genes functioning in chromatin organization, and several other cellular processes are more resistant to doxorubicin under glycolytic conditions. Thus, the Warburg transition appears to alleviate requirements for cellular functions that buffer doxorubicin cytotoxicity in a respiratory context. -
Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients. -
Histone H3.1 (Human) Cell-Based ELISA Kit
Histone H3.1 (Human) Cell-Based ELISA Kit Catalog # : KA2761 規格 : [ 1 Kit ] List All Specification Application Image Product Histone H3.1 (Human) Cell-Based ELISA Kit is an indirect enzyme-linked Qualitative Description: immunoassay for qualitative determination of Histone H3 expression in cultured cells. Reactivity: Human, Mouse, Rat Storage Store the kit at 4°C. Instruction: Protocol: Protocol Download Suitable Attached Cell, Loosely Attached Cell, Suspension Cell Sample: Label: HRP-conjugated Detection Colorimetric Method: Regulation For research use only (RUO) Status: Datasheet: Download Applications Qualitative HIST1H3A HIST1H3D HIST1H3C HIST1H3E HIST1H3I HIST1H3G HIST1H3J HIST1H3H HIST1H3B HIST1H3F Gene Information Entrez GeneID: 8350 Protein P68431 Accession#: Gene Name: HIST1H3A Gene Alias: H3/A,H3FA Gene histone cluster 1, H3a Description: Omim ID: 602810 Gene Ontology: Hyperlink Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a Page 1 of 6 2021/6/18 nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq Other H3 histone family, member A,histone 1, H3a Designations: Gene Information Entrez GeneID: 8351 Protein P68431 Accession#: Gene Name: HIST1H3D Gene Alias: H3/b,H3FB Gene histone cluster 1, H3d Description: Omim ID: 602811 Gene Ontology: Hyperlink Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. -
The Expression and Nuclear Deposition of Histone H3.1 In
Journal of Reproduction and Development, Vol. 58, No 5, 2012 —Original Article— The Expression and Nuclear Deposition of Histone H3.1 in Murine Oocytes and Preimplantation Embryos Machika KAWAMURA1), Tomohiko AKIYAMA1)#, Satoshi TSUKAmoto2), Masataka G. SUZUKI1) and Fugaku AokI1) 1)Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Chiba 277-8562, Japan 2)Laboratory of Animal and Genome Science Section, National Institute of Radiological Sciences, Chiba 263-8555, Japan #Present: Laboratory of Genetics, NIH Biomedical Research Center, Baltimore, MD 21224, U.S.A. Abstract. Differentiated oocytes acquire totipotency through fertilization. During this transition, genome-wide chromatin remodeling occurs, which leads to change in gene expression. However, the mechanism that underlies this global change in chromatin structure has not been fully elucidated. Histone variants play a key role in defining chromatin structure and are implicated in inheritance of epigenetic information. In this study, we analyzed the nuclear localization and expression of H3.1 to elucidate the role of this histone variant in chromatin remodeling during oogenesis and preimplantation development. Analysis using Flag-tagged H3.1 transgenic mice revealed that Flag-H3.1 was not present in differentiated oocytes or early preimplantation embryos before the morula stage, although Flag-H3.1 mRNA was expressed at all stages examined. In addition, the expression levels of endogenous H3.1 genes were low at the stages where H3.1 was not present in chromatin. These results suggest that H3.1 is not incorporated into chromatin due to the inactivity of the histone chaperone and low mRNA expression level. The significance of the dynamics of H3.1 is evaluated in terms of chromatin remodeling that takes place during development. -
Discovery of Recurrent Structural Variants in Nasopharyngeal Carcinoma
Method Discovery of recurrent structural variants in nasopharyngeal carcinoma Anton Valouev,1,5,6 Ziming Weng,2,3,5 Robert T. Sweeney,2 Sushama Varma,2 Quynh-Thu Le,4 Christina Kong,2 Arend Sidow,2,3,6 and Robert B. West2,6 1Division of Bioinformatics, Department of Preventive Medicine, University of Southern California Keck School of Medicine, Los Angeles, California 90087, USA; 2Department of Pathology, Stanford University School of Medicine, Stanford, California 94305, USA; 3Department of Genetics, Stanford University School of Medicine, Stanford, California 94305, USA; 4Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California 94305, USA We present the discovery of genes recurrently involved in structural variation in nasopharyngeal carcinoma (NPC) and the identification of a novel type of somatic structural variant. We identified the variants with high complexity mate-pair libraries and a novel computational algorithm specifically designed for tumor-normal comparisons, SMASH. SMASH combines signals from split reads and mate-pair discordance to detect somatic structural variants. We demonstrate a >90% validation rate and a breakpoint reconstruction accuracy of 3 bp by Sanger sequencing. Our approach identified three in-frame gene fusions (YAP1-MAML2, PTPLB-RSRC1, and SP3-PTK2) that had strong levels of expression in corre- sponding NPC tissues. We found two cases of a novel type of structural variant, which we call ‘‘coupled inversion,’’ one of which produced the YAP1-MAML2 fusion. To investigate whether the identified fusion genes are recurrent, we performed fluorescent in situ hybridization (FISH) to screen 196 independent NPC cases. We observed recurrent rearrangements of MAML2 (three cases), PTK2 (six cases), and SP3 (two cases), corresponding to a combined rate of structural variation re- currence of 6% among tested NPC tissues. -
Carcinoma Discovery of Recurrent Structural Variants in Nasopharyngeal
Downloaded from genome.cshlp.org on February 28, 2014 - Published by Cold Spring Harbor Laboratory Press Discovery of recurrent structural variants in nasopharyngeal carcinoma Anton Valouev, Ziming Weng, Robert T. Sweeney, et al. Genome Res. 2014 24: 300-309 originally published online November 8, 2013 Access the most recent version at doi:10.1101/gr.156224.113 Supplemental http://genome.cshlp.org/content/suppl/2013/11/21/gr.156224.113.DC1.html Material References This article cites 44 articles, 17 of which can be accessed free at: http://genome.cshlp.org/content/24/2/300.full.html#ref-list-1 Creative This article is distributed exclusively by Cold Spring Harbor Laboratory Press for the Commons first six months after the full-issue publication date (see License http://genome.cshlp.org/site/misc/terms.xhtml). After six months, it is available under a Creative Commons License (Attribution-NonCommercial 3.0 Unported), as described at http://creativecommons.org/licenses/by-nc/3.0/. Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here. To subscribe to Genome Research go to: http://genome.cshlp.org/subscriptions © 2014 Valouev et al.; Published by Cold Spring Harbor Laboratory Press Downloaded from genome.cshlp.org on February 28, 2014 - Published by Cold Spring Harbor Laboratory Press Method Discovery of recurrent structural variants in nasopharyngeal carcinoma Anton Valouev,1,5,6 Ziming Weng,2,3,5 Robert T. Sweeney,2 Sushama Varma,2 Quynh-Thu Le,4 Christina Kong,2 Arend Sidow,2,3,6 and Robert B. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name histone cluster 1, H3h Gene Symbol Hist1h3h Organism Mouse Gene Summary Description Not Available Gene Aliases H3-291 RefSeq Accession No. NC_000079.6, NT_039578.8 UniGene ID Mm.377874 Ensembl Gene ID ENSMUSG00000069312 Entrez Gene ID 319152 Assay Information Unique Assay ID qMmuCEP0060016 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000091754 Amplicon Context Sequence CCTCGTGGGTCTGTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT CACCATCATGCCCAAGGACATCCAGCTGGCCCGCCGCATCCGCGGGGAGAGGG CTTAAAGTTCGTCTTTCTGTGTTTTTCAAAGGCTC Amplicon Length (bp) 112 Chromosome Location 13:21717958-21718099 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 102 R2 0.9998 cDNA Cq 23.18 cDNA Tm (Celsius) 88 gDNA Cq 24.47 Specificity (%) 92.12 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Hist1h3h, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. -
CRTC1/MAML2 Gain-Of-Function Interactions with MYC Create A
CRTC1/MAML2 gain-of-function interactions with MYC PNAS PLUS create a gene signature predictive of cancers with CREB–MYC involvement Antonio L. Amelioa,1, Mohammad Fallahib, Franz X. Schauba, Min Zhangc, Mariam B. Lawania, Adam S. Alpersteina, Mark R. Southernd, Brandon M. Younge, Lizi Wuf, Maria Zajac-Kayec,g, Frederic J. Kayec, John L. Clevelanda, and Michael D. Conkrighta,d,2 aDepartment of Cancer Biology, bIT Informatics, dTranslational Research Institute and Department of Molecular Therapeutics, and eGenomics Core, The Scripps Research Institute, Jupiter, FL 33458; and Departments of cMedicine, fMolecular Genetics and Microbiology, and gAnatomy and Cell Biology, Shands Cancer Center, University of Florida, Gainesville, FL 32610 Edited* by Marc Montminy, The Salk Institute for Biological Studies, La Jolla, CA, and approved July 8, 2014 (received for review October 11, 2013) Chimeric oncoproteins created by chromosomal translocations are histology. As such, these are a class of epithelial cell malignancies among the most common genetic mutations associated with tu- that originate from mucous/serous glands present at different morigenesis. Malignant mucoepidermoid salivary gland tumors, as locations in the body (6, 8–15). well as a growing number of solid epithelial-derived tumors, can The genesis of these adult solid tumors was thought to be due arise from a recurrent t (11, 19)(q21;p13.1) translocation that gen- to the direct activation of both CREB and NOTCH/RBPJ, the erates an unusual chimeric cAMP response element binding protein transcription factor targets of the CRTC1 and MAML2 coac- (CREB)-regulated transcriptional coactivator 1 (CRTC1)/mastermind- tivators involved in the t (11, 19) translocation, respectively like 2 (MAML2) (C1/M2) oncoprotein comprised of two transcrip- (6, 15).