DOCSLIB.ORG

The Expression and Nuclear Deposition of Histone H3.1 In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Expression and Nuclear Deposition of Histone H3.1 In Journal of Reproduction and Development, Vol. 58, No 5, 2012 —Original Article— The Expression and Nuclear Deposition of Histone H3.1 in Murine Oocytes and Preimplantation Embryos Machika KAWAMURA1), Tomohiko AKIYAMA1)#, Satoshi TSUKAmoto2), Masataka G. SUZUKI1) and Fugaku AokI1) 1)Department of Integrated Biosciences, Graduate School of Frontier Sciences, University of Tokyo, Chiba 277-8562, Japan 2)Laboratory of Animal and Genome Science Section, National Institute of Radiological Sciences, Chiba 263-8555, Japan #Present: Laboratory of Genetics, NIH Biomedical Research Center, Baltimore, MD 21224, U.S.A. Abstract. Differentiated oocytes acquire totipotency through fertilization. During this transition, genome-wide chromatin remodeling occurs, which leads to change in gene expression. However, the mechanism that underlies this global change in chromatin structure has not been fully elucidated. Histone variants play a key role in defining chromatin structure and are implicated in inheritance of epigenetic information. In this study, we analyzed the nuclear localization and expression of H3.1 to elucidate the role of this histone variant in chromatin remodeling during oogenesis and preimplantation development. Analysis using Flag-tagged H3.1 transgenic mice revealed that Flag-H3.1 was not present in differentiated oocytes or early preimplantation embryos before the morula stage, although Flag-H3.1 mRNA was expressed at all stages examined. In addition, the expression levels of endogenous H3.1 genes were low at the stages where H3.1 was not present in chromatin. These results suggest that H3.1 is not incorporated into chromatin due to the inactivity of the histone chaperone and low mRNA expression level. The significance of the dynamics of H3.1 is evaluated in terms of chromatin remodeling that takes place during development. Key words: H3.1, H3 variants, Oocyte, Preimplantation embryo, Reprogramming (J. Reprod. Dev. 58: 557–562, 2012) ifferentiated gametes, eggs and sperm, acquire totipotency is incorporated into chromatin by histone regulator A (HIRA) and Dthrough fertilization [1, 2]. During this developmental process, DAXX-ATRX [9, 11–13]. Since each H3 variant is associated with genome-wide chromatin remodeling takes place that alters the gene different histone modifications and genome regions, this suggests that expression pattern and begins differentiation [1–3]. This chromatin each variant serves a unique role in chromatin structure [6, 7, 10]. remodeling is essential in erasing previous epigenetic markers Although H3.3 and its role in chromatin remodeling have been and forming and transmitting new ones to the next generation [1, extensively studied in different model organisms, the role of H3.1 is 4]. However, the mechanism that underlies this global change in not well known. For example, the dynamics of H3.3 during oogenesis chromatin structure during development has not been fully elucidated. and preimplantation development have been studied in mice [10, Recent studies have shown that in addition to histone modifications 14]. Although H3.3 is incorporated in oocytes, this histone variant and transcription factors, histone variants play a key role in defining rapidly disappears and then reappears just after fertilization [10]. and altering chromatin structure [5]. Nucleosomes consist of 4 different Defects in heterochromatin formation have been reported in embryos histones, H2A, H2B, H3 and H4. Notably, the association between H3 expressing mutated H3.3 [14]. In addition, in Arabidopsis, H3.3 is variants and chromatin remodeling has been extensively studied. In present in both gametes but rapidly disappears after fertilization, mammals, there are five histone H3 variants, i.e., centromere-specific and only the paternal H3.3 remains in the zygote [15]. Finally, CENP-A, testis-specific H3.1t and three major H3 variants, H3.1, H3.3 is associated with decondensation of the paternal genome after H3.2 and H3.3 [6–9]. H3.1 and H3.2, which differ by 1 amino acid, fertilization in Drosophila melanogaster [16]. Consequently, these are canonical histones expressed and incorporated into chromatin in altogether suggest that H3.3 is essential for chromatin remodeling a DNA replication-dependent manner. Although H3.1 and H3.2 are and for acquiring a totipotent characteristic in 1-cell embryos, but associated with heterochromatin, they differ in histone modifications little is known about the role of H3.1 in chromatin remodeling before [6–8]. In contrast, H3.3 is expressed and incorporated into chromatin and after fertilization. throughout the cell cycle and is associated with euchromatin [6, 8, In this study, we analyzed the nuclear localization and expression 10]. H3.1 is deposited into chromatin via the histone chaperone of H3.1 to elucidate the role of this histone variant in chromatin called chromatin assembly factor 1 (CAF-1) [9–11], whereas H3.3 remodeling during oogenesis and preimplantation development. H3 variants are similar in amino acid sequence, and currently, there are no antibodies that recognize each variant. Therefore, we generated Received: April 20, 2012 Flag-tagged H3.1 transgenic mice that ubiquitously express Flag-H3.1 Accepted: May 15, 2012 Published online in J-STAGE: June 14, 2012 to analyze the presence of Flag-H3.1 in the chromatin. In addition, ©2012 by the Society for Reproduction and Development the expression of H3.1 genes was analyzed. Finally, the biological Correspondence: F Aoki (e-mail: [email protected]) significance and mechanisms concerning nuclear incorporation of 558 KAWAMURA et al. H3.1 are discussed. Tween 20 (MP Biomedicals, Solon, OH, U.S.A.) overnight at 4 C. After being washed in 1% BSA/PBS three times, they were incubated Materials and Methods with the Alexa Fluor 488-conjugated mouse IgG secondary antibody diluted 1:100 with 1% BSA/PBS containing 0.2% Tween 20 for 1 h at Transgenic mouse room temperature. The cells were then mounted on VECTASHIELD The pCAGGS vector [17], which contains the CAG promoter (Vector Laboratories, Burlingame, CA, U.S.A.), an anti-bleaching and a 3’UTR region of rabbit β-globin, was used to generate CAG reagent, and were observed using a confocal laser scanning microscope promoter-driven Flag-tagged H3.1 transgenic mice. For microinjection, (Carl Zeiss 510, Oberkochen, Germany). the transgene was diluted to 4 ng/μl in Tris/EDTA buffer (pH7.5) and microinjected into the pronucleus of C57 BL/6 1-cell embryos (Japan Reverse transcription PCR (RT-PCR) SLC, Shizuoka, Japan). One day after microinjection, normal 2-cell For RT-PCR analyses to detect the expression of Flag-H3.1 embryos were collected and transferred to day 0.5 pseudopregnant transgene, 10 oocytes/embryos were placed in 400 μl ISOGEN ICR (MCH) females (Japan SLC). Thirty-four mice were screened, (Nippon Gene, Tokyo, Japan). RNA was extracted by following the and seven of them were positive for the transgene. The founder manufacturer’s protocol (Nippon Gene), and reverse transcription transgenic mouse was backcrossed twice with C57 BL/6 female was carried out with an Oligo dT Primer using a PrimeScript RT- mice (Japan SLC). The pups were subjected to genotyping of the PCR Kit (TaKaRa, Shiga, Japan). PCR was carried out using Ex transgene by PCR. Taq DNA Polymerase (TaKaRa) and 0.4 oocytes/embryos cDNA in a tube as a template. Flag-H3.1 was detected with the follow- Oocyte collection ing primers: 5’ATGACGACGATAAGGGAGGA3’ (forward) and Growing oocytes were collected from nine-day-old mice. The 5’CTCGGTCGACTTCTGGTAGC3’ (reverse). PCR conditions were ovaries were dissected in HEPES-buffered KSOM (potassium as follows: 95 C for 30 sec (denaturation), 57 C for 30 sec (annealing) simplex optimized medium) [18]. The ovaries were further dissected and then 72 C for 30 sec (elongation). Fifty pg of Rabbit α-globin after trypsin treatment to obtain additional growing oocytes. The mRNA (Sigma-Aldrich) was added into the samples before RNA growing oocytes were placed in α-minimum essential medium extraction as an external control and was detected with the following (Gibco BRL, Grand Island, NY, U.S.A.) supplemented with 5% primers: 5’GTGGGACAGGAGCTTGAAAT3’ (forward) and 5’ fetal bovine serum (Sigma-Aldrich, St. Louis, MO, U.S.A.) and 10 GCAGCCACGGTGGCGAGTAT3’ (reverse). The PCR conditions ng/μl epidermal growth factor (Invitrogen, Carlsbad, CA, U.S.A.) were: 95 C for 20 sec (denaturation), 58 C for 30 sec (annealing), until use for immunocytochemistry or RT-PCR analysis. Full-grown and 72 C for 30 sec (elongation). oocytes were collected from three- to five-week-old mice 48 h after For real-time PCR analyses to examine the expression levels of injection of 5 IU pregnant mare’s serum gonadotropin (PMSG; Aska endogenous histone H3 variants, 40 oocytes/embryos from three- Pharmaceutical, Tokyo, Japan). week-old ddY mice (Japan SLC) were placed in 400 μl ISOGEN (Nippon Gene), and RNA was extracted. The contaminated DNA In vitro fertilization and embryo culture was digested with DNase I (Promega, Madison, WI, U.S.A.) for 40 To obtain mature metaphase II (MII) oocytes, three- to five-week- min at 37 C, and then RNA was purified with phenol/chloroform or old mice were superovulated by injection of 5 IU of human chorionic ISOGEN. Primers were based on the common sequences of several gonadotropin (hCG; Aska Pharmaceutical) 48 h after injection of genes encoding H3.1 as well as to the individual sequences of H3.1 PMSG. The oocytes were collected in human tubal fluid (HTF) genes (Table 1). The primers of common sequences in each of H3.2 medium [19] from the ampulla of the oviduct 16 h after injection and H3.3 were also prepared. Two-step PCR reactions were carried of hCG. Sperm was collected from ICR mice (Japan SLC). In vitro out with the following conditions using a Thermal Cycler Dice Real fertilization was carried out in the HTF medium by fertilizing the Time System (TaKaRa): 95 C for 5 sec (denaturation) and 60 C for MII stage oocytes with the sperm, which had been preincubated 30 sec (annealing/elongation).
Load more

Recommended publications
  • Gene Expression Imputation Across Multiple Brain Regions Provides Insights Into Schizophrenia Risk
    VU Research Portal Gene expression imputation across multiple brain regions provides insights into schizophrenia risk iPSYCH-GEMS Schizophrenia Working Group; CommonMind Consortium; The Schizophrenia Working Group of the PsyUniversity of Copenhagenchiatric Genomics Consortium published in Nature Genetics 2019 DOI (link to publisher) 10.1038/s41588-019-0364-4 document version Publisher's PDF, also known as Version of record document license Article 25fa Dutch Copyright Act Link to publication in VU Research Portal citation for published version (APA) iPSYCH-GEMS Schizophrenia Working Group, CommonMind Consortium, & The Schizophrenia Working Group of the PsyUniversity of Copenhagenchiatric Genomics Consortium (2019). Gene expression imputation across multiple brain regions provides insights into schizophrenia risk. Nature Genetics, 51(4), 659–674. https://doi.org/10.1038/s41588-019-0364-4 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. E-mail address: [email protected] Download date: 28.
    [Show full text]
  • Description: Uniprot:P68431 Alternative Names：
    TA0863 Histone H3 Antibody Order 021-34695924 [email protected] Support 400-6123-828 50ul [email protected] 100 uL √ √ Web www.ab-mart.com.cn Description: Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post- translational modifications of histones, also called histone code, and nucleosome remodeling. Uniprot:P68431 Alternative Names： H3 histone family, member A; H3/A; H31_HUMAN; H3FA; Hist1h3a; HIST1H3B; HIST1H3C; HIST1H3D; HIST1H3E; HIST1H3F; HIST1H3G; HIST1H3H; HIST1H3I; HIST1H3J; histone 1, H3a; Histone cluster 1, H3a; Histone H3.1; Histone H3/a; Histone H3/b; Histone H3/c; Histone H3/d; Histone H3/f; Histone H3/h; Histone H3/i; Histone H3/j; Histone H3/k; Histone H3/l; ;H3.3A; HIST1 cluster, H3E; H3 histone family, member A; H3.1; H3/l; H3F3; H3FF; H3FJ; H3FL; Histone gene cluster 1, H3 histone family, member E; histone H3.1t; Histone H3/o; FLJ92264; H 3; H3; H3 histone family, member B; H3 histone family, member C; H3 histone family, member D; H3 histone family, member F; H3 histone family, member H; H3 histone family, member I; H3 histone family, member J; H3 histone family, member K; H3 histone family, member L; H3 histone family, member T; H3 histone, family 3A; H3/A; H3/b; H3/c; H3/d; h3/f; H3/h; H3/i; H3/j; H3/k; H3/t; H31_HUMAN; H3F1K;
    [Show full text]
  • Snf2h-Mediated Chromatin Organization and Histone H1 Dynamics Govern Cerebellar Morphogenesis and Neural Maturation
    ARTICLE Received 12 Feb 2014 | Accepted 15 May 2014 | Published 20 Jun 2014 DOI: 10.1038/ncomms5181 OPEN Snf2h-mediated chromatin organization and histone H1 dynamics govern cerebellar morphogenesis and neural maturation Matı´as Alvarez-Saavedra1,2, Yves De Repentigny1, Pamela S. Lagali1, Edupuganti V.S. Raghu Ram3, Keqin Yan1, Emile Hashem1,2, Danton Ivanochko1,4, Michael S. Huh1, Doo Yang4,5, Alan J. Mears6, Matthew A.M. Todd1,4, Chelsea P. Corcoran1, Erin A. Bassett4, Nicholas J.A. Tokarew4, Juraj Kokavec7, Romit Majumder8, Ilya Ioshikhes4,5, Valerie A. Wallace4,6, Rashmi Kothary1,2, Eran Meshorer3, Tomas Stopka7, Arthur I. Skoultchi8 & David J. Picketts1,2,4 Chromatin compaction mediates progenitor to post-mitotic cell transitions and modulates gene expression programs, yet the mechanisms are poorly defined. Snf2h and Snf2l are ATP-dependent chromatin remodelling proteins that assemble, reposition and space nucleosomes, and are robustly expressed in the brain. Here we show that mice conditionally inactivated for Snf2h in neural progenitors have reduced levels of histone H1 and H2A variants that compromise chromatin fluidity and transcriptional programs within the developing cerebellum. Disorganized chromatin limits Purkinje and granule neuron progenitor expansion, resulting in abnormal post-natal foliation, while deregulated transcriptional programs contribute to altered neural maturation, motor dysfunction and death. However, mice survive to young adulthood, in part from Snf2l compensation that restores Engrailed-1 expression. Similarly, Purkinje-specific Snf2h ablation affects chromatin ultrastructure and dendritic arborization, but alters cognitive skills rather than motor control. Our studies reveal that Snf2h controls chromatin organization and histone H1 dynamics for the establishment of gene expression programs underlying cerebellar morphogenesis and neural maturation.
    [Show full text]
  • Systemic Analysis of the DNA Replication Regulators Origin Recognition Complex in Lung Adenocarcinomas Identifes Prognostic and Expression Signifcance
    Systemic Analysis of the DNA Replication Regulators Origin Recognition Complex in Lung Adenocarcinomas Identies Prognostic and Expression Signicance Juan Chen University of South China Juan Zou University of South China Juan Zeng University of South China Tian Zeng University of South China Qi-hao Hu University of South China Jun-hui Bai University of South China Min Tang University of South China Yu-kun Li ( [email protected] ) University of South China https://orcid.org/0000-0002-8517-9075 Primary research Keywords: lung adenocarcinomas, ORC complex, public databases, prognostic value, comprehensive bioinformatics Posted Date: May 11th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-487176/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/24 Abstract Background: Origin recognition complex (ORC) 1, ORC2, ORC3, ORC4, ORC5 and ORC6, form a replication- initiator complex to mediate DNA replication, which play a key role in carcinogenesis, while their role in lung adenocarcinomas (LUAD) remains poorly understood. Methods: We conrmed the transcriptional and post-transcriptional levels, DNA alteration, DNA methylation, miRNA network, protein structure, PPI network, functional enrichment, immune inltration and prognostic value of ORCs in LUAD based on Oncomine, GEPIA, HPA, cBioportal, TCGA, GeneMANIA, Metascape, KM-plot, GENT2, and TIMER database. Results: ORC mRNA and protein were both enhanced obviously based on Oncomine, Ualcan, GEPIA, TCGA and HPA database. Furthermore, ORC1 and ORC6 have signicant prognostic values for LUAD patients based on GEPIA database. Protein structure, PPI network, functional enrichment and immune inltration analysis indicated that ORC complex cooperatively accelerate the LUAD development by promoting DNA replication, cellular senescence and metabolic process.
    [Show full text]
  • Genome-Wide Screen of Cell-Cycle Regulators in Normal and Tumor Cells
    bioRxiv preprint doi: https://doi.org/10.1101/060350; this version posted June 23, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Genome-wide screen of cell-cycle regulators in normal and tumor cells identifies a differential response to nucleosome depletion Maria Sokolova1, Mikko Turunen1, Oliver Mortusewicz3, Teemu Kivioja1, Patrick Herr3, Anna Vähärautio1, Mikael Björklund1, Minna Taipale2, Thomas Helleday3 and Jussi Taipale1,2,* 1Genome-Scale Biology Program, P.O. Box 63, FI-00014 University of Helsinki, Finland. 2Science for Life laboratory, Department of Biosciences and Nutrition, Karolinska Institutet, SE- 141 83 Stockholm, Sweden. 3Science for Life laboratory, Division of Translational Medicine and Chemical Biology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, S-171 21 Stockholm, Sweden To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that tumor and normal cells are differentially sensitive to loss of the histone genes transcriptional regulator CASP8AP2. In cancer cells, loss of CASP8AP2 leads to a failure to synthesize sufficient amount of histones in the S-phase of the cell cycle, resulting in slowing of individual replication forks. Despite this, DNA replication fails to arrest, and tumor cells progress in an elongated S-phase that lasts several days, finally resulting in death of most of the affected cells.
    [Show full text]
  • Histone-Related Genes Are Hypermethylated in Lung Cancer
    Published OnlineFirst October 1, 2019; DOI: 10.1158/0008-5472.CAN-19-1019 Cancer Genome and Epigenome Research Histone-Related Genes Are Hypermethylated in Lung Cancer and Hypermethylated HIST1H4F Could Serve as a Pan-Cancer Biomarker Shihua Dong1,Wei Li1, Lin Wang2, Jie Hu3,Yuanlin Song3, Baolong Zhang1, Xiaoguang Ren1, Shimeng Ji3, Jin Li1, Peng Xu1, Ying Liang1, Gang Chen4, Jia-Tao Lou2, and Wenqiang Yu1 Abstract Lung cancer is the leading cause of cancer-related deaths lated in all 17 tumor types from TCGA datasets (n ¼ 7,344), worldwide. Cytologic examination is the current "gold stan- which was further validated in nine different types of cancer dard" for lung cancer diagnosis, however, this has low sensi- (n ¼ 243). These results demonstrate that HIST1H4F can tivity. Here, we identified a typical methylation signature of function as a universal-cancer-only methylation (UCOM) histone genes in lung cancer by whole-genome DNA methyl- marker, which may aid in understanding general tumorigen- ation analysis, which was validated by The Cancer Genome esis and improve screening for early cancer diagnosis. Atlas (TCGA) lung cancer cohort (n ¼ 907) and was further confirmed in 265 bronchoalveolar lavage fluid samples with Significance: These findings identify a new biomarker for specificity and sensitivity of 96.7% and 87.0%, respectively. cancer detection and show that hypermethylation of histone- More importantly, HIST1H4F was universally hypermethy- related genes seems to persist across cancers. Introduction to its low specificity, LDCT is far from satisfactory as a screening tool for clinical application, similar to other currently used cancer Lung cancer is one of the most common malignant tumors and biomarkers, such as carcinoembryonic antigen (CEA), neuron- the leading cause of cancer-related deaths worldwide (1, 2).
    [Show full text]
  • A Yeast Phenomic Model for the Influence of Warburg Metabolism on Genetic Buffering of Doxorubicin Sean M
    Santos and Hartman Cancer & Metabolism (2019) 7:9 https://doi.org/10.1186/s40170-019-0201-3 RESEARCH Open Access A yeast phenomic model for the influence of Warburg metabolism on genetic buffering of doxorubicin Sean M. Santos and John L. Hartman IV* Abstract Background: The influence of the Warburg phenomenon on chemotherapy response is unknown. Saccharomyces cerevisiae mimics the Warburg effect, repressing respiration in the presence of adequate glucose. Yeast phenomic experiments were conducted to assess potential influences of Warburg metabolism on gene-drug interaction underlying the cellular response to doxorubicin. Homologous genes from yeast phenomic and cancer pharmacogenomics data were analyzed to infer evolutionary conservation of gene-drug interaction and predict therapeutic relevance. Methods: Cell proliferation phenotypes (CPPs) of the yeast gene knockout/knockdown library were measured by quantitative high-throughput cell array phenotyping (Q-HTCP), treating with escalating doxorubicin concentrations under conditions of respiratory or glycolytic metabolism. Doxorubicin-gene interaction was quantified by departure of CPPs observed for the doxorubicin-treated mutant strain from that expected based on an interaction model. Recursive expectation-maximization clustering (REMc) and Gene Ontology (GO)-based analyses of interactions identified functional biological modules that differentially buffer or promote doxorubicin cytotoxicity with respect to Warburg metabolism. Yeast phenomic and cancer pharmacogenomics data were integrated to predict differential gene expression causally influencing doxorubicin anti-tumor efficacy. Results: Yeast compromised for genes functioning in chromatin organization, and several other cellular processes are more resistant to doxorubicin under glycolytic conditions. Thus, the Warburg transition appears to alleviate requirements for cellular functions that buffer doxorubicin cytotoxicity in a respiratory context.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients.
    [Show full text]
  • Histone H3.1 (Human) Cell-Based ELISA Kit
    Histone H3.1 (Human) Cell-Based ELISA Kit Catalog # : KA2761 規格 : [ 1 Kit ] List All Specification Application Image Product Histone H3.1 (Human) Cell-Based ELISA Kit is an indirect enzyme-linked Qualitative Description: immunoassay for qualitative determination of Histone H3 expression in cultured cells. Reactivity: Human, Mouse, Rat Storage Store the kit at 4°C. Instruction: Protocol: Protocol Download Suitable Attached Cell, Loosely Attached Cell, Suspension Cell Sample: Label: HRP-conjugated Detection Colorimetric Method: Regulation For research use only (RUO) Status: Datasheet: Download Applications Qualitative HIST1H3A HIST1H3D HIST1H3C HIST1H3E HIST1H3I HIST1H3G HIST1H3J HIST1H3H HIST1H3B HIST1H3F Gene Information Entrez GeneID: 8350 Protein P68431 Accession#: Gene Name: HIST1H3A Gene Alias: H3/A,H3FA Gene histone cluster 1, H3a Description: Omim ID: 602810 Gene Ontology: Hyperlink Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a Page 1 of 6 2021/6/18 nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq Other H3 histone family, member A,histone 1, H3a Designations: Gene Information Entrez GeneID: 8351 Protein P68431 Accession#: Gene Name: HIST1H3D Gene Alias: H3/b,H3FB Gene histone cluster 1, H3d Description: Omim ID: 602811 Gene Ontology: Hyperlink Gene Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes.
    [Show full text]
  • Rap1-Mediated Chromatin and Gene Expression Changes at Senescence
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2019 Rap1-Mediated Chromatin And Gene Expression Changes At Senescence Shufei Song University of Pennsylvania Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biochemistry Commons, and the Cell Biology Commons Recommended Citation Song, Shufei, "Rap1-Mediated Chromatin And Gene Expression Changes At Senescence" (2019). Publicly Accessible Penn Dissertations. 3557. https://repository.upenn.edu/edissertations/3557 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/3557 For more information, please contact [email protected]. Rap1-Mediated Chromatin And Gene Expression Changes At Senescence Abstract ABSTRACT RAP1-MEDIATED CHROMATIN AND GENE EXPRESSION CHANGES AT SENESCENCE The telomeric protein Rap1 has been extensively studied for its roles as a transcriptional activator and repressor. Indeed, in both yeast and mammals, Rap1 is known to bind throughout the genome to reorganize chromatin and regulate gene transcription. Previously, our lab published evidence that Rap1 plays important roles in cellular senescence. In telomerase-deficient S. cerevisiae, Rap1 relocalizes from telomeres and subtelomeres to new Rap1 target at senescence (NRTS). This leads to two types of histone loss: Rap1 lowers global histone levels by repressing histone gene transcription and it also results in local nucleosome displacement at the promoters of the activated NRTS. Here, I examine mechanisms of site-specific histone loss by presenting evidence that Rap1 can directly interact with histone tetramers H3/H4, and map this interaction to a three-amino-acid-patch within the DNA binding domain. Functional studies are performed in vivo using a mutant form of Rap1 with weakened histone interactions, and deficient promoter clearance as well as blunted gene activation is observed, indicating that direct Rap1-H3/H4 interactions are involved in nucleosome displacement.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name histone cluster 1, H3h Gene Symbol Hist1h3h Organism Mouse Gene Summary Description Not Available Gene Aliases H3-291 RefSeq Accession No. NC_000079.6, NT_039578.8 UniGene ID Mm.377874 Ensembl Gene ID ENSMUSG00000069312 Entrez Gene ID 319152 Assay Information Unique Assay ID qMmuCEP0060016 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000091754 Amplicon Context Sequence CCTCGTGGGTCTGTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGCGTGT CACCATCATGCCCAAGGACATCCAGCTGGCCCGCCGCATCCGCGGGGAGAGGG CTTAAAGTTCGTCTTTCTGTGTTTTTCAAAGGCTC Amplicon Length (bp) 112 Chromosome Location 13:21717958-21718099 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 102 R2 0.9998 cDNA Cq 23.18 cDNA Tm (Celsius) 88 gDNA Cq 24.47 Specificity (%) 92.12 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Hist1h3h, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • High-Fat Diet Alters the Retinal Transcriptome in the Absence of Gut Microbiota
    cells Article High-Fat Diet Alters the Retinal Transcriptome in the Absence of Gut Microbiota David Dao 1, Bingqing Xie 2,3 , Urooba Nadeem 4, Jason Xiao 1, Asad Movahedan 5, Mark D’Souza 2, Vanessa Leone 6,7 , Seenu M. Hariprasad 1, Eugene B. Chang 7, Dinanath Sulakhe 3 and Dimitra Skondra 1,* 1 Department of Ophthalmology and Visual Science, University of Chicago, Chicago, IL 60637, USA; [email protected] (D.D.); [email protected] (J.X.); [email protected] (S.M.H.) 2 Center for Research Informatics, University of Chicago, Chicago, IL 60637, USA; [email protected] (B.X.); [email protected] (M.D.) 3 Department of Medicine, University of Chicago, Chicago, IL 60637, USA; [email protected] 4 Department of Pathology, University of Chicago, Chicago, IL 60637, USA; [email protected] 5 Department of Ophthalmology and Visual Science, Yale University School of Medicine, New Haven, CT 06437, USA; [email protected] 6 Department of Animal Biologics and Metabolism, University of Wisconsin, Madison, WI 53706, USA; [email protected] 7 Knapp Center for Biomedical Discovery, Department of Medicine, Microbiome Medicine Program, University of Chicago, Chicago, IL 60637, USA; [email protected] * Correspondence: [email protected] Abstract: The relationship between retinal disease, diet, and the gut microbiome has shown increasing importance over recent years. In particular, high-fat diets (HFDs) are associated with development and progression of several retinal diseases, including age-related macular degeneration (AMD) and Citation: Dao, D.; Xie, B.; Nadeem, diabetic retinopathy. However, the complex, overlapping interactions between diet, gut microbiome, U.; Xiao, J.; Movahedan, A.; D’Souza, and retinal homeostasis are poorly understood.
    [Show full text]