DOCSLIB.ORG

2006 Catalog

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
2006 Catalog Friends School of Minnesota Nonprofit Org. U.S. Postage 1365 Englewood Avenue PAID Saint Paul, MN 55104 Minneapolis, MN Permit No. 1767 TIME VALUE DATA If you have received a duplicate copy, please let us know, and pass the extra to a friend! North Star Originals 6 The Himalayan Saint Paul, Blue Poppy FROM 35W Minnesota FROM HWY 3 What’s “Native” LARPENTEUR AVENUE SNELLING AVE Mean When It Comes to Plants? Minnesota State Fair Friends School CLEVELAND AVE Plant Sale 280 COMMONWEALTH DAN PATCH MIDWAY PKWY P May 12, 13, 14, 2006 Friday,May 12 36 COMO AVENUE Cleveland 35W Snelling 11:00 A.M.–8:00 P.M. Larpenteur CANFIELD Saturday,May 13 State Fair Grandstand PLANT SALE 9:00 A.M.–8:00 P.M. Y 280 Como G PAR ER K N FROM 94 E Sunday,May 14 Friends School NOON P.M. The native Penstemon grandiflorus 12:00 –4:00 (Large-Flowered Beardtongue), 94 photographed in St. Paul’s At the State Fair Midway area during summer 2005. Grandstand 17th Annual Friends School Plant Sale May 12th, 13th and 14th, 2006 Friday 11:00 A.M.–8:00 P.M.• Saturday 9:00 A.M.–8:00 P.M. Sunday 12:00 NOON–4:00 P.M.Sunday is half-price day at the Minnesota State Fair Grandstand Friends School of Minnesota Thank you for supporting Friends School of Minnesota by purchasing plants at our sale. Friends School of Minnesota prepares children to embrace life, learning, and community with hope, skill, understanding, and creativity. We are committed to the Quaker values of peace, justice, simplicity and integrity. Located in Saint Paul near Hamline University, the school has a student body of 142 and a faculty of 16. Started by Quakers and peace activists in 1988, Friends School of Minnesota has main- tained a strong commitment to serving families of religious, ethnic and economic diversity. The school’s website address: www.fsmn.org Plant sale phone number: 651-917-0076 Visiting the Boes of Faribault Contents North Star Originals About the School . .2 What’s New . .2 BY CLEM NAGEL How to “Do” the Sale . .3 Saturday Vendor Fair . .4–5 Articles For lo, Container Plants . .10 the winter is past . Himalyan Blue Poppies . .25 the flowers appear North Star Originals . .1 on the earth, Poisonous Plants . .23 the time of singing Veggie Gardening . .27 has come, What’s “Native” Mean? . .26 and the voice of the turtledove Plants is heard in the land. Annual Flowers . .6–13 —Song of Solomon 2:12 Climbing Plants . .28–29 Daylilies . .34 Ferns . .35 Art and Mertyann Boe of North Star Seed & Nursery Fruit Trees . .17 Grasses . .22 lizabeth and I have volun- that grows annuals and perenni- Garden Perennials . .30–42 als from seeds and cuttings that teered at the Friends I have great faith Herbs . .18–19 School Plant Sale for sev- in a seed. Convince me are then sold, directly to retail that you have a seed Hosta . .32 eral years. What a great nurseries and greenhouses there, and I am prepared Lilies . .37 event! It’s a generous around the country. Looking at to expect wonders. Native Wildflowers . .43–45 resource for the community and a fantas- these miniscule plants in their E —Henry D. Thoreau Rare Plants . .24–25 tic fundraiser that supports the school. warm greenhouse home in the Roses . .13 This winter we became involved in a behind-the- middle of winter emphasized for us the amount of Shrubs . .14–16 scenes aspect of the Plant Sale, in which we helped labor involved to grow a plant to market-size. Takes Trees . .17 choose some the varieties for the 2006 Sale. What a lot of pure faith to imagine them getting big Vegetables . .20–21 an eye-opener for us…and lots of fun! enough to look like something that people actually Water Plants . .39 On a Friday in mid-January, we accompanied want to buy. Faith (and experience) is what Henry Woodland Wildflowers . .45 Henry on one of his “plant buying trips.” We went has. And his enthusiasm is contagious! to visit a wholesaler, North Star Seed & Nursery, continued on page 27 Common Name Index . .46 More articles on pages 10, 23, 25, 26 and 27 Latin Name Index . .47 2 Friends School Plant Sale • 2006 About Friends School By Mark Niedermier hank you for looking to Friends A: Friends School is guided by the School for your gardening needs. principles of progressive education. We TOur annual Plant Sale, now in its believe that children learn best when 17th year, has staked out a unique place they work actively to solve problems and among Minnesota gardening events. collaborate with others. We encourage We’re really glad that you have chosen to students to observe the world directly, join us. read, conduct experiments, and ask Many people who shop at the plant questions. Then we ask them to express sale wonder about the school that puts it what they’re learning through writing, on: What is Friends School of speaking, acting, creating visual art, Minnesota? Here are some common making music, and teaching others. questions and answers about FSM. There is a special emphasis on the com- I hope they help you understand us a bit munity life of the classroom and school more, and maybe even consider us for because we view this as preparation for your children’s school. children to participate actively in demo- cratic life as adults. Q: How many students and what grades do Q: Are you a religious school? you have? Q: What are the profits of the Plant Sale used A: Yes, we are affiliated with the A: We enroll around 142 students in for? Religious Society of Friends—better grades kindergarten through eight. The A: Last year’s profit was approximate- known as Quakers. About 20 percent of average lower school (grades K–4) class- ly $110,000. We hope to do even better our students come from Quaker families. room has about 18 students and the this year. All profit directly supports the The other students come from a wide average middle school (grades 5–8) school program, particularly our need- variety of religious denominations, but classroom has about 18–20 students. based financial aid program. Over our their families share an affinity with the school’s 18-year history, we have provid- Q: Where is Friends School located? ethical culture of Friends School. ed over $2 million in need-based We are located near the intersection Q: What is the mission of Friends School? financial aid. Each purchase you make at of Hamline and Englewood Avenues in A: Friends School of Minnesota the Plant Sale helps to ensure that a the Hamline-Midway area of St. Paul, prepares children to embrace life, learn- Friends School education is available to about a mile southeast of the Plant ing, and community with hope, skill, children regardless of a family’s ability Sale’s State Fairgrounds location. About understanding, and creativity. We are to pay. 50 percent of our students come from St. committed to the Quaker values of Paul, about 40 percent from I hope these few points are a helpful Mark Niedermier is Head peace, justice, simplicity, and integrity. Minneapolis, and the remaining 10 start for learning about Friends School. of School at Friends percent from throughout the metro area. Q: What is the school’s educational Thank you for your support! School of Minnesota. philosophy? YearTwo at the Grandstand Key s we get ready for the 17th This year, as costs have continued to Saturday Shipments Í Full sun Friends School of Minnesota rise for the greenhouses (how was your If you haven’t been to the Plant Sale ∏ Part sun/part shade APlant Sale, there’s a lot of news heating bill?), we have made the deci- on Saturday morning in the last few Ó Shade to share. sion to raise the price of the $1 perenni- years, you may not know that we’ve been ˜ Native als to $1.50. The good news is that the restocking. So just because something ˝ How Grand Was the Grandstand? Ground cover plants from the newer grower, which sells out on Friday doesn’t mean we ‰ Most of the shoppers we heard from Rock garden were $2, are now also $1.50—less con- won’t have more. We have provided a ´ Edible flowers thought the move to the Grandstand was fusing for everyone, and we hope, on new notation in the catalog (ß), which  Medicinal a success. We were all a lot drier and average, about the same level of bargain indicates whether a restocking shipment Ç Culinary usually warmer, even though the building for you, our customers. is expected on Saturday. Remember, ß Saturday restock is unheated! The bathrooms were a hit restocking happens early on Saturday and the aisles were wider…the solid floor Shrubs and Trees on Parade (before the sale opens for the day), so the About the made it easier to move, and the fact that We went a little crazy with the shrubs newly arrived plants may be gone if you alphabet we could forego using hay meant fewer this year. In case you haven’t thought arrive later in the day. Throughout, we have allergic reactions and an easier passage about shrubs or trees for your yard, this tried to alphabetize for everyone. might be the year to plant some of these Sunday Is Half-Price by the main common We did learn a lot of ways we could lower-maintenance beauties, which can name of each plant, Once again, all remaining plants will with variant common improve from last year, as you might bring structure to your garden and often be sold at half price on Sunday, from names following the expect.
Load more

Recommended publications
  • Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: a Review
    Available online at www.ijpab.com Dhakar and Soni Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) ISSN: 2320 – 7051 DOI: http://dx.doi.org/10.18782/2320-7051.5192 ISSN: 2320 – 7051 Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) Review Article Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: A Review Sunita Dhakar1* and Anjali Soni2 1Division of Floriculture and Landscaping, ICAR- IARI, New Delhi 110012, India 2Division of Fruits and Horticultural Technology, ICAR-IARI, New Delhi 110012, India *Corresponding Author E-mail: [email protected] Received: 11.07.2017 | Revised: 19.08.2017 | Accepted: 26.08.2017 ABSTRACT Flower colours are of paramount importance in the ecology of plants and their ability to attract pollinators and seed dispersing organisms. The primary pigments occurring in plants are chlorophylls and carotenoids accumulated in plastids, anthocyanins and betalains, which are dissolved in vacuolar sap. Flavonoids and carotenoids are widely distributed in plant pigments. Among the factors influencing flower colour, anthocyanin biosynthesis has been the most extensively studied. Each plant species usually accumulates limited kinds of anthocyanins and exhibits limited flower colour. For example, roses and carnations lack violet/blue colour because they do not accumulate delphinidin-based anthocyanins and petunia and cymbidium lack brick red/orange colour due to the lack of pelargonidin-based anthocyanins. Different approaches are used for development of novel flower colour in floricultural crops like hybridization, mutation and genetic engineering. Advances in molecular biology and plant transformation technology have made possible the engineering of an anthocyanin biosynthetic pathway by the overexpression of heterologous flavonoid biosynthetic genes or the down-regulation of endogenous genes in transgenic plants.
    [Show full text]
  • International Union for the Protection of New Varieties of Plants
    E TG/ZINNIA(proj.9) ORIGINAL: English DATE: 2021-04-23 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS Geneva DRAFT * ZINNIA UPOV Code(s): ZINNI_AEL; ZINNI_ANG; ZINNI_ELE; ZINNI_HAA; ZINNI_PER Zinnia × marylandica D. M. Spooner et al.; Zinnia angustifolia Kunth; Zinnia elegans Jacq.; Zinnia haageana Regel; Zinnia peruviana (L.) L. GUIDELINES FOR THE CONDUCT OF TESTS FOR DISTINCTNESS, UNIFORMITY AND STABILITY prepared by experts from Mexico to be considered by the Technical Working Party for Ornamental Plants and Forest Trees at its fifty-third session, to be held in Roelofarendsveen, Netherlands, from 2021-06-07 to 2021-06-11 Disclaimer: this document does not represent UPOV policies or guidance Alternative names:* Botanical name English French German Spanish Zinnia ×marylandica D. M. Spooner et al. Zinnia angustifolia Zinnia naranja Kunth Zinnia elegans Jacq., Youth and age, Zinnia élégant Zinnie Rascamoño, Zinnia, Zinnia violacea Cav. Youth-and-old-age Miguelito Zinnia haageana Regel Zinnia Mexicana Zinnia peruviana (L.) L. Field zinnia, Mal de ojo Peruvian zinnia, Wild zinnia The purpose of these guidelines (“Test Guidelines”) is to elaborate the principles contained in the General Introduction (document TG/1/3), and its associated TGP documents, into detailed practical guidance for the harmonized examination of distinctness, uniformity and stability (DUS) and, in particular, to identify appropriate characteristics for the examination of DUS and production of harmonized variety descriptions. ASSOCIATED DOCUMENTS These Test Guidelines should be read in conjunction with the General Introduction and its associated TGP documents. * These names were correct at the time of the introduction of these Test Guidelines but may be revised or updated.
    [Show full text]
  • SUPPLEMENTARY TABLES LIST of TABLES 1 List of Universal and Diagnostic Primer
    SUPPLEMENTARY TABLES LIST OF TABLES 1 List of universal and diagnostic primer . .1 3 Genbank sequence accessions (cytoplasmic) . .1 4 Genbank sequence accessions (nuclear) . .2 2 List of secondary specimens (lemongrass and carnation) . .5 5 Anatomical diagnostic key . .6 6 BLOG bamboo tribe classification results . .7 Table 1. List of universal and diagnostic (ARMS) primer used in the current study. The table includes primer names and sequences, melting temperatures (Tm) of each individual primer, the annealing temperatures (An) for each primer pair and references to corresponding publications. Name Sequence (5’...3’) Tm (◦C) An (◦C) Design rbcLa fu ATGTCACCACAAACAGAGACTAAAGC 62.2 58 Kondo et al. [1996] rbcLa revu GTAAAATCAAGTCCACCRCG 74.7 Fofana et al. [1997] rbcLb-Sfu AGACCTTTTTGAAGAAGGTTCTGT 62.2 55 Dong et al. [2014] rbcLb-Sru TCGGTCAGAGCAGGCATATGCCA 74.7 1R KIM ru ACCCAGTCCATCTGGAAATCTTGGTTC 72.1 52 Ki-Joong Kimp 3F KIM fu CGTACAGTACTTTTGTGTTTACGAG 60.6 ITS5u GGAAGTAAAAGTCGTAACAAGG 58.4 56 White et al. [1990] ITS4u TCCTCCGCTTATTGATATGC 61.5 Bbo-C-407-rd AGGBGGRCCTSGRAAAGTTTTCGA 58.7 current study Dian-T-223-rd CGGGCTCGATGTGGTAGTAA 64.9 Cym-A-254-rd AGCTACATAACAGATATATTGATCAGG 59.5 d diagnostic primer (ARMS), destabilizing nucleotide underlined u universal primer p unpublished Table 3. GenBank sequence accessions of two plastid DNA regions (rbcL and matK) used in the current study. Taxon rbcL matK Arundinarieae Arundinaria gigantea subsp. tecta AJ746179 EF125165 Borinda emeryi EF125079 EF125167 Chimonobambusa marmorea AJ746176 EF125168 Drepanostachyum falcatum AJ746265 EF125170 Fargesia dracocephala AJ746266 KP685610 Fargesia sp. Asmussen AM110249 AM114722 Indocalamus latifolius AJ746177 EF125173 Phyllostachys aurea HE573324 AF164390 Phyllostachys bambusoides AB088833 AB088805 Phyllostachys nigra HE573325 EU434241 Pleioblastus maculatus JN247242 JN247148 Pseudosasa amabilis AJ746273 KP093752 Pseudosasa japonica FN870405 HG794001 Thamnocalamus spathiflorus EF125087 KP685639 Bambubseae Bambusa multiplex M91626 EF125166 1/7 Table 3.
    [Show full text]
  • Gardenergardener®
    Theh American A n GARDENERGARDENER® The Magazine of the AAmerican Horticultural Societyy January / February 2016 New Plants for 2016 Broadleaved Evergreens for Small Gardens The Dwarf Tomato Project Grow Your Own Gourmet Mushrooms contents Volume 95, Number 1 . January / February 2016 FEATURES DEPARTMENTS 5 NOTES FROM RIVER FARM 6 MEMBERS’ FORUM 8 NEWS FROM THE AHS 2016 Seed Exchange catalog now available, upcoming travel destinations, registration open for America in Bloom beautifi cation contest, 70th annual Colonial Williamsburg Garden Symposium in April. 11 AHS MEMBERS MAKING A DIFFERENCE Dale Sievert. 40 HOMEGROWN HARVEST Love those leeks! page 400 42 GARDEN SOLUTIONS Understanding mycorrhizal fungi. BOOK REVIEWS page 18 44 The Seed Garden and Rescuing Eden. Special focus: Wild 12 NEW PLANTS FOR 2016 BY CHARLOTTE GERMANE gardening. From annuals and perennials to shrubs, vines, and vegetables, see which of this year’s introductions are worth trying in your garden. 46 GARDENER’S NOTEBOOK Link discovered between soil fungi and monarch 18 THE DWARF TOMATO PROJECT BY CRAIG LEHOULLIER butterfl y health, stinky A worldwide collaborative breeds diminutive plants that produce seeds trick dung beetles into dispersal role, regular-size, fl avorful tomatoes. Mt. Cuba tickseed trial results, researchers unravel how plants can survive extreme drought, grant for nascent public garden in 24 BEST SMALL BROADLEAVED EVERGREENS Delaware, Lady Bird Johnson Wildfl ower BY ANDREW BUNTING Center selects new president and CEO. These small to mid-size selections make a big impact in modest landscapes. 50 GREEN GARAGE Seed-starting products. 30 WEESIE SMITH BY ALLEN BUSH 52 TRAVELER’S GUIDE TO GARDENS Alabama gardener Weesie Smith championed pagepage 3030 Quarryhill Botanical Garden, California.
    [Show full text]
  • Zinnia Peruviana (L.) L
    TAXON: Zinnia peruviana (L.) L. SCORE: 7.0 RATING: High Risk Taxon: Zinnia peruviana (L.) L. Family: Asteraceae Common Name(s): field zinnia Synonym(s): Chrysogonum peruvianum L. (basionym) Peruvian zinnia Zinnia pauciflora L. wild zinnia Zinnia tenuiflora Jacq. Zinnia verticillata Andrews Assessor: Assessor Status: Assessor Approved End Date: 20 Apr 2021 WRA Score: 7.0 Designation: H(HPWRA) Rating: High Risk Keywords: Annual Herb, Disturbance Weed, Wildflower, Self-Compatible, Wind-dispersed Qsn # Question Answer Option Answer 101 Is the species highly domesticated? y=-3, n=0 n 102 Has the species become naturalized where grown? 103 Does the species have weedy races? Species suited to tropical or subtropical climate(s) - If 201 island is primarily wet habitat, then substitute "wet (0-low; 1-intermediate; 2-high) (See Appendix 2) High tropical" for "tropical or subtropical" 202 Quality of climate match data (0-low; 1-intermediate; 2-high) (See Appendix 2) High 203 Broad climate suitability (environmental versatility) y=1, n=0 y Native or naturalized in regions with tropical or 204 y=1, n=0 y subtropical climates Does the species have a history of repeated introductions 205 y=-2, ?=-1, n=0 y outside its natural range? 301 Naturalized beyond native range y = 1*multiplier (see Appendix 2), n= question 205 y 302 Garden/amenity/disturbance weed n=0, y = 1*multiplier (see Appendix 2) y 303 Agricultural/forestry/horticultural weed n=0, y = 2*multiplier (see Appendix 2) n 304 Environmental weed 305 Congeneric weed 401 Produces spines, thorns or burrs y=1, n=0 n 402 Allelopathic y=1, n=0 n 403 Parasitic y=1, n=0 n 404 Unpalatable to grazing animals 405 Toxic to animals y=1, n=0 n 406 Host for recognized pests and pathogens 407 Causes allergies or is otherwise toxic to humans 408 Creates a fire hazard in natural ecosystems y=1, n=0 n Creation Date: 20 Apr 2021 (Zinnia peruviana (L.) L.) Page 1 of 16 TAXON: Zinnia peruviana (L.) L.
    [Show full text]
  • A Comprehensive Review of Phytoconstituents and Biological
    J. Adv. Biomed. & Pharm. Sci. 2 (2019) 29-37 Journal of Advanced Biomedical and Pharmaceutical Sciences Journal Homepage: http://jabps.journals.ekb.eg A comprehensive review of phytoconstituents and biological activities of genus Zinnia Alshymaa Abdel-Rahman Gomaa1 , Mamdouh Nabil Samy1* , Samar Yehia Desoukey1 , Mohamed Salah Kamel1,2 1 Department of Pharmacognosy, Faculty of Pharmacy, Minia University, 61519 Minia, Egypt 2 Department of Pharmacognosy, Faculty of Pharmacy, Deraya University, 61111 New Minia, Egypt Received: October 14, 2018; revised: November 21, 2018; accepted: November 29, 2018 Abstract Zinnia genus contains annual and perennial plants belonging to the family Asteraceae and comprising about 20 species native to South America. Zinnia species are used in folk medicine for the treatment of malaria and stomach pain and are used as hepatoprotective, antiparasitic, antifungal and antibacterial agents. Zinnia plants are well known ornamental plants with large, beautiful and attractive flowers. Many studies reported that Zinnia contains numerous secondary metabolites of different classes including sterols, flavonoids, sesquiterpenes, diterpenes and hydrocarbons. Zinnia plants are also reported to possess a wide range of biological effects such as antioxidant, hepatoprotective, cytotoxic, antibacterial, antifungal and insecticidal activities. This review potentiates the researchers for carrying out further studies on this genus to isolate and develop new drugs from natural sources with wide margin of safety and understanding their effects and possible mechanism of actions. Key words Asteraceae, Zinnia, phytochemical components, biological activities 1. Introduction from 1949 till 2018. All the reported data from pervious published researches are summarized and listed in two tables. Asteraceae (sunflower family) is considered the largest family of flowering plants that includes about 1600 genera and 2.1.
    [Show full text]
  • ZINNIA(Proj.8) ORIGINAL: English DATE: 2020-04-27
    E TG/ZINNIA(proj.8) ORIGINAL: English DATE: 2020-04-27 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS Geneva DRAFT * ZINNIA UPOV Code(s): ZINNI_ELE ; ZINNI_HAA ; ZINNI_PER ; ZINNI_ANG Zinnia elegans Jacq.; Zinnia haageana Regel; Zinnia peruviana (L.) L.; Zinnia angustifolia Kunth GUIDELINES FOR THE CONDUCT OF TESTS FOR DISTINCTNESS, UNIFORMITY AND STABILITY prepared by experts from Mexico to be considered by the Technical Working Party for Ornamental Plants and Forest Trees at its fifty-second session, to be held in Roelofarendsveen, Netherlands, from 2020-06-08 to 2020-06-12 Disclaimer: this document does not represent UPOV policies or guidance Alternative names:* Botanical name English French German Spanish Zinnia elegans Jacq., Youth and age, Youth- Zinnia élégant Zinnie Rascamoño, Zinnia, Zinnia violacea Cav. and-old-age Miguelito Zinnia haageana Regel Zinnia Mexicana Zinnia peruviana (L.) L. Field zinnia, Peruvian Mal de ojo zinnia, Wild zinnia Zinnia angustifolia Zinnia naranja Kunth The purpose of these guidelines (“Test Guidelines”) is to elaborate the principles contained in the General Introduction (document TG/1/3), and its associated TGP documents, into detailed practical guidance for the harmonized examination of distinctness, uniformity and stability (DUS) and, in particular, to identify appropriate characteristics for the examination of DUS and production of harmonized variety descriptions. ASSOCIATED DOCUMENTS These Test Guidelines should be read in conjunction with the General Introduction and its associated TGP documents. * These names were correct at the time of the introduction of these Test Guidelines but may be revised or updated. [Readers are advised to consult the UPOV Code, which can be found on the UPOV Website (www.upov.int), for the latest information.] TG/ZINNIA(proj.8) Zinnia, 2020-04-27 2 TABLE OF CONTENTS PAGE 1.
    [Show full text]
  • Yavapai Gardens
    University of Arizona Yavapai County Cooperative Extension Yavapai Gardens Master Gardener Newsletter April 2004 Zinnias by Nora Graf Events & Activities MG Association Meeting, Wednes- One of the unsung heroes of the summer day, April 20 6:30pm, Prescott. The garden is the zinnia. In a world domi- speaker will be Betty Billingsly-”Judging nated by masses of 6-packs of petunias, at the Fair” marigolds and salvias the zinnia is lim- ited to a mere flat or two pushed into a Yavapai Rose Society - ,April 18 2:30pm back corner of the garden center. Why? Special tour of Willow Creek Nursery. 1670 E. Zinnias come in a wide range of colors, Perkinsville Rd. For more information 928- shapes and sizes, so it can’t be that. They 771-9300. bloom and grow in very hot weather, so that’s not the reason. The Alta Vista Gardening Club, Prescott, fourth reason is they don’t tolerate modern commercial greenhouse condi- Tuesday of the month, 12:30pm. Call 928- tions and growing techniques. Zinnias are not fond of getting their 443-0464 for location and information. leaves wet and most commercial greenhouses use overhead sprin- klers. Nor do they like their roots disturbed, so it’s tough to trans- Prescott Area Gourd Society, third Tuesday of plant them out of 6-packs. The good news is that you can toss out a the month, 6:30 pm, at the Smoki Museum. few handsful of seeds and have a great summer display. Pond Club -this is an informal group that Zinnias come in all styles: there are types that resemble spider meets every couple of months, usually the 3rd dahlias, others that are small pom- poms and there are tall varieties week.
    [Show full text]
  • University of Montenegro Faculty of Sciences and Mathematics
    UNIVERSITY OF MONTENEGRO FACULTY OF SCIENCES AND MATHEMATICS PROTECTED AREA GAP ASSESSMENT WITH COMPREHENSIVE PLAN FOR A REPRESENTATIVE PAS (PROTECTED AREA SYSTEM) November, 2012th 1 PROJETC TEAM: DR DANILO MRDAK – Project leader, expert for fish, for conservation issues and for sustainable development DR DANKA CAKOVIĆ – Expert for botany and conservation issues MR SNEŽANA VUKSANOVIĆ – Expert for botany DR MARKO KARAMAN – Expert for invertebrate fauna DR RUŽA ĆIROVIĆ – Expert for herpetofauna MR NELA VEŠOVIĆ – DUBAK – Expert for bird fauna DR VESNA MAČIĆ – Expert on marine flora and fauna MR MARINA ĐUROVIĆ - Expert on mammal fauna DR SNEŽANA DRAGIĆEVIĆ – Expert on moss DR GORDANA KASOM – Expert on fungi DR DRAGANA MILOŠEVIĆ – Expert for conservation issues MR ANA KATNIĆ – Expert for sustainable development DR SEONA ANDERSON – International expert for conservation issues DR PREDRAG STANIŠIĆ - Expert for data basis MR MARJAN ERCEG – Expert for GIS 2 3 1. IDENTIFICATION, ASSESSING AND MAPPING OF HABITATS AND SPECIES DISTRIBUTION 1.1. Identification and assessing Experts for botany reviewed list of habitats related to Montenegro (lend and marine). They paid attention on habitats that were specified as important for Emerald network designation as well as to ones that were of interest for Yearly Monitoring of Biodiversity status 2011th. The Botany team identifies habitats that are either endangered or threatened as well as the ones that are rare or specific for Balkan nature. They produce check list of habitats that serve as a referent check
    [Show full text]
  • A History of Zinnias: Flower for the Ages
    Purdue University Purdue e-Pubs Purdue University Press Book Previews Purdue University Press 3-2020 A History of Zinnias: Flower for the Ages Eric Grissell Follow this and additional works at: https://docs.lib.purdue.edu/purduepress_previews Part of the Agriculture Commons, Botany Commons, Entomology Commons, and the Horticulture Commons This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. Copyright 2020 by Purdue University. All rights reserved. Printed in the United States of America. Cataloging-in-Publication Data is available at the Library of Congress. Hardback ISBN: 978-1-55753-906-9 ePub ISBN: 978-1-55753-907-6 ePDF ISBN: 978-1-55753-908-3 Cover image: Garden example of archetypal single Elegant Zinnia (Zinnia elegans), with strongly developed central cone of yellow disk flowers and a single outer row of ray petals. Each ray petal has a seed at its base. Compare with Photospread Fig. 17, an illustration of the original Elegant Zinnia described in 1792. Flower for the Ages Eric Grissell Purdue University Press West Lafayette, Indiana Contents Preface, vii 1 From Gilbert and Sullivan to Corvettes, 1 2 Starting in the Middle, 9 3 Search for the Historic Zinnia: New Spain and Old Legends, 17 4 Of Marigolds, Dahlias, and Zinnias, 33 5 Coming of Age: The European Period, 47 6 Homeward Bound: America, 67 7 Doubling Your Pleasure, 77 8 The Revolution, 89 9 Confusion Reigns, 107 10 Modern Times, or Sex to the Rescue, 131 11 In the Garden, 143 Acknowledgments, 155 Appendix 1.
    [Show full text]
  • 2017–2018 Seed Exchange Catalog MID-ATLANTIC GROUP He 24Th Annual Edition for the First Time
    The Hardy Plant Society/Mid-Atlantic Group 2017–2018 Seed Exchange Catalog MID-ATLANTIC GROUP he 24th annual edition for the first time. As you can tions and you will find plants of the Seed Exchange see, this seed program in- your garden can’t do with- TCatalog includes 933 cludes new plants not previ- out! Since some listed seed seed donations contributed ously offered as well as old is in short supply, you are en- by 58 gardeners, from begin- favorites. couraged to place your order ners to professionals. Over We’re sure you’ll enjoy early. 124 new plants were donated perusing this year’s selec- Our Seed Donors Catalog listed seed was generously contributed by our members. Where the initial source name is fol- lowed by “/”and other member names, the latter identifies those who actually selected, collected, cleaned, and then provided descriptions to the members who prepared the catalog. If a donor reported their zone, you will find it in parenthesis. Our sincere thanks to our donors—they make this Seed Exchange possible. Agard, Beverly 3448 (6) Doering, Alice 239 (6) Norfolk Botanical staff 1999 (8a) Aquascapes Unlimited Ellis, Barbara 269 Ogorek, Carrie 3462 (6b) / Heffner, Randy 1114 Garnett, Polly 318 Perron, William 3321 (6) Axel, Laura 3132 (7a) Gregg, John 3001 (7) Plant Delights, 32 Bartlett, John 45 Haas, Joan 1277 (6a) Richardson, Sharon 2688 Bennett, Teri 1865 (7) Humphrey, Donald & Lois 446 Rifici, Stephen 3540 (7) Berger, Clara 65 Jellinek, Susan 1607 (7a) Robinson, Barbara Paul 797 Berkshire Botanical Garden Jenkins Arboretum 9985 (7a) Roper, Lisa 9968 (7a) / Hviid, Dorthe 1143 (5b) Kolo, Fred 507 (7) Scott Arboretum 9995 Bittmann, Frank 2937 (6a) Kushner, Annetta 522 Silberstein, Steve 3436 (7a) Bowditch, Margaret 84 Leasure, Charles 543 (7a) Stonecrop Gardens, 118 (5a) Boylan, Rebecca 2137 (6b) Leiner, Shelley 549 (7a) Streeter, Mary Ann 926 Bricker, Matthew D.
    [Show full text]
  • ABSTRACT GU, YU. Cut Flower Production and Economic Analysis
    ABSTRACT GU, YU. Cut Flower Production and Economic Analysis, Polyploidy Induction in Two Zinnia Cultivars, Zinnia Pollination Mechanisms, and DNA Content of Zinnia Species. (Under the direction of Julia L. Kornegay.) Cut flower production is a small, but growing, segment of the North Carolina floriculture industries. In summer 2013, two field trials were conducted to help growers make informed decisions about their production practices. In the first study, two cut flower cultivars, zinnia Benary Giant ‘Scarlet’ and sunflower ‘Procut’, were evaluated for stem yield (number of stems harvested) and flower quality (stem length and flower diameter) under two planting methods (direct-seeded vs. transplanted) and plant densities (16 vs. 32 plants/plot) . In ‘Scarlet’, stem yield was significantly higher at the higher plant density, but there was no significant effect of planting density and planting method on flower quality. Significantly greater severity of powdery mildew (Erysiphe cichoracearum) was observed on zinnia at the higher plant density. Direct-seeded sunflower ‘Pro Cut’ had significantly longer stem lengths and larger flower diameters compared to the transplanted plants. In this study, the fixed costs of direct-seeded cut flower crops were higher than those of transplanted crops because only limited greenhouse space was used in producing the transplants. Growers are recommended to direct seed zinnia at the higher plant density for increased yield, but for disease management, lower densities can reduce the severity of powdery mildew. In ‘Procut’ sunflowers, planting method and density can be used to control flower size and stem length depending on market demands. In the second field study, season-long vs.
    [Show full text]