DOCSLIB.ORG

University of Montenegro Faculty of Sciences and Mathematics

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
University of Montenegro Faculty of Sciences and Mathematics UNIVERSITY OF MONTENEGRO FACULTY OF SCIENCES AND MATHEMATICS PROTECTED AREA GAP ASSESSMENT WITH COMPREHENSIVE PLAN FOR A REPRESENTATIVE PAS (PROTECTED AREA SYSTEM) November, 2012th 1 PROJETC TEAM: DR DANILO MRDAK – Project leader, expert for fish, for conservation issues and for sustainable development DR DANKA CAKOVIĆ – Expert for botany and conservation issues MR SNEŽANA VUKSANOVIĆ – Expert for botany DR MARKO KARAMAN – Expert for invertebrate fauna DR RUŽA ĆIROVIĆ – Expert for herpetofauna MR NELA VEŠOVIĆ – DUBAK – Expert for bird fauna DR VESNA MAČIĆ – Expert on marine flora and fauna MR MARINA ĐUROVIĆ - Expert on mammal fauna DR SNEŽANA DRAGIĆEVIĆ – Expert on moss DR GORDANA KASOM – Expert on fungi DR DRAGANA MILOŠEVIĆ – Expert for conservation issues MR ANA KATNIĆ – Expert for sustainable development DR SEONA ANDERSON – International expert for conservation issues DR PREDRAG STANIŠIĆ - Expert for data basis MR MARJAN ERCEG – Expert for GIS 2 3 1. IDENTIFICATION, ASSESSING AND MAPPING OF HABITATS AND SPECIES DISTRIBUTION 1.1. Identification and assessing Experts for botany reviewed list of habitats related to Montenegro (lend and marine). They paid attention on habitats that were specified as important for Emerald network designation as well as to ones that were of interest for Yearly Monitoring of Biodiversity status 2011th. The Botany team identifies habitats that are either endangered or threatened as well as the ones that are rare or specific for Balkan nature. They produce check list of habitats that serve as a referent check list for their work. Table 1. List of important habitats for mapping (Codes are given according to NATURA 2000 classification.) CODE Name of habitat type 1210 Annual vegetation of drift lines 1240 Vegetated sea cliffs of the Mediterranean coasts with endemic Limonium spp 1310 Salicornia and other annuals colonising mud and sand 1410 Mediterranean salt meadows (Juncetalia maritimi) Mediterranean and thermo-Atlantic halophilous scrubs (Salicornetea 1420 fruticosi) 2110 Embryonic shifting dune 2120 Shifting dunes along the shoreline with Ammophila arenaria (white dunes) 2190 Humide dune slack 2220 Dunes with Euphorbia terracina 2240 Brachypodietalia dune grasslands with annuals Oligotrophic to mesotrophic standing waters with vegetation of the 3130 Littorelletea uniflorae and/or of the Isoëto-Nanojuncetea 3140 Hard oligo-mesotrophic waters with benthic vegetation of Chara spp. Natural eutrophic lakes with Magnopotamion and Hydrocharition type 3150 vegetation 3230 Alpine rivers and their ligneous vegetation with Myricaria germanica 4060 Alpine and boreal heaths 5310 Laurus nobilis thickets 6170 Alpine and subalpine calcareous grassland Semi-natural dry grasslands and scrubland facies on calcareous substrates 6210 (Festuco-Brometalia) ( * important orchid sites) 6220 Pseudo-steppe with grasses and annuals of the Thero-Brachypodietea *Species-rich Nardus grasslands, on siliceous substrates in mountain areas 6230 and submountain areas in continental Europe 62A0 East sub-Mediterranean dry grasslands (Scorzoneretalia villosae) 7220 *Petrifying springs with tufa formation (Cratoneurion) Calcareous and calcshist screes of the montane to alpine levels (Thlaspietea 8120 rotundifolii) 8130 Western mediterranean and thermophilous screes 8210 Calcareous rocky slopes with chasmophytic vegetation 8220 Siliceous rocky slopes with chasmophytic vegetation 91E0 * Alluvial forests with Alnus glutinosa and Fraxinus excelsior (Alno-Padion, 4 Alnion incanae, Salicion albae) Riparian mixed forests of Quercus robur, Ulmus laevis and Ulmus minor, 91F Fraxinus excelsior or Fraxinus angustifolia, along the great rivers (Ulmenion minoris) 9110 Luzulo-Fagetum beech forests 9130 Asperulo-Fagetum beech forests 91K0 Illyrian Fagus sylvatica forests (Aremonio-Fagion) 91L0 Illyrian oak-hornbeam forests (Erythronio-carpinion) 91W0 Moesian beech forest 9250 Quercus trojana woods 9260 Chestnut woods 9320 Olea and Ceratonia forests 9410 Acidophilous Picea forests of the montane to alpine level (Vaccinio-Piceetea) 9530 (Sub-) Mediterranean pine forests with endemic black pines 95A0 High Oromediterranean pine forests This list was produced on basis of extrapolation of existing data, published and data collected during filed research while their categorization of habitats was based on two main parameters, their rarity and vulnerability. Those were main characteristics for selection of listed types of habitats. This list (Table 1.) was referent for further mapping. For choosing of referent specie among several taxonomic groups (plants, moss, invertebrates, fish, amphibians and reptiles, birds, mammals and marine species and habitats) each expert study and assess the list of protected fungi, plant and animal species of Montenegro1. They also assess the lists that are noted in national reports for the Convention on Biological Diversity, in EMERALD network data basis in program of Biodiversity Monitoring. They additionally analyzed data basis for IPA (Important Plan Areas) and for IBA (Important Bird Areas) (bird and plant experts). Experts check each species IUCN Red List status (endangered or threatened) as well as analyze the ecological value of endemic species trough European scale. For the species with unreliable data of occurrence in Montenegro extra filed research were organized. Their work was based on following approach: a) Experts categorized species that are present in Montenegro and that are listed in Habitats and Bird Directive and those that are on Barcelona and Bon conventions. They overlap such list with those related to protected plant and animal species in MNE and with lists in Emerald, IBA an IPA data basis b) They made crosscut analysis among international and national data sets (lists) in order to produce draft list of species for each group. Final list of each species group is based on several criteria such are level of endemism, level of vulnerability, level of importance (on EU scale), IUCN Red List category, etc. 1 RJEŠENJE O STAVLJANJU POD ZAŠTITU POJEDINIH BILJNIH I ŽIVOTINJSKIH VRSTA, 2006. Službeni glasnik Crne Gore br. 76/06 5 c) Species that are protected under National Legislative and which population number is high and stabile are not included in following lists. The same situation is with those that are numerous in Balkan countries no matter if they are low in number in EU countries. d) Occurrence of some species in Montenegro is highly disputable and some field researches were done in MN related to verification of their existence. The species which are not reported for more than 40 years are not taken in consideration. e) For selecting of target species list related to mapping, 80 % of decision making process was based on published papers, documents, monographs, master and doctoral thesis, 10% was based on personal field experience while 10% was based on filed investigation during this project implementation. IN following tables they are lists of each group that served as a basis for further taxa mapping work. Table 2. List of important plant species for mapping Species IUCN Red IUCN Red IUCN EU Status Status Endemic Protected Directive Habitat Habitat List List Red List Wildlife Bern Cites in Category Category Category Trade Annex Annex MN (World, (Europe) (EU 27) Regulati 1998) on 1 Adenophora lilifolia (L.) LC Annex + _ Ledeb. II, IV 2 Allium phthioticum Boiss. DD DD + RE & Heldr 3 Androsace komovensis + Schönswetter & Schneew Komovi 4 Aquilegia dinarica G. Beck R + Balkan 5 Arenaria halacsyi Bald. R + Mne Komovi 6 Arnica montana L. LC LC D Annex + - V 7 Artemisia eriantha Ten LC LC Annex + - Artemisia petrosa V (Baumg.) Jan subsp. eriantha Ten. 8 Asperula baldaccii R + Mne (Halacsy) Ehrend. Rumija 9 Asperula doerfleri Wettst. + RE 10 Bellevalia dalmatica R + RE (Backer) A.K. Jackson & Turill= Hyacinthella dalmatica (Baker) Chouard 11 Berteroa gintlii Rohlena R + Mne Lovćen 12 Buxus sempervirens L. + 13 Caldesia parnassifolia (L.) NT Annex I _ - Parl. II, IV 6 14 Calistegia soladanella (L.) + - R. Br. 15 Campanula abietina DD I + - Griseb. et Schenk. 16 Campanula secundiflora Ex/E + RE Vis 17 Centaurea glaberima R + RE Tausch 18 Centaurea incompta Vis. R + RE 19 Cephalaria pastricensis + RE Dörfler et Hayek 20 Crepis bertiscea Jáv. R + RE 21 Cymbalaria ebelii (Cufod.) + RE Speta 22 Cypripedium calceolus NT A Annex I II + - II, IV 23 Cerastium dinaricum VU Annex + RE G.Beck & Szysz. II, IV 24 Daphne malyana Blečić R? + RE 25 Dianthus knappii (Pant.) R + RE Ascher. & Kanitz ex Borbas 26 Dianthus nitidus ssp. RE lakusicii Wraber 27 Dioscorea balcanica + RE Košanin 28 Draba bertiscea D. Lakušić + RE & V. Stevanović 29 Edraianthus wettsteinii R + Hal. & Bald. subsp. RE wettsteinii 30 Edraianthus wettsteinii + Hal. & Bald. subsp. RE lovcenicus Mayer & Blečić 31 Euphorbia montenegrina + RE (Bald.) K. Malỳ 32 Euphorbia pancicii G. + RE Beck. 33 Eryngium alpinum L. I NT Annex I + _ II, IV 34 Fritillaria montana Hoppe. DD I + _ 35 Gentiana lutea L. LC LC D Annex + - V 36 Gladiolus palustris Gaud. I DD Annex + _ II, IV 37 Geum bulgaricum Panc. LC Annex I + Balkan II 38 Gymnospermium + RE scipetarum (Paparisto & Qosja) Mayer & Pulević 39 Himantoglossum caprinum DD Anex I II + _ (Bieb.) C. Koch II, IV 40 Ilex aquifolium L. + 41 Knautia sarajevensis Szabó R + RE 42 Leucanthemum R + RE chloroticum A. Kerner & Murb. 7 43 Lunaria telekiana Jáv. R + RE 44 Lycopodium alpinum Annex + - Diphasiastrum alpinum V (L.) J. Holub 45 Marsilea quadrifolia NT Annex I + - II, IV 46 Minuartia velenovskyi R + RE (Rohlena) Hayek
Load more

Recommended publications
  • Globalna Strategija Ohranjanja Rastlinskih
    GLOBALNA STRATEGIJA OHRANJANJA RASTLINSKIH VRST (TOČKA 8) UNIVERSITY BOTANIC GARDENS LJUBLJANA AND GSPC TARGET 8 HORTUS BOTANICUS UNIVERSITATIS LABACENSIS, SLOVENIA INDEX SEMINUM ANNO 2017 COLLECTORUM GLOBALNA STRATEGIJA OHRANJANJA RASTLINSKIH VRST (TOČKA 8) UNIVERSITY BOTANIC GARDENS LJUBLJANA AND GSPC TARGET 8 Recenzenti / Reviewers: Dr. sc. Sanja Kovačić, stručna savjetnica Botanički vrt Biološkog odsjeka Prirodoslovno-matematički fakultet, Sveučilište u Zagrebu muz. svet./ museum councilor/ dr. Nada Praprotnik Naslovnica / Front cover: Semeska banka / Seed bank Foto / Photo: J. Bavcon Foto / Photo: Jože Bavcon, Blanka Ravnjak Urednika / Editors: Jože Bavcon, Blanka Ravnjak Tehnični urednik / Tehnical editor: D. Bavcon Prevod / Translation: GRENS-TIM d.o.o. Elektronska izdaja / E-version Leto izdaje / Year of publication: 2018 Kraj izdaje / Place of publication: Ljubljana Izdal / Published by: Botanični vrt, Oddelek za biologijo, Biotehniška fakulteta UL Ižanska cesta 15, SI-1000 Ljubljana, Slovenija tel.: +386(0) 1 427-12-80, www.botanicni-vrt.si, [email protected] Zanj: znan. svet. dr. Jože Bavcon Botanični vrt je del mreže raziskovalnih infrastrukturnih centrov © Botanični vrt Univerze v Ljubljani / University Botanic Gardens Ljubljana ----------------------------------- Kataložni zapis o publikaciji (CIP) pripravili v Narodni in univerzitetni knjižnici v Ljubljani COBISS.SI-ID=297076224 ISBN 978-961-6822-51-0 (pdf) ----------------------------------- 1 Kazalo / Index Globalna strategija ohranjanja rastlinskih vrst (točka 8)
    [Show full text]
  • Conserving Europe's Threatened Plants
    Conserving Europe’s threatened plants Progress towards Target 8 of the Global Strategy for Plant Conservation Conserving Europe’s threatened plants Progress towards Target 8 of the Global Strategy for Plant Conservation By Suzanne Sharrock and Meirion Jones May 2009 Recommended citation: Sharrock, S. and Jones, M., 2009. Conserving Europe’s threatened plants: Progress towards Target 8 of the Global Strategy for Plant Conservation Botanic Gardens Conservation International, Richmond, UK ISBN 978-1-905164-30-1 Published by Botanic Gardens Conservation International Descanso House, 199 Kew Road, Richmond, Surrey, TW9 3BW, UK Design: John Morgan, [email protected] Acknowledgements The work of establishing a consolidated list of threatened Photo credits European plants was first initiated by Hugh Synge who developed the original database on which this report is based. All images are credited to BGCI with the exceptions of: We are most grateful to Hugh for providing this database to page 5, Nikos Krigas; page 8. Christophe Libert; page 10, BGCI and advising on further development of the list. The Pawel Kos; page 12 (upper), Nikos Krigas; page 14: James exacting task of inputting data from national Red Lists was Hitchmough; page 16 (lower), Jože Bavcon; page 17 (upper), carried out by Chris Cockel and without his dedicated work, the Nkos Krigas; page 20 (upper), Anca Sarbu; page 21, Nikos list would not have been completed. Thank you for your efforts Krigas; page 22 (upper) Simon Williams; page 22 (lower), RBG Chris. We are grateful to all the members of the European Kew; page 23 (upper), Jo Packet; page 23 (lower), Sandrine Botanic Gardens Consortium and other colleagues from Europe Godefroid; page 24 (upper) Jože Bavcon; page 24 (lower), Frank who provided essential advice, guidance and supplementary Scumacher; page 25 (upper) Michael Burkart; page 25, (lower) information on the species included in the database.
    [Show full text]
  • "Official Gazette of RM", No. 28/04 and 37/07), the Government of the Republic of Montenegro, at Its Meeting Held on ______2007, Enacted This
    In accordance with Article 6 paragraph 3 of the FT Law ("Official Gazette of RM", No. 28/04 and 37/07), the Government of the Republic of Montenegro, at its meeting held on ____________ 2007, enacted this DECISION ON CONTROL LIST FOR EXPORT, IMPORT AND TRANSIT OF GOODS Article 1 The goods that are being exported, imported and goods in transit procedure, shall be classified into the forms of export, import and transit, specifically: free export, import and transit and export, import and transit based on a license. The goods referred to in paragraph 1 of this Article were identified in the Control List for Export, Import and Transit of Goods that has been printed together with this Decision and constitutes an integral part hereof (Exhibit 1). Article 2 In the Control List, the goods for which export, import and transit is based on a license, were designated by the abbreviation: “D”, and automatic license were designated by abbreviation “AD”. The goods for which export, import and transit is based on a license designated by the abbreviation “D” and specific number, license is issued by following state authorities: - D1: the goods for which export, import and transit is based on a license issued by the state authority competent for protection of human health - D2: the goods for which export, import and transit is based on a license issued by the state authority competent for animal and plant health protection, if goods are imported, exported or in transit for veterinary or phyto-sanitary purposes - D3: the goods for which export, import and transit is based on a license issued by the state authority competent for environment protection - D4: the goods for which export, import and transit is based on a license issued by the state authority competent for culture.
    [Show full text]
  • Plant Production--Root Vegetables--Yams Yams
    AU.ENCI FOR INTERNATIONAL DEVILOPME4T FOR AID USE ONLY WASHINGTON. 0 C 20823 A. PRIMARYBIBLIOGRAPHIC INPUT SHEET I. SUBJECT Bbliography Z-AFOO-1587-0000 CL ASSI- 8 SECONDARY FICATIDN Food production and nutrition--Plant production--Root vegetables--Yams 2. TITLE AND SUBTITLE A bibliography of yams and the genus Dioscorea 3. AUTHOR(S) Lawani,S.M.; 0dubanjo,M.0. 4. DOCUMENT DATE IS. NUMBER OF PAGES 6. ARC NUMBER 1976 J 199p. ARC 7. REFERENCE ORGANIZATION NAME AND ADDRESS IITA 8. SUPPLEMENTARY NOTES (Sponaoring Ordanization, Publlahera, Availability) (No annotations) 9. ABSTRACT This bibliography on yams bring together the scattered literature on the genus Dioscorea from the early nineteenth century through 1975. The 1,562 entries in this bibliography are grouped into 36 subject categories, and arranged within each category alphabetically by author. Some entries, particularly those whose titles are not sufficiently informative, are annotated. The major section titles in the book are as follows: general and reference works; history and eography; social and cultural importance; production and economics; botany including taxonomy, genetics, and breeding); yam growing (including fertilizers and plant nutrition); pests and diseases; storage; processing; chemical composition, nutritive value, and utilization; toxic and pharmacologically active constituents; author index; and subject index. Most entries are in English, with a few in French, Spanish, or German. 10. CONTROL NUMBER I1. PRICE OF DOCUMENT PN-AAC-745 IT. DrSCRIPTORS 13. PROJECT NUMBER Sweet potatoes Yams 14. CONTRACT NUMBER AID/ta-G-1251 GTS 15. TYPE OF DOCUMENT AID 590-1 44-741 A BIBLIOGRAPHY OF YAMS AND THE GENUS DIOSCOREA by S.
    [Show full text]
  • 2006 Catalog
    Friends School of Minnesota Nonprofit Org. U.S. Postage 1365 Englewood Avenue PAID Saint Paul, MN 55104 Minneapolis, MN Permit No. 1767 TIME VALUE DATA If you have received a duplicate copy, please let us know, and pass the extra to a friend! North Star Originals 6 The Himalayan Saint Paul, Blue Poppy FROM 35W Minnesota FROM HWY 3 What’s “Native” LARPENTEUR AVENUE SNELLING AVE Mean When It Comes to Plants? Minnesota State Fair Friends School CLEVELAND AVE Plant Sale 280 COMMONWEALTH DAN PATCH MIDWAY PKWY P May 12, 13, 14, 2006 Friday,May 12 36 COMO AVENUE Cleveland 35W Snelling 11:00 A.M.–8:00 P.M. Larpenteur CANFIELD Saturday,May 13 State Fair Grandstand PLANT SALE 9:00 A.M.–8:00 P.M. Y 280 Como G PAR ER K N FROM 94 E Sunday,May 14 Friends School NOON P.M. The native Penstemon grandiflorus 12:00 –4:00 (Large-Flowered Beardtongue), 94 photographed in St. Paul’s At the State Fair Midway area during summer 2005. Grandstand 17th Annual Friends School Plant Sale May 12th, 13th and 14th, 2006 Friday 11:00 A.M.–8:00 P.M.• Saturday 9:00 A.M.–8:00 P.M. Sunday 12:00 NOON–4:00 P.M.Sunday is half-price day at the Minnesota State Fair Grandstand Friends School of Minnesota Thank you for supporting Friends School of Minnesota by purchasing plants at our sale. Friends School of Minnesota prepares children to embrace life, learning, and community with hope, skill, understanding, and creativity. We are committed to the Quaker values of peace, justice, simplicity and integrity.
    [Show full text]
  • Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: a Review
    Available online at www.ijpab.com Dhakar and Soni Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) ISSN: 2320 – 7051 DOI: http://dx.doi.org/10.18782/2320-7051.5192 ISSN: 2320 – 7051 Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) Review Article Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: A Review Sunita Dhakar1* and Anjali Soni2 1Division of Floriculture and Landscaping, ICAR- IARI, New Delhi 110012, India 2Division of Fruits and Horticultural Technology, ICAR-IARI, New Delhi 110012, India *Corresponding Author E-mail: [email protected] Received: 11.07.2017 | Revised: 19.08.2017 | Accepted: 26.08.2017 ABSTRACT Flower colours are of paramount importance in the ecology of plants and their ability to attract pollinators and seed dispersing organisms. The primary pigments occurring in plants are chlorophylls and carotenoids accumulated in plastids, anthocyanins and betalains, which are dissolved in vacuolar sap. Flavonoids and carotenoids are widely distributed in plant pigments. Among the factors influencing flower colour, anthocyanin biosynthesis has been the most extensively studied. Each plant species usually accumulates limited kinds of anthocyanins and exhibits limited flower colour. For example, roses and carnations lack violet/blue colour because they do not accumulate delphinidin-based anthocyanins and petunia and cymbidium lack brick red/orange colour due to the lack of pelargonidin-based anthocyanins. Different approaches are used for development of novel flower colour in floricultural crops like hybridization, mutation and genetic engineering. Advances in molecular biology and plant transformation technology have made possible the engineering of an anthocyanin biosynthetic pathway by the overexpression of heterologous flavonoid biosynthetic genes or the down-regulation of endogenous genes in transgenic plants.
    [Show full text]
  • Some Specific Analysis on Conservation Status
    HABITATS DIRECTIVE ARTICLE 17 REPORT ( 2001 – 2006 ) SOME SPECIFIC ANALYSIS ON CONSERVATION STATUS This paper is part of the web-based Article 17 Technical Report (2001-2006) http://biodiversity.eionet.europa.eu/article17 compiled by the European Topic Centre on Biological Diversity for the European Commission (DG Environment) DISCLAIMER: The contents of this paper do not necessarily reflect the official opinion of the European Environment Agency, the European Commission or other European Communities institutions. ETC/BD, Paris, 2008 Article 17 Technical Report (2001-2006) Some specific analysis on conservation status This paper examines a few themes arising from the Article 17 reports, discussing the conservation status of agricultural habitats, of species with restricted distributions, the possible role of the EU LIFE programme and a discussion of climate change. Contents Conservation status of habitats linked to agriculture............................................................................................ 2 Species with restricted distribution....................................................................................................................... 7 LIFE and improving conservation status .............................................................................................................. 9 Habitats and species affected by climate change .............................................................................................. 10 Appendix 1 - Species of Annexes II, IV & V which have a very restricted
    [Show full text]
  • CBD First National Report
    FIRST NATIONAL REPORT OF THE REPUBLIC OF SERBIA TO THE UNITED NATIONS CONVENTION ON BIOLOGICAL DIVERSITY July 2010 ACRONYMS AND ABBREVIATIONS .................................................................................... 3 1. EXECUTIVE SUMMARY ........................................................................................... 4 2. INTRODUCTION ....................................................................................................... 5 2.1 Geographic Profile .......................................................................................... 5 2.2 Climate Profile ...................................................................................................... 5 2.3 Population Profile ................................................................................................. 7 2.4 Economic Profile .................................................................................................. 7 3 THE BIODIVERSITY OF SERBIA .............................................................................. 8 3.1 Overview......................................................................................................... 8 3.2 Ecosystem and Habitat Diversity .................................................................... 8 3.3 Species Diversity ............................................................................................ 9 3.4 Genetic Diversity ............................................................................................. 9 3.5 Protected Areas .............................................................................................10
    [Show full text]
  • Friends of the JC Raulston Arboretum Newsletter Spring 2019 – Vol
    Friends of the JC Raulston Arboretum Newsletter Spring 2019 – Vol. 22, No. 1 Director’s Letter Annual Report Friends of the JC Raulston Arboretum Newsletter Spring 2019 – Vol. 22, No. 1 Christopher Todd Glenn, Editor [email protected] Photographs by Tim Alderton, College of Agriculture and Life Sciences Communications, Maryann Debski, Adam DeRose, Nancy Doubrava, Justin Durango, Christopher Todd Glenn, Bob Hauver, Judy Morgan- Davis, Tom Ranney, Southern Nursery Association, Kristi Traynor, Mark Weathington, and Jeanne Wilkinson © May 2019 JC Raulston Arboretum JC Raulston Arboretum NC State University 4415 Beryl Road Campus Box 7522 Raleigh, NC 27606-1457 Raleigh, NC 27695-7522 Phone: (919) 515-3132 Greetings from the JC Fax: (919) 515-5361 jcra.ncsu.edu facebook.com/jcraulstonarboretum/ Raulston Arboretum jcraulstonarboretum.wordpress.com youtube.com/jcraulstonarb/ instagram.com/jcraulstonarboretum/ Arboretum Open Daily By Mark Weathington, We’ve got exciting news to kick off 2019: the JC Raulston April–October – 8:00 AM–8:00 PM November–March – 8:00 AM–5:00 PM Director Arboretum and Juniper Level Botanic Garden (Tony Avent’s Bobby G. Wilder Visitor Center garden surrounding Plant Delights Nursery) are formalizing their Monday–Friday – 8:00 AM–5:00 PM long-time collaborative status and joining forces. Tony and Anita Avent are gifting their Saturday* – 10:00 AM–2:00 PM Sunday* – 1:00 AM–4:00 PM property to the JC Raulston Arboretum and NC State University to continue the legacy *Weekend hours are based on volunteer availability of bridging the gap between botany and horticulture. Check out page three for more Staff Mark Weathington, Director information about this game-changing partnership.
    [Show full text]
  • Cibulnaté a Hlíznaté Rostliny
    Cibulnaté a hlíznaté rostliny Přehled druhů 2: Asparagales Řád Asparagales rozsáhlý řád, 14 čeledí, některé obrovské semena rostlin obsahují černé barvivo melanin (některé druhy ho druhotně ztratily) Hosta PREZENTACE © JN Iridaceae (kosatcovité) Řád Asparagales Čeleď Iridaceae (kosatcovité) vytrvalé byliny s oddenky, hlízami, nebo cibulemi stonek přímý nevětvený, někdy zkrácený listy mečovité nebo čárkovité, dvouřadé se souběžnou žilnatinou květy jednotlivé nebo v chudých květenstvích (vějířek nebo srpek) – významné druhy okrasného zahradnictví subtropy až mírné pásmo 70/1750, ČR 3/12 PREZENTACE © JN Iridaceae (kosatcovité) Řád Asparagales Čeleď Iridaceae (kosatcovité) Zahradnicky významné jsou: mečíky (Gladiolus), frézie (Freesia), kosatce (Iris), šafrány (Crocus) Mezi další zahradnicky významné Iridaceae patří např. Crocosmia, Ixia, Tigridia © Saxifraga-Dirk Hilbers © Saxifraga-Inigo Sanchez Iris xiphium http://www.freenatureimages.eu/Plants/Flora%20D-I/Iris%20xiphium/slides/Iris%20xiphium%201,%20Saxifraga-Dirk%20Hilbers.jpg http://www.freenatureimages.eu/Plants/Flora%20D-I/Iris%20xiphium/slides/Iris%20xiphium%202,%20Saxifraga-Inigo%20Sanchez.jpg Iridaceae (kosatcovité) Iris (kosatec) zahrnuje i množství druhů které se neřadí mezi cibuloviny. Do cibulovin patří kosatce sekce Xiphium a Reticulata Sekce Xiphium - původní druhy pocházejí ze středomoří, hlavně Pyrenejí, zde rostou v 1500 m na mořem Cibule se 3-5 masitými šupinami, žlábkovité listy , stvol s 2-3 tuhými zelenými listeny a 2-3 květy, jsou modré se žlutým středem na vnějších okvětních lístcích, v přírodě kvetou koncem června Křížením původních druh této sekce hlavně Iris xiphium a I. tingitana vzniklo velké množství kutivarů – označované jako Dutch iris (holandské kosatce), pěstují se tržně v mnoha barvách (od bílé, žluté, modré až po fialovou) a prodávají jako řezané květiny např.
    [Show full text]
  • Final Report on Biodiversity Assessment
    Final Report submitted to the United States Agency for International Development Biodiversity Kosovo Assessment Under the Biodiversity and Forestry Indefinite Quantity Contract Contract No. LAG-I-00-99-00013-00, Task Order No. 811 Submitted to: USAID/Kosovo Submitted by: ARD-BIOFOR IQC Consortium 159 Bank Street, Suite 300 Burlington, Vermont 05401 Telephone: (802) 658-3890 fax: (802) 658-4247 Email: [email protected] May 2003 Table of Contents List of Acronyms and Abbreviations ...........................................................................................................iii Executive Summary ..................................................................................................................................... iv 1.0 Introduction....................................................................................................................................... 1 1.1 Purpose and Objective ..................................................................................................................... 1 1.2 Methodology .................................................................................................................................... 1 1.3 Environmental Requirements for Country Strategic Plans .............................................................. 1 1.4 Acknowledgements.......................................................................................................................... 2 2.0 Background on Kosovo....................................................................................................................
    [Show full text]
  • SUPPLEMENTARY TABLES LIST of TABLES 1 List of Universal and Diagnostic Primer
    SUPPLEMENTARY TABLES LIST OF TABLES 1 List of universal and diagnostic primer . .1 3 Genbank sequence accessions (cytoplasmic) . .1 4 Genbank sequence accessions (nuclear) . .2 2 List of secondary specimens (lemongrass and carnation) . .5 5 Anatomical diagnostic key . .6 6 BLOG bamboo tribe classification results . .7 Table 1. List of universal and diagnostic (ARMS) primer used in the current study. The table includes primer names and sequences, melting temperatures (Tm) of each individual primer, the annealing temperatures (An) for each primer pair and references to corresponding publications. Name Sequence (5’...3’) Tm (◦C) An (◦C) Design rbcLa fu ATGTCACCACAAACAGAGACTAAAGC 62.2 58 Kondo et al. [1996] rbcLa revu GTAAAATCAAGTCCACCRCG 74.7 Fofana et al. [1997] rbcLb-Sfu AGACCTTTTTGAAGAAGGTTCTGT 62.2 55 Dong et al. [2014] rbcLb-Sru TCGGTCAGAGCAGGCATATGCCA 74.7 1R KIM ru ACCCAGTCCATCTGGAAATCTTGGTTC 72.1 52 Ki-Joong Kimp 3F KIM fu CGTACAGTACTTTTGTGTTTACGAG 60.6 ITS5u GGAAGTAAAAGTCGTAACAAGG 58.4 56 White et al. [1990] ITS4u TCCTCCGCTTATTGATATGC 61.5 Bbo-C-407-rd AGGBGGRCCTSGRAAAGTTTTCGA 58.7 current study Dian-T-223-rd CGGGCTCGATGTGGTAGTAA 64.9 Cym-A-254-rd AGCTACATAACAGATATATTGATCAGG 59.5 d diagnostic primer (ARMS), destabilizing nucleotide underlined u universal primer p unpublished Table 3. GenBank sequence accessions of two plastid DNA regions (rbcL and matK) used in the current study. Taxon rbcL matK Arundinarieae Arundinaria gigantea subsp. tecta AJ746179 EF125165 Borinda emeryi EF125079 EF125167 Chimonobambusa marmorea AJ746176 EF125168 Drepanostachyum falcatum AJ746265 EF125170 Fargesia dracocephala AJ746266 KP685610 Fargesia sp. Asmussen AM110249 AM114722 Indocalamus latifolius AJ746177 EF125173 Phyllostachys aurea HE573324 AF164390 Phyllostachys bambusoides AB088833 AB088805 Phyllostachys nigra HE573325 EU434241 Pleioblastus maculatus JN247242 JN247148 Pseudosasa amabilis AJ746273 KP093752 Pseudosasa japonica FN870405 HG794001 Thamnocalamus spathiflorus EF125087 KP685639 Bambubseae Bambusa multiplex M91626 EF125166 1/7 Table 3.
    [Show full text]