DOCSLIB.ORG

Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: a Review

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: a Review Available online at www.ijpab.com Dhakar and Soni Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) ISSN: 2320 – 7051 DOI: http://dx.doi.org/10.18782/2320-7051.5192 ISSN: 2320 – 7051 Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) Review Article Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: A Review Sunita Dhakar1* and Anjali Soni2 1Division of Floriculture and Landscaping, ICAR- IARI, New Delhi 110012, India 2Division of Fruits and Horticultural Technology, ICAR-IARI, New Delhi 110012, India *Corresponding Author E-mail: [email protected] Received: 11.07.2017 | Revised: 19.08.2017 | Accepted: 26.08.2017 ABSTRACT Flower colours are of paramount importance in the ecology of plants and their ability to attract pollinators and seed dispersing organisms. The primary pigments occurring in plants are chlorophylls and carotenoids accumulated in plastids, anthocyanins and betalains, which are dissolved in vacuolar sap. Flavonoids and carotenoids are widely distributed in plant pigments. Among the factors influencing flower colour, anthocyanin biosynthesis has been the most extensively studied. Each plant species usually accumulates limited kinds of anthocyanins and exhibits limited flower colour. For example, roses and carnations lack violet/blue colour because they do not accumulate delphinidin-based anthocyanins and petunia and cymbidium lack brick red/orange colour due to the lack of pelargonidin-based anthocyanins. Different approaches are used for development of novel flower colour in floricultural crops like hybridization, mutation and genetic engineering. Advances in molecular biology and plant transformation technology have made possible the engineering of an anthocyanin biosynthetic pathway by the overexpression of heterologous flavonoid biosynthetic genes or the down-regulation of endogenous genes in transgenic plants. Transgenic carnations and a transgenic rose that accumulate delphinidin as a result of expressing a flavonoid 3’, 5’-hydroxylase gene and have novel blue hued flowers have been commercialized. Key words: Carotenoids, Flavonoids, Flower colour, Hybridization, Mutation, Genetic engineering INTRODUCTION promotion of wind pollination13. Flower and There are many beautiful flowers in nature and fruit colour are important in the attraction of they show a variety of shapes and colours. pollinators and organisms for seed dispersal Such diversity is acquired through and thus for critical factors in plant survival evolutionary processes to ensure successful organisms26. reproduction by attracting pollinators or by Cite this article: Dhakar, S. and Anjali Soni, A., Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: A Review, Int. J. Pure App. Biosci. 6(1): 442-451 (2018). doi: http://dx.doi.org/10.18782/2320-7051.5192 Copyright © Jan.-Feb., 2018; IJPAB 442 Dhakar and Soni Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) ISSN: 2320 – 7051 From a horticultural point of view, flower red, orange and yellow colour on flower when colour is one of the most important targets for they are present. These lipid-soluble pigments plant breeders and many different coloured found embedded in the membranes of cultivars have been bred using natural mutants chloroplasts and chromoplasts. In addition, a or genetically related species. Ornamentals third class of pigment is betalains, it contribute were among the first plants to be hybridized to red and yellow colour. Betalains can be found alter specific colour traits, and fruit and flower only in certain plants from 10 families of the colour have contributed to make clear order Caryophyllales (including beetroot and fundamental genetic principles. Today, the several important genera such as Amaranthus, market for ornamental plants and cut flowers Celosia, Gomphrena, Iresine, etc.) and in is rapidly expanding and totals over $70 some higher fungi such as fly agaric (Amanita billion in annual sales. Although increasing muscaria)6. postharvest life, altering scent, and modifying Major plant pigments flower shape are areas where progress is being Primary function of pigments in flowers is to actively pursued, much of the novelty in the attract insects and other animals which help in cut flower industry continues to be targeted cross pollination. The different roles of colour toward the generation of new colours. other than attraction of pollinators are function Generally speaking, flower colour is in photosynthesis, protecting tissue against predominantly determined by two classes of photo oxidative damage, provide resistant to pigments: flavonoids and carotenoids. biotic and abiotic stress and symbiotic plant- Flavonoids and their coloured class microbe interaction. It acts as intermediary for anthocyanins are the most common flower other compounds and also shows antibacterial, pigments contributing to a wide range of antifungal, antitumor and anti-inflammatory colours are yellow, orange, red, magenta, properties. Chlorophylls and Carotenoids are violet, purple, blue. Carotenoids are synthesizing in the Plastid of the cell while ubiquitously distributed in plant as essential Anthocyanins and Betalins are synthesize in components of photosynthesis and confer a vacuole of plant cell. Table 1: Major plant pigments and their occurrence Pigment Compound Types Compound Examples Typical Colours Chlorophylls Chlorophyll Chlorophyll a and b Green Carotenoids Carotenes Lycopene, α-carotene, Yellow, β-carotene, γ-carotene etc. Orange, Red Xanthophylls Lutein,, Zeaxanthin, Neoxanthin, Yellow, Orange, Violaxanthin etc. Anthocyanins Cyanidin, Delphinidin, Malvidin, Red, Orange, Pelargonidin, Peonidin, Petunidin Blue, violet Flavonoids Flavones Flavonol Luteolin, Apigenin, Tangeritin Yellow Flavanone Quercetin, Kaempferol, Myricetin Yellow Flavanonol Hesperetin, Naringenin, Eriodictyol Colour less , Homoeriodictyol co- pigments Flavone Taxifolin , Dihydrokaempferol Colour less co- pigments Betalains Betacyanins Red - Violet Betaxanthins Yellow -Orange Each plant species usually accumulates limited floricultural breeders have always sought kinds of anthocyanins and exhibits limited novel flower colours26. For example, roses, flower color by the expression of a specific set carnations and chrysanthemum, which are the of biosynthetic genes, the substrate specificity most important floricultural crops, do not of key enzymes and/or the temporal and accumulate delphinidin-based anthocyanins. spatial regulation of the biosynthetic genes. Thus, they lack violet/blue varieties. This is Therefore, it is rare for a single species to have attributed to their deficiency of flavonoid 3‟, the entire spectrum of flower color, although 5‟-hydroxylase (F3‟5‟H), a key enzyme in the Copyright © Jan.-Feb., 2018; IJPAB 443 Dhakar and Soni Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) ISSN: 2320 – 7051 synthesis of delphinidin. On the other hand, primarily based upon six common petunia and cymbidium lack brick red/orange anthocyanidins; pelargonidin, cyanidin, varieties due to the lack of pelargonidin-based peonidin, delphinidin, petunidin and malvidin. anthocyanins because their dihydroflavonol 4- In terms of biosynthesis, since peonidin is reductases (DFRs) do not utilize derived from cyaniding and petunidin and dihydrokaempferol as a substrate. Some malvidin are both derived from delphinidin, species that usually accumulate delphinidin- there are only three major anthocyanidins; based anthocyanins and do not accumulate pelargonidin, cyanidin and delphinidin pelargonidin-based anthocyanins in their (Figure- 1). Flavonoid biosynthesis has been petals, such as iris and gentian, are likely to well characterized in the flowers of petunia have DFRs with a similar substrate specificity and snapdragon, and in the kernels of maize, to that of petunia DFR. Rose DFR can utilize and is therefore one of the most well studied dihydromyricetin as a substrate on the basis of pathways among plant secondary feeding of dihydromyricetin to rose petals. So metabolisms20,16,29. Blue flowers tend to have for the breeding for colour various approaches delphinidin and intense red flowers tend to have been followed. have pelargonidin as the anthocyanidin base. Flavonoids An increase in the number of hydroxyl groups Flavonoids are the most common pigment in on the B-ring imparts a bluer colour to the flower tissue. Flavonoids are derived from anthocyanins derived from the anthocyanidin, phenyl-propanoid pathway with precursor while methylation of the 3‟ or 5‟-hydroxyl amino acid phenyl-alanine. Though hundreds group results in a slight reddening. of anthocyanins have been reported, they are Fig. 1: Flavonoid biosynthetic pathway and flavonoid compounds accumulated in flowers. A simplified pathway derived from several plant species is depicted for ease of explanation. The painted colours shows image of each compound. ANS (Anthocyanidin synthase), AS (Aureusidin synthase), AT (Acyltransferase), C4’GT (Chalcone 4’-Oglucosyltransferase), C4H (Cinnamate-4-hydroxylase), CHI (Chalcone isomerase), CHS (Chalcone synthase), 4CL (4-coumarate:CoA ligase), DFR (Dihydroflavonol 4-reductase), F3H (Flavanone 3-hydroxylase), F3’H flavonoid 3’-hydroxylase, F3’5’H (Flavonoid 3’,5’- hydroxylase), FLS (Flavonol synthase), FNR (Flavanone 4-reductase), FNS (Flavone synthase), GT (Glycosyltransferase), MT (Methyltransferase), PAL (Phenylalanine ammonialyase)23. Copyright © Jan.-Feb., 2018; IJPAB 444 Dhakar and Soni Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) ISSN: 2320 – 7051 Table 2: Genes involve in pigment
Load more

Recommended publications
  • Dolichodorus Heterocephalus Cobb, 1914
    CA LIF ORNIA D EPA RTM EN T OF FOOD & AGRICULTURE California Pest Rating Proposal for Dolichodorus heterocephalus Cobb, 1914 Cobb’s awl nematode Current Pest Rating: A Proposed Pest Rating: A Domain: Eukaryota, Kingdom: Metazoa, Phylum: Nematoda, Class: Secernentea Order: Tylenchida, Suborder: Tylenchina, Family: Dolichodoridae Comment Period: 08/10/2021 through 09/24/2021 Initiating Event: This nematode has not been through the pest rating process. The risk to California from Dolichodorus heterocephalus is described herein and a permanent pest rating is proposed. History & Status: Background: The genus Dolichodorus was created by Cobb (1914) when he named D. heterocephalus collected from fresh water at Silver Springs, Florida and Douglas Lake, Michigan. This nematode is a migratory ectoparasite that feeds only from the outside on the cells, on the root surfaces, and mainly at root tip. They live freely in the soil and feed on plants without becoming attached or entering inside the roots. Males and females are both present. This genus is notable in that its members are relatively large for plant parasites and have long stylets. Usually, awl nematodes are found in moist to wet soil, low areas of fields, and near irrigation ditches and other bodies of fresh water. Because they prefer moist to wet soils, they rarely occur in agricultural fields and are not as well studied as other plant-parasitic nematodes (Crow and Brammer, 2003). Infestations in Florida may be due to soil containing nematodes being spread from riverbanks CA LIF ORNIA D EPA RTM EN T OF FOOD & AGRICULTURE onto fields, or by moving with water during flooding (Christie, 1959).
    [Show full text]
  • 2006 Catalog
    Friends School of Minnesota Nonprofit Org. U.S. Postage 1365 Englewood Avenue PAID Saint Paul, MN 55104 Minneapolis, MN Permit No. 1767 TIME VALUE DATA If you have received a duplicate copy, please let us know, and pass the extra to a friend! North Star Originals 6 The Himalayan Saint Paul, Blue Poppy FROM 35W Minnesota FROM HWY 3 What’s “Native” LARPENTEUR AVENUE SNELLING AVE Mean When It Comes to Plants? Minnesota State Fair Friends School CLEVELAND AVE Plant Sale 280 COMMONWEALTH DAN PATCH MIDWAY PKWY P May 12, 13, 14, 2006 Friday,May 12 36 COMO AVENUE Cleveland 35W Snelling 11:00 A.M.–8:00 P.M. Larpenteur CANFIELD Saturday,May 13 State Fair Grandstand PLANT SALE 9:00 A.M.–8:00 P.M. Y 280 Como G PAR ER K N FROM 94 E Sunday,May 14 Friends School NOON P.M. The native Penstemon grandiflorus 12:00 –4:00 (Large-Flowered Beardtongue), 94 photographed in St. Paul’s At the State Fair Midway area during summer 2005. Grandstand 17th Annual Friends School Plant Sale May 12th, 13th and 14th, 2006 Friday 11:00 A.M.–8:00 P.M.• Saturday 9:00 A.M.–8:00 P.M. Sunday 12:00 NOON–4:00 P.M.Sunday is half-price day at the Minnesota State Fair Grandstand Friends School of Minnesota Thank you for supporting Friends School of Minnesota by purchasing plants at our sale. Friends School of Minnesota prepares children to embrace life, learning, and community with hope, skill, understanding, and creativity. We are committed to the Quaker values of peace, justice, simplicity and integrity.
    [Show full text]
  • Colonial Garden Plants
    COLONIAL GARD~J~ PLANTS I Flowers Before 1700 The following plants are listed according to the names most commonly used during the colonial period. The botanical name follows for accurate identification. The common name was listed first because many of the people using these lists will have access to or be familiar with that name rather than the botanical name. The botanical names are according to Bailey’s Hortus Second and The Standard Cyclopedia of Horticulture (3, 4). They are not the botanical names used during the colonial period for many of them have changed drastically. We have been very cautious concerning the interpretation of names to see that accuracy is maintained. By using several references spanning almost two hundred years (1, 3, 32, 35) we were able to interpret accurately the names of certain plants. For example, in the earliest works (32, 35), Lark’s Heel is used for Larkspur, also Delphinium. Then in later works the name Larkspur appears with the former in parenthesis. Similarly, the name "Emanies" appears frequently in the earliest books. Finally, one of them (35) lists the name Anemones as a synonym. Some of the names are amusing: "Issop" for Hyssop, "Pum- pions" for Pumpkins, "Mushmillions" for Muskmellons, "Isquou- terquashes" for Squashes, "Cowslips" for Primroses, "Daffadown dillies" for Daffodils. Other names are confusing. Bachelors Button was the name used for Gomphrena globosa, not for Centaurea cyanis as we use it today. Similarly, in the earliest literature, "Marygold" was used for Calendula. Later we begin to see "Pot Marygold" and "Calen- dula" for Calendula, and "Marygold" is reserved for Marigolds.
    [Show full text]
  • Herbaceous Perennial Trials in Central Alabama, 1996–97
    VARIETY TRIALS he need for new varieties growing seasons. Six beds, each 6 × 80 Herbaceous of plants and an increased ft (1.8 × 24.4 m), were prepared for T interest in perennials were the planting on 11 Apr. 1996. Three plants Perennial Trials in trends most frequently identified in a per entry were grown in three separate recent Georgia survey of retail garden beds (a total of nine plants per entry) in Central Alabama, center outlets (Garber and Bondari, full sun in a randomized complete 1998). Garden center respondents block design. The plants were allowed 1996–97 projected strongest future demand for to adjust to transplanting and evalua- perennials and groundcovers among tions began 3 July 1996. Rainfall was J. Raymond Kessler, Jr.,1 eight plant categories during the next supplemented by overhead sprinkler 5 years (Garber and Bondari, 1998). irrigation to provide an equivalent of 1 Jeff L. Sibley,1 While herbaceous perennials continue inch (2.5 cm) of water per week. Mini- Bridget K. Behe,2 to gain popularity (Salle, 1991a, mum deadheading of spent flowers, 1991b), many field trials continue to weeding by hand, and cutting back as Darby M. Quinn,3 and lump annuals and perennials together needed to prevent breakage was the 4 for evaluation (Davis, 1998). When only other maintenance performed James S. Bannon asked to rate projects at public institu- during the trial. tions, research and demonstration sta- Plants were evaluated every 2 weeks tions, growers generally put variety from 3 July 1996 through October ADDITIONAL INDEX WORDS. trial gardens, crop production, flower cultivars trials at the top of the list (Price and 1997.
    [Show full text]
  • SUPPLEMENTARY TABLES LIST of TABLES 1 List of Universal and Diagnostic Primer
    SUPPLEMENTARY TABLES LIST OF TABLES 1 List of universal and diagnostic primer . .1 3 Genbank sequence accessions (cytoplasmic) . .1 4 Genbank sequence accessions (nuclear) . .2 2 List of secondary specimens (lemongrass and carnation) . .5 5 Anatomical diagnostic key . .6 6 BLOG bamboo tribe classification results . .7 Table 1. List of universal and diagnostic (ARMS) primer used in the current study. The table includes primer names and sequences, melting temperatures (Tm) of each individual primer, the annealing temperatures (An) for each primer pair and references to corresponding publications. Name Sequence (5’...3’) Tm (◦C) An (◦C) Design rbcLa fu ATGTCACCACAAACAGAGACTAAAGC 62.2 58 Kondo et al. [1996] rbcLa revu GTAAAATCAAGTCCACCRCG 74.7 Fofana et al. [1997] rbcLb-Sfu AGACCTTTTTGAAGAAGGTTCTGT 62.2 55 Dong et al. [2014] rbcLb-Sru TCGGTCAGAGCAGGCATATGCCA 74.7 1R KIM ru ACCCAGTCCATCTGGAAATCTTGGTTC 72.1 52 Ki-Joong Kimp 3F KIM fu CGTACAGTACTTTTGTGTTTACGAG 60.6 ITS5u GGAAGTAAAAGTCGTAACAAGG 58.4 56 White et al. [1990] ITS4u TCCTCCGCTTATTGATATGC 61.5 Bbo-C-407-rd AGGBGGRCCTSGRAAAGTTTTCGA 58.7 current study Dian-T-223-rd CGGGCTCGATGTGGTAGTAA 64.9 Cym-A-254-rd AGCTACATAACAGATATATTGATCAGG 59.5 d diagnostic primer (ARMS), destabilizing nucleotide underlined u universal primer p unpublished Table 3. GenBank sequence accessions of two plastid DNA regions (rbcL and matK) used in the current study. Taxon rbcL matK Arundinarieae Arundinaria gigantea subsp. tecta AJ746179 EF125165 Borinda emeryi EF125079 EF125167 Chimonobambusa marmorea AJ746176 EF125168 Drepanostachyum falcatum AJ746265 EF125170 Fargesia dracocephala AJ746266 KP685610 Fargesia sp. Asmussen AM110249 AM114722 Indocalamus latifolius AJ746177 EF125173 Phyllostachys aurea HE573324 AF164390 Phyllostachys bambusoides AB088833 AB088805 Phyllostachys nigra HE573325 EU434241 Pleioblastus maculatus JN247242 JN247148 Pseudosasa amabilis AJ746273 KP093752 Pseudosasa japonica FN870405 HG794001 Thamnocalamus spathiflorus EF125087 KP685639 Bambubseae Bambusa multiplex M91626 EF125166 1/7 Table 3.
    [Show full text]
  • New York State Department of Agriculture and Markets Division of Plant Industry Albany, New York 12235
    New York State Department of Agriculture and Markets Division of Plant Industry Albany, New York 12235 CIRCULAR 826 Article 9 of the Agriculture and Markets Law Chapter 631 Relating to INSPECTION AND SALE OF SEEDS with Rules and Regulations Revised 2013 NEW YORK STATE DEPARTMENT OF AGRICULTURE AND MARKETS ARTICLE 9 INSPECTION AND SALE OF SEEDS Section 136. Definitions. 137. Label requirements of all seeds including lawn seeding mixtures. 137-a. Responsibility for labeling. 138. Prohibitions. 139. Exemptions. 139-a. Tolerances. 140. Samples, publications of results of tests. 140-a. Provision for seed tests. 141. Certification. 142. Implementation. Section 136. Definitions. As used in this article unless otherwise expressly stated, or unless the context or subject matter otherwise requires: 1. The term “person” shall include any individual, partnership, corporation, company, society, or association. 2. The term “seed” means botanical structures used for planting purposes and commonly referred to as “seed” within this state. This includes tubers of the Irish potato when such tubers are represented as being suitable for planting purposes. 3. The term “agricultural seeds” and “crop seeds” includes the seeds of grass, forage, cereal, field beans, and fiber crops or any other kinds of seeds commonly recognized within this state as agricultural seeds, lawn seeds, and mixtures of such seeds. 4. The term “vegetable seeds” includes seeds of those food crops which are grown in gardens and on truck farms and are generally known and sold under the name of vegetable or herb seeds in this state. 5. The term “flower seeds” includes seeds of herbaceous plants grown for their blooms, ornamental foliage, or other ornamental parts and commonly known and sold under the name of flower seeds in this state.
    [Show full text]
  • Garden Reflections Designed Artfully, Still Water Features Mirror Plantings and Provide an Air of Tranquility in a Garden
    For ~ fower cJUU ~ all of us. Apit 16,May 30. The Epcot® International Flower & Garden Festival is a blooming riot of flower power, Enjoy millions of blossoms and phenomenal international gardens, plus interactive workshops and demonstrations with famous green thumbs from Disney and around the world, At night there 's music from the '60s and '70s followed by IllumiNations, It's great fun for the serious gardener and flower children of all ages! For gourmet brunch packages call us at 407·WDW·DINE and check out www,disneyworld,com for some flower power on the web, Guest Appearances by Home &Garden Television Personalities __________ • April 16-17, Kathy Renwald • April 23-24 , Erica Glasener • April 30-May 1, Gary Alan • May 7-8.Kitty Bartholomew . May 14-15, TBD • May 21-22, Paul James . May 28-29, Jim Wilson Included with regular Epcot. admission, Brunch packages sold separately, Guest appearances and entertainment subject to change. © Disney NEA 10060 Southern Living . & ~ co n t e n t s Volume 78, Number 2 March/Apri l 1999 DEPARTMENTS Commentary 4 Dianthus 24 Members' Forum 5 by Rand B. Lee (!(wanzan) chen7) bulb resource) provenance. Often overshadowed by their showy hybrid cousins) the lesmt-known species pinks haJ7e a sedate charm News from AHS 7 all theilt own that)s well worth cultivating. AHS wins award) Plant a Row for the Hungry) Rockefeller Center Tree ProJect) fossilized flowers. Reflecting Gardens 30 by Molly Dean Focus 10 Thltoughout the ages) landscapers have used the Be sun-smaltt while you garden. powelt of watelt to uni.b and enhance many elements Offshoots 14 ofgal tden design.
    [Show full text]
  • Download a PDF of Drought-Tolerant Landscapes for Alabama, ANR
    YARD AND GARDEN Drought-Tolerant Landscapes for Alabama ► Key issues in planning and implementing a water efficient landscape and recommended drought-tolerant landscape plants. A well-designed and managed landscape can reduce the amount of water needed for home landscape irrigation. This conservation of water becomes increasingly important as municipal governments impose broad watering bans in response to drought situations that create water shortages and strained water supplies. Overhead landscape irrigation is usually the target of these water conservation policies because it is viewed as noncritical consumption. Thoughtfully planned, attractive landscapes are important because they provide environmental benefits and add value and beauty to homes. The environmental benefits include reducing soil erosion and storm water runoff, providing wildlife habitats, removing carbon dioxide and pollutants from the atmosphere while adding oxygen, and keeping homes cooler in the summer and protecting them from cold winds in the winter. Homeowners can ensure a sustainable landscape by planning Some plants perform well with only occasional irrigation. for water conservation, choosing appropriate plants, improving the soil, establishing Early in the design process, divide the landscape plants properly, mulching, fertilizing correctly, and into low-, moderate-, and high-water-use areas, or watering efficiently. hydrozones. Walk around the landscape and identify places where the soil stays moist longer and separate Planning for Efficient Use of Water them from the areas fully exposed to the sun where the soil tends to dry quickly. It is important to plan a design for the landscape. The types of plants used and their location, the condition Low-water-use hydrozones should comprise as much of the soil, and other factors all affect how much water of the landscape as possible when water conservation must be used to maintain the landscape.
    [Show full text]
  • Chicago Department of Transportation Roadway Plant List
    CHICAGOCHICAGO DEPARTMENTDEPARTMENT OFOF TRANSPORTATIONTRANSPORTATION Richard M. Daley, Mayor Thomas H. Powers ROADWAYROADWAY PLANTPLANT LISTLIST Acting Commissioner Compiled by DIVISION OF ENGINEERING TH 7 Edition HISTORIC GARFIELD BOULEVARD CHICAGO DEPARTMENT OF TRANSPORTATION ROADWAY PLANT LIST The Chicago Department of Transportation (CDOT) Division of Engineering is pleased to present the newest edition of the City of Chicago’s Roadway Plant List, intended as a resource for landscape architects. CDOT has evaluated the plants on this list based on its years of experience maintaining medians and other roadside locations. The accompanying comments are based on the plants’ ability to withstand salt spray and other urban roadway conditions. Although no scientific trials were conducted, installation and maintenance of the plant material have been done in accordance with standard CDOT specifications. As a result, cultural conditions such as soil structure, composition and moisture are known factors. CDOT’s list highlights plant materials in order of consideration. Dark gray rows indicate plants that are not recommended. Light gray rows include plant materials that are currently under evaluation or have not yet been used. It also indicates plant selections which survive in the roadway but have attributes which negatively affect the plant’s performance in a municipal application. Although the “concerns” are independent of CDOT’s assessment of the plants’ sustenance in the roadway, CDOT expects selections to consist of plants that both survive on medians and have no additional concerns. We hope this guide proves a valuable tool for industry professionals. For more information, please contact CDOT’s Division of Engineering at (312) 744-3520. Cover Page Photo: Springtime on Historic Garfield Boulevard.
    [Show full text]
  • A List of Vascular Plant Species in the Nova Scotia Flora
    A list of vascular plant species in the Nova Scotia flora AFTER the page below was posted, The Atlantic Canada Conservation Data Centre posted their authoritative lists of Species Ranks for vascualar and non-vascular plants and for invertebrate and vertebrate animals for each of the Atlantic Provinces. See ACCDC Species Ranks. The page below remains posted for the time-being, but visitors are advised that the ACCDC Species Ranks pages are the better ones to consult. A list of native and naturalized vascular plant species in Nova Scotia was generated from Wild Species 2005: The General Status of Species in Canada using the General Status Search Tool. See Wild Species 2005:General Status Summaries:Vascular Plants for details about the listings. The Report parameters were: Report: "Ferns (2005), Orchids (2005), Vascular Plants (2005)" Status: "At risk, May be at risk, Sensitive, Secure, Undetermined, Not assessed, Exotic" Range: "NS" A total of 1657 records matched those criteria. The conservation rankings and number of species within each rank were as follows: Rank Description No. Species 1 At Risk 8 2 May Be At Risk 127 3 Sensitive 136 4 Secure 694 5 Undetermined 96 6 Not Assessed 0 7 Exotic 596 The list is convenient for looking up scientific names of species for which you have a common name or vice versa, also to see a list of all species within a family. Use your browser's FIND function to find a name within the page. Limitations Please note that only one common name for each species is given, also that synonyms for the scientific names are not listed.
    [Show full text]
  • Southern Garden History Plant Lists
    Southern Plant Lists Southern Garden History Society A Joint Project With The Colonial Williamsburg Foundation September 2000 1 INTRODUCTION Plants are the major component of any garden, and it is paramount to understanding the history of gardens and gardening to know the history of plants. For those interested in the garden history of the American south, the provenance of plants in our gardens is a continuing challenge. A number of years ago the Southern Garden History Society set out to create a ‘southern plant list’ featuring the dates of introduction of plants into horticulture in the South. This proved to be a daunting task, as the date of introduction of a plant into gardens along the eastern seaboard of the Middle Atlantic States was different than the date of introduction along the Gulf Coast, or the Southern Highlands. To complicate maters, a plant native to the Mississippi River valley might be brought in to a New Orleans gardens many years before it found its way into a Virginia garden. A more logical project seemed to be to assemble a broad array plant lists, with lists from each geographic region and across the spectrum of time. The project’s purpose is to bring together in one place a base of information, a data base, if you will, that will allow those interested in old gardens to determine the plants available and popular in the different regions at certain times. This manual is the fruition of a joint undertaking between the Southern Garden History Society and the Colonial Williamsburg Foundation. In choosing lists to be included, I have been rather ruthless in expecting that the lists be specific to a place and a time.
    [Show full text]
  • Gardenergardener®
    TheThe AmericanAmerican GARDENERGARDENER® TheThe MagazineMagazine ofof thethe AAmericanmerican HorticulturalHorticultural SocietySociety March / April 2016 HighHigh StyleStyle with Flowering Vines Deciduous Conifers for Today’s Gardens Charming Perennial Pinks Companion Planting: Does It Really Work? Baby Pete™ Lily Of The Nile Agapanthus praecox ssp. orientalis ‘Benfran’ P.P. #21,705 Monrovia makes it easy to create a beautiful garden. For a profusion of bright blue fl owers, our exclusive Baby Pete™ Lily of the Nile is stunning in a container or planted in a perennial border. It is shorter and more compact, making it ideal for a smaller garden. This maintenance-free beauty will provide abundant color from May to September. All Monrovia plants are regionally grown in our custom-blended, nutrient-rich soil and tended carefully to ensure the healthiest plant. We work with the best breeders around the world to fi nd improved plant varieties that perform better in the garden. Plus, consumers can now order plants on shop.monrovia.com and have them sent to your garden center for pick up! Call your local Monrovia sales representative for details and to enroll in the program. Insta Free App AMERICAN HORTICULTURAL SOCIETY HOMEGROWN Making America a Nation of Gardeners, a Land of Gardens With Bonnie Plants Board of Directors CHAIR Amy Bolton Falls Church, Virginia FIRST VICE CHAIRMAN Jane Diamantis McDonald, Tennessee SECOND VICE CHAIRMAN Mary Pat Matheson Atlanta, Georgia SECRETARY Nancy Hargroves Manakin Sabot, Virginia TREASURER J. Landon Reeve, IV Woodbine, Maryland IMMEDIATE PAST CHAIR Harry A. Rissetto, Esq. Falls Church, Virginia EXECUTIVE COMMITTEE Henrietta Burke Alexandria, Virginia Marcia Zech Mercer Island, Washington Skipp Calvert Alexandria, Virginia Q Tim Conlon Dubuque, Iowa Q Gay Estes Houston, Texas Tom Johnson Washington, D.C.
    [Show full text]