DOCSLIB.ORG

2018 Catalog Compressed.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
2018 Catalog Compressed.Pdf 2018 Plant Catalogue Hemerocallis ‘Bold Tiger’ Bold Tiger Daylily As bold as its name, bright orange petals with Zone 4-9 Height Spacing a large red eye and yellow-green throat. 28” 18-24” Bloom Color Petals are dramatically recurved with a nicely Zone Culture ruffled edge. Well-branched with heavily Orange w/ Red Eye Sun to Part Shade budded scapes. Tetraploid. Dormant winter foliage. Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Brookwood Black Kitten’ Brookwood Black Kitten Daylily Thus unusual color will wow you and your Zone 3-9 Height Spacing guests with its Black Red flower with 22” 18-24” Bloom Color contrasting midrib stripe. Zone Culture Diploid. Dormant winter foliage. Black Red Sun to Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Celebrity Elite’ Celebrity Elite Daylily A cherry-red flower with yellow throats over Zone 3-9 Height Spacing grass-like leaf blades. Blooms in mid July. 25” 18-24” Bloom Color Dormant foliage in winter. Diploid. Zone Culture Red Self Sun to Part Shade Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Chicago Apache’ Chicago Apache Daylily Intense scarlet red blooms with a golden Zone 4-9 Height Spacing throat are 5” across. Petals have a loosely 28” 18-24” Bloom Color ruffled edge. Very sun-fast. Zone Culture Dormant foliage, Tetraploid. Red Self Sun or Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid-Late Summer Butterflies, Hummers Hemerocallis ‘Daring Deception’ Daring Deception Daylily Features dusky cream-pink trumpet-shaped Zone 3-9 Height Spacing flowers with a burgundy-purple throat and 24” 18-24” Bloom Color pie-crust edging. Petals overlap, creating a Zone Culture uniquely shaped eyezone. Its grassy leaves Creamy Pink w/ Sun to Partial Shade remain attractive all season. Tetraploid. Burgundy Eye Deer resistant. Moist, Well Drained Bloom Season Attracts Late June-July, Butterflies, Hummers 2018 Plant Catalogue Hemerocallis ‘Dominic’ Dominic Daylily This early to mid season bloomer with Zone 4-9 Height Spacing gorgeous 5.5” dark reddish-black flowers 30” 18-24” Bloom Color with yellow throat. Plant is very vigorous and Zone Culture increases rapidly. Foliage is semi-evergreen Red Black Sun or Part Shade in winter. Tetraploid. Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘El desperado’ El desperado Daylily Butter yellow flowers with a striking wine- Zone 3-9 Height Spacing purple eye and matching picotee edge. 28” 18-24” Bloom Color Extended bloom (flowers last at least 16 Zone Culture hours). Tetraploid. Dormant winter foliage. Yellow, Wine eyezone Sun-Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid-Late Summer Butterflies, Hummers Hemerocallis ‘Entrapment’ Entrapment Daylily Super bloomer with over 600 flowers after 3 Zone 3-9 Height Spacing years. Large 6" blue-purple flowers with a 26” 18-24” Bloom Color yellow throat and wonderful ruffling. Zone Culture Excellent rebloomer and destined to be one of Blue-purple self Sun-Part Shade the best. Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid-season, Butterflies, Hummers Hemerocallis ‘Fooled Me’ Fooled Me Daylily Winner of many awards, this popular variety Zone 4-9 Height Spacing has large (5.5”) flowers of a golden-yellow 22” 18-24” Bloom Color with a striking deep red eye and matching Zone Culture picotee, pie crust edge. Bright Yellow, Red Sun or Part Shade Dormant winter foliage. Tetraploid. Throat Throat Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid-Late Summer Butterflies, Hummers Hemerocallis ‘Gentle Shepherd’ Gentle Shepherd Daylily Lightly ruffled 5” nearly white flowers with a Zone 3-9 Height Spacing green throats make a nice highlight in the 29” 18-24” Bloom Color garden. Bloom time is early to mid July. Zone Culture Semi-evergreen winter foliage. Diploid. White Sun to Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Early-Mid Summer Butterflies, Hummers 2018 Plant Catalogue Hemerocallis ‘Grape Velvet’ Grape Velvet Daylily The 4.5” flowers are deep wine purple with Zone 3-9 Height Spacing paler mid-rib and yellow throat. 24” 18-24” Bloom Color Dormant winter foliage. Diploid. Zone Culture Rabbit resistant. Deep Wine Purple Sun to Part Shade Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Happy Returns’ Happy Returns Daylily Fragrant, 3” canary-yellow blooms over dark Zone 4-9 Height Spacing green leaves. Good repeat bloomer. 18” 18-24” Bloom Color Extended length of bloom. Zone Culture Dormant foliage, Diploid. Yellow Self Sun or Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Early-Late Summer Butterflies, Hummers Hemerocallis ‘Hyperion’ Hyperion Daylily Canary yellow flowers are carried in profusion Zone 3-9 Height Spacing above vigorous clumps of grasslike foliage. 40” 18-24” Bloom Color The flowers have a light, sweet fragrance Zone Culture often not found in newer hybrids. Great Lemon-yellow Sun to Part Shade landscape plant. Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid-late Summer Butterflies, Hummers Hemerocallis ‘Inwood’ Inwood Daylily Fragrant, very pale peachy yellow flowers Zone 3-9 Height Spacing with a sharply contrasting plum purple eye 25” 18-24” Bloom Color zone and matching picotee edge on the Zone Culture petals. It is an early to midseason performer Yellow/Burgundy eye Sun or Part Shade with re-bloom. Foliage is winter dormant. Tetraploid. Moist, Well Drained Rabbit resistant. Bloom Season Attracts Early-Mid Summer Butterflies, Hummers Hemerocallis ‘Joan Senior’ Joan Senior Daylily Exquisite, slightly recurved creamy white Zone 4-9 Height Spacing blossoms with a pale yellow watermark and a 24-30” 18-24” Bloom Color soft yellow-green throat. Flowers last at least Zone Culture 16 hours each. Foliage is evergreen, Diploid White Self Sun to Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Early-Mid Summer, Butterflies, Hummers 2018 Plant Catalogue Hemerocallis ‘Jolyene Nichole’ Jolyene Nichole Daylily A popular variety with big deep rose pink Zone 4-9 Height Spacing blooms held on short scapes. 16” 18-24” Bloom Color Semi-evergreen winter foliage. Diploid. Zone Culture Rabbit resistant. Rose-Pink Self Sun to Part Shade Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Lilting Belle’ Lilting Belle Daylily Spider variant with very unusual orchid-pink Zone 3-9 Height Spacing blooms that have an extended bloom time. 36” 18-24” Bloom Color Semi-evergreen winter foliage. Diploid. Zone Culture Rabbit resistant. Pink w/ near White eye Sun to Part Shade Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Mighty Chestnut’ Mighty Chestnut Daylily Aptly named, the 5 to 5.5”, russet red-orange Zone 3-9 Height Spacing blossoms with a deep burgundy eye and gold 30” 18-24” Bloom Color throat. The broad, rounded, ruffled petals Zone Culture open wide and reveal a perfect form. Russet, Red-Orange Sun or Part Shade Dormant, Tetraploid with extended bloom. Rabbit resistant. Average to Moist, Well Bloom Season Attracts Early-Late Summer, Butterflies, Hummers Hemerocallis ‘Mini Pearl’ Mini Pearl Daylily Fragrant, melon pink, 3” flowers on 16” Zone 3-9 Height Spacing scapes above clumps of arching, blade-like 12-18” 12-18” Bloom Color dark green leaves. Blooms early to midseason Zone Culture with extended bloom and repeat bloom. Melon Pink Sun-Part Shade Foliage is winter evergreen. Diploid. Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Moonlit Masqueurade’ Moonlit MAsquerade Daylily Strong grower with 6” creamy white petals Zone 3-9 Height Spacing with a dark purple eye and picotee edge. 22-26” 18-24” Bloom Color Semi-evergreen winter foliage. Reblooms. Zone Culture Tetraploid. Creamy white, purple Sun or Part Shade Rabbit resistant. eye Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers 2018 Plant Catalogue Hemerocallis ‘Omomuki’ Omomuki Daylily One of the best yellow tetraploid daylilies Zone 4-9 Height Spacing with 5”, delightfully fragrant, heavily ruffled 26” 18-24” Bloom Color clear yellow flowers with a bright green Zone Culture throat. Well branched and heavily budded, Yellow Sun or Part Shade each flower will last at least 16 hours. Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Pardon Me’ Pardon Me Daylily A miniature daylily, 2.75”,fragrant, cranberry Zone 3-9 Height Spacing red petals with a narrow yellow watermark 18” 18-24” Bloom Color and bright green throat. Heavily budded so Zone Culture blooms continue from mid-July to early fall Cranberry red Sun or Part Shade with rebloom. Rabbit resistant. Average to Moist, Well Bloom Season Attracts Early-Late Summer, Butterflies, Hummers Hemerocallis ‘Preview Party’ Preview Party Daylily The 6”, lightly ruffled flowers are burnish Zone 3-9 Height Spacing gold with a burgundy eyezone. It will be the 25” 18-24” Bloom Color first large flowered variety to bloom in late Zone Culture spring-early summer. Tetraploid. Gold with Burgundy Sun to Part Shade Dormant winter foliage, eye Rabbit resistant. Moist, Well Drained Bloom Season Attracts Late Spring-Early Butterflies, Hummers Hemerocallis ‘Primal Scream’ Primal Scream Daylily Nothing comes close to the enormous, Zone 3-9 Height Spacing glimmering tangerine-orange, gold dusted 30” 18-24” Bloom Color blossoms that have narrow, twisted, ruffled Zone Culture petals. Dormant winter foliage. Tetraploid. Tangerine-Orange Sun or Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Purple de Oro’ Purple d’Oro Daylily AKA ‘Razzmatazz’ is a miniature with Zone 4-9 Height Spacing compact growth. Petals have a narrow pie 20" 18-24” Bloom Color crust edge, dark purple veining and paler Zone Culture purple midribs.
Load more

Recommended publications
  • 2006 Catalog
    Friends School of Minnesota Nonprofit Org. U.S. Postage 1365 Englewood Avenue PAID Saint Paul, MN 55104 Minneapolis, MN Permit No. 1767 TIME VALUE DATA If you have received a duplicate copy, please let us know, and pass the extra to a friend! North Star Originals 6 The Himalayan Saint Paul, Blue Poppy FROM 35W Minnesota FROM HWY 3 What’s “Native” LARPENTEUR AVENUE SNELLING AVE Mean When It Comes to Plants? Minnesota State Fair Friends School CLEVELAND AVE Plant Sale 280 COMMONWEALTH DAN PATCH MIDWAY PKWY P May 12, 13, 14, 2006 Friday,May 12 36 COMO AVENUE Cleveland 35W Snelling 11:00 A.M.–8:00 P.M. Larpenteur CANFIELD Saturday,May 13 State Fair Grandstand PLANT SALE 9:00 A.M.–8:00 P.M. Y 280 Como G PAR ER K N FROM 94 E Sunday,May 14 Friends School NOON P.M. The native Penstemon grandiflorus 12:00 –4:00 (Large-Flowered Beardtongue), 94 photographed in St. Paul’s At the State Fair Midway area during summer 2005. Grandstand 17th Annual Friends School Plant Sale May 12th, 13th and 14th, 2006 Friday 11:00 A.M.–8:00 P.M.• Saturday 9:00 A.M.–8:00 P.M. Sunday 12:00 NOON–4:00 P.M.Sunday is half-price day at the Minnesota State Fair Grandstand Friends School of Minnesota Thank you for supporting Friends School of Minnesota by purchasing plants at our sale. Friends School of Minnesota prepares children to embrace life, learning, and community with hope, skill, understanding, and creativity. We are committed to the Quaker values of peace, justice, simplicity and integrity.
    [Show full text]
  • Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: a Review
    Available online at www.ijpab.com Dhakar and Soni Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) ISSN: 2320 – 7051 DOI: http://dx.doi.org/10.18782/2320-7051.5192 ISSN: 2320 – 7051 Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) Review Article Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: A Review Sunita Dhakar1* and Anjali Soni2 1Division of Floriculture and Landscaping, ICAR- IARI, New Delhi 110012, India 2Division of Fruits and Horticultural Technology, ICAR-IARI, New Delhi 110012, India *Corresponding Author E-mail: [email protected] Received: 11.07.2017 | Revised: 19.08.2017 | Accepted: 26.08.2017 ABSTRACT Flower colours are of paramount importance in the ecology of plants and their ability to attract pollinators and seed dispersing organisms. The primary pigments occurring in plants are chlorophylls and carotenoids accumulated in plastids, anthocyanins and betalains, which are dissolved in vacuolar sap. Flavonoids and carotenoids are widely distributed in plant pigments. Among the factors influencing flower colour, anthocyanin biosynthesis has been the most extensively studied. Each plant species usually accumulates limited kinds of anthocyanins and exhibits limited flower colour. For example, roses and carnations lack violet/blue colour because they do not accumulate delphinidin-based anthocyanins and petunia and cymbidium lack brick red/orange colour due to the lack of pelargonidin-based anthocyanins. Different approaches are used for development of novel flower colour in floricultural crops like hybridization, mutation and genetic engineering. Advances in molecular biology and plant transformation technology have made possible the engineering of an anthocyanin biosynthetic pathway by the overexpression of heterologous flavonoid biosynthetic genes or the down-regulation of endogenous genes in transgenic plants.
    [Show full text]
  • SUPPLEMENTARY TABLES LIST of TABLES 1 List of Universal and Diagnostic Primer
    SUPPLEMENTARY TABLES LIST OF TABLES 1 List of universal and diagnostic primer . .1 3 Genbank sequence accessions (cytoplasmic) . .1 4 Genbank sequence accessions (nuclear) . .2 2 List of secondary specimens (lemongrass and carnation) . .5 5 Anatomical diagnostic key . .6 6 BLOG bamboo tribe classification results . .7 Table 1. List of universal and diagnostic (ARMS) primer used in the current study. The table includes primer names and sequences, melting temperatures (Tm) of each individual primer, the annealing temperatures (An) for each primer pair and references to corresponding publications. Name Sequence (5’...3’) Tm (◦C) An (◦C) Design rbcLa fu ATGTCACCACAAACAGAGACTAAAGC 62.2 58 Kondo et al. [1996] rbcLa revu GTAAAATCAAGTCCACCRCG 74.7 Fofana et al. [1997] rbcLb-Sfu AGACCTTTTTGAAGAAGGTTCTGT 62.2 55 Dong et al. [2014] rbcLb-Sru TCGGTCAGAGCAGGCATATGCCA 74.7 1R KIM ru ACCCAGTCCATCTGGAAATCTTGGTTC 72.1 52 Ki-Joong Kimp 3F KIM fu CGTACAGTACTTTTGTGTTTACGAG 60.6 ITS5u GGAAGTAAAAGTCGTAACAAGG 58.4 56 White et al. [1990] ITS4u TCCTCCGCTTATTGATATGC 61.5 Bbo-C-407-rd AGGBGGRCCTSGRAAAGTTTTCGA 58.7 current study Dian-T-223-rd CGGGCTCGATGTGGTAGTAA 64.9 Cym-A-254-rd AGCTACATAACAGATATATTGATCAGG 59.5 d diagnostic primer (ARMS), destabilizing nucleotide underlined u universal primer p unpublished Table 3. GenBank sequence accessions of two plastid DNA regions (rbcL and matK) used in the current study. Taxon rbcL matK Arundinarieae Arundinaria gigantea subsp. tecta AJ746179 EF125165 Borinda emeryi EF125079 EF125167 Chimonobambusa marmorea AJ746176 EF125168 Drepanostachyum falcatum AJ746265 EF125170 Fargesia dracocephala AJ746266 KP685610 Fargesia sp. Asmussen AM110249 AM114722 Indocalamus latifolius AJ746177 EF125173 Phyllostachys aurea HE573324 AF164390 Phyllostachys bambusoides AB088833 AB088805 Phyllostachys nigra HE573325 EU434241 Pleioblastus maculatus JN247242 JN247148 Pseudosasa amabilis AJ746273 KP093752 Pseudosasa japonica FN870405 HG794001 Thamnocalamus spathiflorus EF125087 KP685639 Bambubseae Bambusa multiplex M91626 EF125166 1/7 Table 3.
    [Show full text]
  • University of Montenegro Faculty of Sciences and Mathematics
    UNIVERSITY OF MONTENEGRO FACULTY OF SCIENCES AND MATHEMATICS PROTECTED AREA GAP ASSESSMENT WITH COMPREHENSIVE PLAN FOR A REPRESENTATIVE PAS (PROTECTED AREA SYSTEM) November, 2012th 1 PROJETC TEAM: DR DANILO MRDAK – Project leader, expert for fish, for conservation issues and for sustainable development DR DANKA CAKOVIĆ – Expert for botany and conservation issues MR SNEŽANA VUKSANOVIĆ – Expert for botany DR MARKO KARAMAN – Expert for invertebrate fauna DR RUŽA ĆIROVIĆ – Expert for herpetofauna MR NELA VEŠOVIĆ – DUBAK – Expert for bird fauna DR VESNA MAČIĆ – Expert on marine flora and fauna MR MARINA ĐUROVIĆ - Expert on mammal fauna DR SNEŽANA DRAGIĆEVIĆ – Expert on moss DR GORDANA KASOM – Expert on fungi DR DRAGANA MILOŠEVIĆ – Expert for conservation issues MR ANA KATNIĆ – Expert for sustainable development DR SEONA ANDERSON – International expert for conservation issues DR PREDRAG STANIŠIĆ - Expert for data basis MR MARJAN ERCEG – Expert for GIS 2 3 1. IDENTIFICATION, ASSESSING AND MAPPING OF HABITATS AND SPECIES DISTRIBUTION 1.1. Identification and assessing Experts for botany reviewed list of habitats related to Montenegro (lend and marine). They paid attention on habitats that were specified as important for Emerald network designation as well as to ones that were of interest for Yearly Monitoring of Biodiversity status 2011th. The Botany team identifies habitats that are either endangered or threatened as well as the ones that are rare or specific for Balkan nature. They produce check list of habitats that serve as a referent check
    [Show full text]
  • Alpine Garden Club of British Columbia Seed Exchange 2015
    Alpine GArden Club of british ColumbiA seed exChAnGe 2015 We are very grateful to all those members who have made our Seed Exchange possible through donating seeds, and to those living locally who volunteer so much time and effort to packaging and filling orders. We especially appreciate those donors who made an extra effort in this difficult summer. We have fewer donors but still a good list and that is thanks to them. Read the following instructions carefully before filling out the seed request form. PLEASE KEEP YOUR SEED LIST, packets will be marked by number only. Please send the Seed Exchange Request Form (last page of booklet) by mail as soon as possible, but no later than DECEMBER 10. You can request your seeds on-line (see back page) and the complete seed list is available on the website for reference. This year you will find a special list of plants at the end of the ‘Native to North America’ section, of plants wild collected on Pink Mountain in northern BC. Please see the accompanying note in the November Bulletin. The Club would appreciate it if anyone who raises plants from these seeds and obtains seed from them would let us know. Those seeds may be useful in the future for revegetation projects. Allocation: Donors may receive up to 60 packets and non-donors 30 packets, limit of one packet of each selection. Donors receive preference for seeds in short supply. (USDA will permit no more than 50 packets for those living in the USA.) List first choices by number only, in strict numerical order, from left to right on the order form.
    [Show full text]
  • Serbia and Montenegro Biodiversity Analysis, 2002
    FAA SECTION 119 BIODIVERSITY ANALYSIS FOR SERBIA AND MONTENEGRO Prepared for: United States Agency for International Development Mission to the Federal Republics of Yugoslavia Submitted By: Loren L. Schulze and The Environmental Information Systems and Networking Project (Contract No. EE-C-00-98-00001-00) DevTech Systems, Inc. May 2002 Final Report Note This document was prepared under the auspices of United States Agency for International Development (USAID) by a Biodiversity Analysis Team. The team was comprised of Dr. Loren L. Schulze, team leader and consultants from the Environmental Information Systems and Networking Project managed by DevTech Systems, Inc. Dr. Bruce A Byers consultant ecologist was responsible for the ecological analysis and Violeta Orlovic was responsible for the institutional analysis. The statements and opinions expressed herein are not necessarily those of either USAID or DevTech Systems, Inc. Table of Contents Table of Contents ............................................................................................................................... 1 List of Appendices ............................................................................................................................. 3 Executive Summary ........................................................................................................................... 4 Introduction ........................................................................................................................................ 5 Section One: Conservation
    [Show full text]
  • SUPPLEMENTARY TABLES LIST of TABLES 1 List of Primers
    SUPPLEMENTARY TABLES LIST OF TABLES 1 List of Primers . .1 2 List of Reference Plant Accessions (lemongrass and carnation) . .1 3 Genbank sequence Accessions (cytoplasmic) . .2 4 Genbank sequence Accessions (nuclear) . .3 5 Anatomical diagnostic key . .5 Table 1. List of universal and diagnostic (ARMS) primer used in the current study. Name Sequence (5’...3’) Tm (◦C) Design rbcLa fu ATGTCACCACAAACAGAGACTAAAGC 62.2 ? rbcLa revu GTAAAATCAAGTCCACCRCG 74.7 ? rbcLb-Sfu AGACCTTTTTGAAGAAGGTTCTGT 62.2 ? rbcLb-Sru TCGGTCAGAGCAGGCATATGCCA 74.7 ? 1R KIM ru ACCCAGTCCATCTGGAAATCTTGGTTC 72.1 Ki-Joong Kimp 3F KIM fu CGTACAGTACTTTTGTGTTTACGAG 60.6 Ki-Joong Kimp ITS5u GGAAGTAAAAGTCGTAACAAGG 58.4 ? ITS4u TCCTCCGCTTATTGATATGC 61.5 ? Bbo-C-407-rd AGGBGGRCCTSGRAAAGTTTTCGA 58.7 current study Dian-T-223-rd CGGGCTCGATGTGGTAGTAA 64.9 current study Cym-A-254-rd AGCTACATAACAGATATATTGATCAGG 59.5 current study d diagnostic primer (ARMS), destabilizing nucleotide underlined u universal primer p unpublished Table 2. Reference plant accessions (Acc) of lemongrass (Cymbopogon, Panicoideae) (L1 - L2) and carnation (Dianthus, Caryophyllaceae) (D1 - D10) their taxon names and Genbank sequence accessions of three plastid DNA regions (rbcLa, rbcLb and matK-KIM) and for carnation accessions also for one nuclear DNA region (ITS). Acc Taxon rbcLa rbcLb matK-KIM ITS Panicoideae L1 Cymbopogon citratus KU722908 KU748525 KU722906 - L2 Cymbopogon citratus KU722907 KU748524 KU722905 - Caryophyllaceae D1 Dianthus caryophyllus KU722895 KU722853 KU722867 KU722881 D2 Dianthus chinensis KU722896 KU722854 KU722868 KU722882 D3 Dianthus deltoides KU722898 KU722856 KU722870 KU722884 D4 Dianthus deltoides KU722897 KU722855 KU722869 KU722883 D5 Dianthus gratianopolitanus KU722899 KU722857 KU722871 KU722885 D6 Dianthus imereticus KU722900 KU722858 KU722872 KU722886 D7 Dianthus longicalyx KU722901 KU722859 KU722873 KU722887 D8 Dianthus superbus KU722902 KU722860 KU722874 KU722888 D9 Dianthus superbus KU722903 KU722861 KU722875 KU722889 D10 Dianthus turkestanicus KU722904 KU722862 KU722876 KU722890 1/5 Table 3.
    [Show full text]
  • Cultiu in Vitro
    INTRODUCCIÓ EXPERIMENTAL A LA BIOTECNOLOGIA AMB CLAVELLINA: CULTIU IN VITRO AGRAÏMENTS Vull donar les gràcies al meu tutor del Treball de Recerca, Jordi Sanfeliu, per la seva disposició a ajudar-me i col·laborar, sobretot en la part pràctica. També als meus amics, Cristian, Carla , Adrià i Arantxa per estar sempre al meu costat ajudant-me i animant-me. Moltes gràcies. 2on de Batxillerat TdR. Cultiu in vitro amb clavellina ÍNDEX AGRAÏMENTS................................................................................................................ 2 ARTICLE ......................................................................................................................... 4 INTRODUCCIÓ............................................................................................................. 15 La clavellina ................................................................................................................... 16 Taxonomia.............................................................................................................. 16 Origen geogràfic..................................................................................................... 17 Descripció............................................................................................................... 18 Multiplicació........................................................................................................... 19 Usos .......................................................................................................................
    [Show full text]
  • North American Rock Garden Society |
    Bulletin of the American Rock Garden Society VOL. 43 FALL 85 NO. 4 THE BULLETIN CONTENTS VOL. 43 NO. 4 FALL 1985 And Then, There Are the Dianthus — Richard L. Critz 167 Donald E. Havens — Olive Thomson 180 Award Winners — 1985: Award of Merit, Donald E. Havens, Norman Singer; LePiniec Award, William J. Hamilton; Carleton R. Worth Prize, Mark McDonough 181 Native Plants of Vermont — Arthur Gilman 189 European Notebook: A 50th Anniversary, Floraire, and H. Correvon — Margaret and Paul Halladin 195 Hazel Feakins Smith 200 Portable Frames — Frederick K. Watson, Jr. 201 Six Idaho Batholith Endemics — Roy Davidson 205 Garden Ecology — Paul Palomino 208 A Field Trip to Mt. Dobson — Brenda Snadon 209 Book Review: The Cultivated Hemlocks by Dr. John C. Swartley 210 Omnium-Gatherum 212 CALENDAR OF COMING EVENTS — 1986 Jan. 24-26 Eastern Winter Study Weekend Hotel duPont Wilmington, DE Feb. 28- Western Winter Study Weekend Empress Hotel March 2 Victoria, B.C. June 28- Second Interim International Alpine Boulder and July 2 Conference (and Annual Meeting) Denver Cover Picture: Dodecatheon sp., Ice Lake, Wallowa Mountains Phil Pearson, photographer Published quarterly by the AMERICAN ROCK GARDEN SOCIETY, a tax-exempt, non-profit organization incor• porated under the laws of the state of New Jersey. You are invited to join. Annual dues (Bulletin included), to be sub• mitted in U.S. funds or International Money Order, are: General Membership, $15.00 (includes domestic or foreign, single or joint — two at same address to receive one Bulletin, one Seed List); Patron, $50.00; Life Member (individual only), over 55, $300; under 55, $350.
    [Show full text]
  • 2020–2021 Seed Exchange Catalog
    MID-ATLANTIC GROUP 2020–2021 Seed Exchange Catalog The 27th annual edition of the Seed Exchange Our Seed Donors Catalog includes 916 seed donations con- Catalog listed seed was generously contributed by our members. tributed by 51 gardeners, from beginners to Where the initial source name is followed by “/”and other member names, the latter identifies those who actually selected, collected, professionals. Approximately 90 new plants cleaned, and then provided descriptions to the members who pre- were donated for the first time. As you can pared the catalog. If a donor reported their zone, you will find it in see, this seed program includes new plants parenthesis. Our sincere thanks to our donors—they make this Seed not previously offered as well as old favorites. Exchange possible. We realize how important this Seed Exchange Bartlett, John 45 (6b) Mahony, Peter 590 (7a) is to HPS and to our members and that is why Bartram’s Garden/ Malarek, David 2608 Katie Jacoby 9975 Malocsay, Jan-Paul 592 (6) we decided to continue the tradition during Berger, Clara 65 McGowan, Brian 3666 (5) the pandemic. Bittmann, Frank 2937 (6a) McShane, Nadeen 627 Bowditch, Margaret 84 (6b) Mills, Michael 2504 We’re sure you’ll enjoy perusing this year’s Boylan, Rebecca 2137 (6b) Nachlas, Sally 2621 (6) selections and you will find plants your gar- Cresson, Charles 199 (7) Norfolk Botanical Staff/ den can’t do without! Since some listed seed Creveling, Beth 200 (7) Julie Finn 1999 (8a) Cyphers, Barry 1181 Perron, William 3321 (6) is in short supply, you are encouraged to Doblmaier, Susan 2515 (6b) Plant Delights 32 place your order early.
    [Show full text]
  • French (2.287Mb)
    EP Programme des Nations Unies pour l’Environnement UNEP(DEPI)/MED WG.308/3 2 Mai 2007 I ORIGINAL: FRANÇAIS PLAN D’ACTION POUR LA MEDITERRANEE Huitième réunion des Points Focaux Nationaux pour les ASP Palerme, Italie, 6-9 juin 2007 Synthèse des Rapports Nationaux sur la Mise en Œuvre du Protocole Relatif aux Aires Spécialement Protégées et à la Diversité Biologique en Méditerranée, pour la Période Mars 2005 – Mars 2007 PNUE CAR/ASP - Tunis, 2007 Note : Les appellations employées dans ce document et la présentation des données qui y figurent n’impliquent de la part du CAR/ASP et du PNUE aucune prise de position quant au statut juridique des pays, territoires, villes ou zones, ou de leur autorité, ni quant au tracé de leur frontière ou limites. © 2007 Programme des Nations Unies pour l'Environnement Plan d'action pour la Méditerranée Centre d’Activités Régionales pour les Aires Spécialement Protégées (CAR/ASP) B.P. 337 - 1080 Tunis CEDEX E-mail : [email protected] La synthèse des rapports nationaux a été préparé pour le Centre d’Activité Régional pour les Aires Spécialement Protégées (CAR/ASP) par : C. LE RAVALLEC 13 bd Perrin 13013 Marseille (France) Avec le concours de C. RAIS OKIANOS 1, Boulevard de l'Environnement 8110 Tabarka (Tunisia) SOMMAIRE I. INTRODUCTION ..................................................................................................................................................1 II. INFORMATIONS GENERALES.........................................................................................................................1
    [Show full text]
  • Download Alien Species in Norway
    Alien species in Norway – with the Norwegian Black List 2012 Alien species in Norway – with the Norwegian Black List 2012 presents an overview of ecological impact assessments of alien species which reproduce in Norwegian territories. The assessments are based upon a new and semi- quantitative set of criteria, where the species’ invasion potential and ecological effect are considered. The work has been carried out by 11 groups of experts who have treated ca. 2500 species. Impact assessments have been made for 1180 alien species which reproduce in Norwegian territories and for 134 species which might arrive in Norway with the aid of humans in the future – so called ‘door knockers’. A total of 106 species are categorised as having a severe impact, 111 species as having a high impact, 198 species as having a potentially high impact, 399 species as having a low impact, and 366 species as having no known impact in Norwegian nature. In addition, species inform- ation has been gathered for 1071 alien species which do not reproduce on the Norwegian mainland and territorial waters, and 69 non-reproducing alien species observed in Svalbard. Distribution: Norwegian Biodiversity Information Centre 7491 Trondheim Alien species in Norway Phone: +47 73592145 e-mail: [email protected] –with the Norwegian Black List www.biodiversity.no 2012 Alien species in Norway –with the Norwegian Black List 2012 Editors Lisbeth Gederaas, Toril Loennechen Moen, Sigrun Skjelseth, Line-Kristin Larsen Project management Lisbeth Gederaas Groups of experts See chapter “The work of the expert groups” Database development and management Stein Arild Hoem, Helge Sandmark Layout Skipnes Kommunikasjon AS, Åshild Viken (front cover) Cover Harmonia axyridis Cover photo Bjørn H.
    [Show full text]