DOCSLIB.ORG

Econseeds BV Hi Lights 2011 Elbaweg 15A 1607 MN HEM (Holland) Abbreviations P1 = First Year Flowering Perennial Tel (+31) 228 544066 Cutting/Border/Rock Etc

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Econseeds BV Hi Lights 2011 Elbaweg 15A 1607 MN HEM (Holland) Abbreviations P1 = First Year Flowering Perennial Tel (+31) 228 544066 Cutting/Border/Rock Etc EconSeeds BV Hi Lights 2011 Elbaweg 15A 1607 MN HEM (Holland) Abbreviations P1 = first year flowering perennial Tel (+31) 228 544066 cutting/border/rock etc. = predominant use of the plant Fax (+31) 228 542914 so-flo = time from sowing to flowering ds=directseeding E-mail [email protected] tp=pre-sow and plant out z= hardiness zone Achillea millefolium Cassis 0060.2650 perennial P1 cutting, border 6000 s/gr so-flo 22-24 weeks tp z3 Exceptional modern variety of Yarrow, producing many stems with warm cherry-red flower heads. Awarded a Fleuroselect Qualtiy Mark for fully first year flowering and a true perennial indeed. Thrives in all soils and climates. Excellent on the border and a good pot plant, too, 60 cm Achillea ptarmica The Pearl Superior 0060.5990 perennial P1 bedding, border, cutting 3300 s/gr so-flo 12 weeks tp z4 A much improved ptarmica with sprays of fully double white flowers on compact plants. Equally good as bedding plant annual (height 25 cm) or as a hardy perennial in the border. Height in the second season is 70 cm Agastache mexicana Liquorice blue 0146.2000 perennial P1 border, cutting 2400 s/gr so-flo 10-12 weeks tp z7 Flowering in only 10-12 weeks from seed but a true perennial, it produces long spikes of blue flowers in whorls. Attractive border plant, 70 cm Alyssum saxatile compactum sulphureum 0340.7800 perennial P1 border, rock, groundcover 1100 s/gr so-flo 18 weeks ds/tp z4/5 Popular spring-flowering rock garden plant in a new moonshine yellow colour. Easily cultivated and growing to only 20 cm. Fully perennial and wintergreen. Anagallis arvensis coerulea 0380.3300 annual border, bedding 1400 s/gr so-flo 14-16 weeks ds/tp Enchanting annual with flowers of an intense gentian blue colour, produced in great profusion. For edging, border, in pots and hanging baskets, 20 cm Anthemis arabica Criss Cross 0460.0300 (Cladanthus) annual border, bedding 4000 s/gr so-flo 10 weeks ds/tp When directseeded mid spring Anthemis arabica will show a 10 cm high flowering plant in 6 weeks time. Criss Cross from around the first flower 4 or 5 new stems will appear with new blooms out of which.. etc. slowly forming a mound of orange yellow flowers. Attractive in (patio) pots for late winter and spring display. Pleasantly scented if bruised or brushed against, 40 cm Asclepias incarnata Milkmaid 0720. 2000 perennial P1 border, cutting 235 s/gr so-flo 20-22 weeks ds/tp z3 Indispensable border plant with white umbels on a sturdy plant, flowering late summer and autumn. Sow late winter for first year flowering. Long lasting and thriving in moist to dry soils. The rose-pink flowered companion Soulmate is also available. Asperula orientalis Blue Surprise 0740.0460 annual border 900 s/gr so-flo 10 weeks ds/tp Easily grown and attractive annual with small delicately fragrant lavender-blue flowers. For moist shady spots in the garden, 25 cm Asphodeline lutea Yellow Candle 0760.4900 perennial border, landscaping 55 s/gr so-flo 2nd season z7/8 Handsome perennial with numerous stems and fragrant yellow flowers in long, dense spikes, 90 cm Briza media Doddering Dillies 1040.5100 perennial border, landscaping 1500 s/gr so-gro 12 weeks flo 22-24 weeks ds/tp z5 A most attractive perennial ornamental grass with delicate panicles of small heart-shaped spikelets. Very nice for edging and rockeries, 40 cm. Machine packaging of the seeds is possible. In case you wonder... Doddering Dillies is the common name. Calamintha nepeta 1160.4500 perennial P1 border, rock, herb 3300 s/gr so-flo 12 weeks ds/tp z5 Longflowering border plant and herb with small thyme-like lilac flowers and mint-scented leaves when brushed, 50 cm. Flowers the same year from seed. Needs a dry or well-drained spot in the garden where it will attract lots of bees. Cut back when necessary, and use as culinary herb with meat. Calandrinia umbellata Ruby Tuesday 1170.5000 Hhp/annual bedding, border 7000 s/gr so-flo 13-15 weeks ds/tp z7 Summer bedding plant for hot and sunny climates, with clusters of intense violet rose portulaca-like blooms. Good variety for both the professional and the home gardener, 15 cm Centaurea americana Aloha (Rose) and Aloha Blanca 1520.7150 and 7170 annual border, cutting 55 and 70 s/gr so-flo 16 weeks ds Robust and tall growing annuals with superb rose or white fluffy flowers of 15 cm across. Lovely in the border and as cut flower, both fresh and dried, 150 cm Chenopodium Strawberry Sticks 1700.1000 Chenopodium foliosum annual border 1250 s/gr so-flo 12 weeks ds The colourful strawberry-red fruits all along the stems make this plant most attractive in the border. The leaves are eaten raw or cooked as spinach. The fruits, although edible, are only nice to view, 40 cm Chrysanthemum cinerariifolium 1740.8200 perennial P1 border 600 s/gr so-flo 10-12 weeks ds/tp z6 Silvery-grey foliage with spicy fragrance, used, like Senecio/Dusty Miller, for contrast in the border. The flowers are daisy-like and white, 30-40 cm Cleome serrulata Solo 1830.1000 annual border 300 s/gr so-flo 12 weeks ds Easily grown plant with pink to white flowers with long crimson stamens on light green plants. The decorative seed pods are a bonus, 40 cm Coix lacryma-jobi 1930.4708 annual border 5 s/gr so-flo 14-16 weeks ds/tp Erect, leafy gras with sprays of drooping pearly-white seeds. Border plant of yesteryear, and the new trend now! Effective in flower arranging, too, 40-60 cm Commelina coelestis Sleeping Beauty 1985.0200 halfhardy perennial, grow as annual 250 s/gr so-flo 20 weeks tp z7 Produces vivid blue flowers in Tradescantia fashion from early summer till late fall. Commelina will grow practically anywhere, in full sun and in the shade, in dry and in wet soils. An easy to grow plant for the border and in pots with 4 or 5 together, 35-50 cm. Needs winter protection (or lift the tubers) or start from seed again in then next season. Cosmos bipinnnatus Pied Piper Red and Pied Piper Blush White 2090.6000 and 6010 annual border 175 s/gr so-flo 8-10 weeks ds Both colours are award-winning very lovely Cosmos varieties of the Sea Shell type, with fluted petals grouped around a yellow eye. The one in warm crimson red and the other in white with a hint of rose. For the home gardener who is in for something extravagant, 80 cm Crepis rubra 2140.6500 annual border 900 s/gr (semi-rubbed seeds) so-flo 12 weeks ds Easily grown border plant with showy pink flowers, 35 cm. Attractive in natural plantings, and best when directseeded. Available as semi-rubbed seeds, enabling machine filling and mixing. Dianthus deltoides F2 Canta Libre mix 2420.9300 perennial P1 bedding, border, parks 5700 s/gr so-flo 12 weeks ds/tp z4 Kieft/Econ’s new generation in Dianthus deltoides. High value hardy perennial mixture, abundantly flowering three months after sowing.Canta Libre is an outstanding series awarded a Fleuroselect Quality Mark. It is a charming mixture with pink, white and cherry-red flowers on bronze and green foliage. A mat forming true perennial, attractive in beds, borders and parks, 15 cm Dianthus knappii Yellow Harmony 2420.5355 perennial P1 border, landscaping 950 s/gr so-flo 22-25 weeks ds/tp z6 With its neatly untidy appearance it has more of a wild flower than most border pinks.The flowers are of a unique light yellow colour and blend in well with other plants. Easily grown and happily surviving many years in the garden, 50 cm Dorotheanthus bellidiformis Gelato annual bedding 3200 s/gr so-flo 11 weeks tp First series of separate colours Dorotheanthus, awarded by Fleuroselect and widely recognised. Strong, compact and richflowering plants smothered in blazing colours. Especially good in dry and sunny climates (with irrigation bans), 10 cm. Tip: when produced in packs: extreme dry culture results in abundant flowering. Cultural details are available. 2580.2308 bright red, FSQ 2580.2208 dark pink, FSN 2580.2508 orange, FSN 2580.2908 white, crispy white, warm red eye 2580.2408 yellow shades 2580.9058 formula mixture Eccremocarpus scaber Tresco mix 2650.9100 Hhp/annual climber 2600 s/gr so-flo 16 weeks ds/tp z9 Easily grown free-flowering climber with spikes of tubular flowers in trendy colours. When sown early, it will flower ihe same year in yellow, carmine and orange shades, 300 cm Eragrostis elegans 2720.2200 annual cutting, border 2500 s/gr so-flo 12-14 weeks ds/tp Ornamental grass with sprays of white spikelets. For fresh and dried cut, 50 cm. Machine packaging of the seeds is possible. Gaillardia pulchella dwarf Red Plume and Yellow Plume 3060.5000 and 7000 annual bedding border 600 s/gr so-flo 16-18 weeks ds/tp Dwarf and free-flowering annuals for packs and pots, profusely flowering with double red or buff yellow powderpuff blooms. Drought and heat tolerant, 25 cm Geum chiloense Mrs Bradshaw and Lady Stratheden 3190.1160 and 1150 perennial P1 border 650 and 350 s/gr so-flo 22-24 weeks tp Superior varieties for the border with wintergreen foliage and pleasing semi-double to double flowers. Generally very healthy. Available in scarlet (Mrs. Bradshaw) and clear yellow (Lady Stratheden), 60 cm Gomphrena globosa QIS® series 3290.9550 annual cutting, border 400 s/gr clean seeds so-flo 14 weeks tp Globular flowers in a mix: purple, dark rose, soft pink and white.
Load more

Recommended publications
  • 2006 Catalog
    Friends School of Minnesota Nonprofit Org. U.S. Postage 1365 Englewood Avenue PAID Saint Paul, MN 55104 Minneapolis, MN Permit No. 1767 TIME VALUE DATA If you have received a duplicate copy, please let us know, and pass the extra to a friend! North Star Originals 6 The Himalayan Saint Paul, Blue Poppy FROM 35W Minnesota FROM HWY 3 What’s “Native” LARPENTEUR AVENUE SNELLING AVE Mean When It Comes to Plants? Minnesota State Fair Friends School CLEVELAND AVE Plant Sale 280 COMMONWEALTH DAN PATCH MIDWAY PKWY P May 12, 13, 14, 2006 Friday,May 12 36 COMO AVENUE Cleveland 35W Snelling 11:00 A.M.–8:00 P.M. Larpenteur CANFIELD Saturday,May 13 State Fair Grandstand PLANT SALE 9:00 A.M.–8:00 P.M. Y 280 Como G PAR ER K N FROM 94 E Sunday,May 14 Friends School NOON P.M. The native Penstemon grandiflorus 12:00 –4:00 (Large-Flowered Beardtongue), 94 photographed in St. Paul’s At the State Fair Midway area during summer 2005. Grandstand 17th Annual Friends School Plant Sale May 12th, 13th and 14th, 2006 Friday 11:00 A.M.–8:00 P.M.• Saturday 9:00 A.M.–8:00 P.M. Sunday 12:00 NOON–4:00 P.M.Sunday is half-price day at the Minnesota State Fair Grandstand Friends School of Minnesota Thank you for supporting Friends School of Minnesota by purchasing plants at our sale. Friends School of Minnesota prepares children to embrace life, learning, and community with hope, skill, understanding, and creativity. We are committed to the Quaker values of peace, justice, simplicity and integrity.
    [Show full text]
  • Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: a Review
    Available online at www.ijpab.com Dhakar and Soni Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) ISSN: 2320 – 7051 DOI: http://dx.doi.org/10.18782/2320-7051.5192 ISSN: 2320 – 7051 Int. J. Pure App. Biosci. 6 (1): 442-451 (2018) Review Article Genetic and Molecular Basis of Petal Pigmentation in Floriculture Crops: A Review Sunita Dhakar1* and Anjali Soni2 1Division of Floriculture and Landscaping, ICAR- IARI, New Delhi 110012, India 2Division of Fruits and Horticultural Technology, ICAR-IARI, New Delhi 110012, India *Corresponding Author E-mail: [email protected] Received: 11.07.2017 | Revised: 19.08.2017 | Accepted: 26.08.2017 ABSTRACT Flower colours are of paramount importance in the ecology of plants and their ability to attract pollinators and seed dispersing organisms. The primary pigments occurring in plants are chlorophylls and carotenoids accumulated in plastids, anthocyanins and betalains, which are dissolved in vacuolar sap. Flavonoids and carotenoids are widely distributed in plant pigments. Among the factors influencing flower colour, anthocyanin biosynthesis has been the most extensively studied. Each plant species usually accumulates limited kinds of anthocyanins and exhibits limited flower colour. For example, roses and carnations lack violet/blue colour because they do not accumulate delphinidin-based anthocyanins and petunia and cymbidium lack brick red/orange colour due to the lack of pelargonidin-based anthocyanins. Different approaches are used for development of novel flower colour in floricultural crops like hybridization, mutation and genetic engineering. Advances in molecular biology and plant transformation technology have made possible the engineering of an anthocyanin biosynthetic pathway by the overexpression of heterologous flavonoid biosynthetic genes or the down-regulation of endogenous genes in transgenic plants.
    [Show full text]
  • SUPPLEMENTARY TABLES LIST of TABLES 1 List of Universal and Diagnostic Primer
    SUPPLEMENTARY TABLES LIST OF TABLES 1 List of universal and diagnostic primer . .1 3 Genbank sequence accessions (cytoplasmic) . .1 4 Genbank sequence accessions (nuclear) . .2 2 List of secondary specimens (lemongrass and carnation) . .5 5 Anatomical diagnostic key . .6 6 BLOG bamboo tribe classification results . .7 Table 1. List of universal and diagnostic (ARMS) primer used in the current study. The table includes primer names and sequences, melting temperatures (Tm) of each individual primer, the annealing temperatures (An) for each primer pair and references to corresponding publications. Name Sequence (5’...3’) Tm (◦C) An (◦C) Design rbcLa fu ATGTCACCACAAACAGAGACTAAAGC 62.2 58 Kondo et al. [1996] rbcLa revu GTAAAATCAAGTCCACCRCG 74.7 Fofana et al. [1997] rbcLb-Sfu AGACCTTTTTGAAGAAGGTTCTGT 62.2 55 Dong et al. [2014] rbcLb-Sru TCGGTCAGAGCAGGCATATGCCA 74.7 1R KIM ru ACCCAGTCCATCTGGAAATCTTGGTTC 72.1 52 Ki-Joong Kimp 3F KIM fu CGTACAGTACTTTTGTGTTTACGAG 60.6 ITS5u GGAAGTAAAAGTCGTAACAAGG 58.4 56 White et al. [1990] ITS4u TCCTCCGCTTATTGATATGC 61.5 Bbo-C-407-rd AGGBGGRCCTSGRAAAGTTTTCGA 58.7 current study Dian-T-223-rd CGGGCTCGATGTGGTAGTAA 64.9 Cym-A-254-rd AGCTACATAACAGATATATTGATCAGG 59.5 d diagnostic primer (ARMS), destabilizing nucleotide underlined u universal primer p unpublished Table 3. GenBank sequence accessions of two plastid DNA regions (rbcL and matK) used in the current study. Taxon rbcL matK Arundinarieae Arundinaria gigantea subsp. tecta AJ746179 EF125165 Borinda emeryi EF125079 EF125167 Chimonobambusa marmorea AJ746176 EF125168 Drepanostachyum falcatum AJ746265 EF125170 Fargesia dracocephala AJ746266 KP685610 Fargesia sp. Asmussen AM110249 AM114722 Indocalamus latifolius AJ746177 EF125173 Phyllostachys aurea HE573324 AF164390 Phyllostachys bambusoides AB088833 AB088805 Phyllostachys nigra HE573325 EU434241 Pleioblastus maculatus JN247242 JN247148 Pseudosasa amabilis AJ746273 KP093752 Pseudosasa japonica FN870405 HG794001 Thamnocalamus spathiflorus EF125087 KP685639 Bambubseae Bambusa multiplex M91626 EF125166 1/7 Table 3.
    [Show full text]
  • University of Montenegro Faculty of Sciences and Mathematics
    UNIVERSITY OF MONTENEGRO FACULTY OF SCIENCES AND MATHEMATICS PROTECTED AREA GAP ASSESSMENT WITH COMPREHENSIVE PLAN FOR A REPRESENTATIVE PAS (PROTECTED AREA SYSTEM) November, 2012th 1 PROJETC TEAM: DR DANILO MRDAK – Project leader, expert for fish, for conservation issues and for sustainable development DR DANKA CAKOVIĆ – Expert for botany and conservation issues MR SNEŽANA VUKSANOVIĆ – Expert for botany DR MARKO KARAMAN – Expert for invertebrate fauna DR RUŽA ĆIROVIĆ – Expert for herpetofauna MR NELA VEŠOVIĆ – DUBAK – Expert for bird fauna DR VESNA MAČIĆ – Expert on marine flora and fauna MR MARINA ĐUROVIĆ - Expert on mammal fauna DR SNEŽANA DRAGIĆEVIĆ – Expert on moss DR GORDANA KASOM – Expert on fungi DR DRAGANA MILOŠEVIĆ – Expert for conservation issues MR ANA KATNIĆ – Expert for sustainable development DR SEONA ANDERSON – International expert for conservation issues DR PREDRAG STANIŠIĆ - Expert for data basis MR MARJAN ERCEG – Expert for GIS 2 3 1. IDENTIFICATION, ASSESSING AND MAPPING OF HABITATS AND SPECIES DISTRIBUTION 1.1. Identification and assessing Experts for botany reviewed list of habitats related to Montenegro (lend and marine). They paid attention on habitats that were specified as important for Emerald network designation as well as to ones that were of interest for Yearly Monitoring of Biodiversity status 2011th. The Botany team identifies habitats that are either endangered or threatened as well as the ones that are rare or specific for Balkan nature. They produce check list of habitats that serve as a referent check
    [Show full text]
  • Alpine Garden Club of British Columbia Seed Exchange 2015
    Alpine GArden Club of british ColumbiA seed exChAnGe 2015 We are very grateful to all those members who have made our Seed Exchange possible through donating seeds, and to those living locally who volunteer so much time and effort to packaging and filling orders. We especially appreciate those donors who made an extra effort in this difficult summer. We have fewer donors but still a good list and that is thanks to them. Read the following instructions carefully before filling out the seed request form. PLEASE KEEP YOUR SEED LIST, packets will be marked by number only. Please send the Seed Exchange Request Form (last page of booklet) by mail as soon as possible, but no later than DECEMBER 10. You can request your seeds on-line (see back page) and the complete seed list is available on the website for reference. This year you will find a special list of plants at the end of the ‘Native to North America’ section, of plants wild collected on Pink Mountain in northern BC. Please see the accompanying note in the November Bulletin. The Club would appreciate it if anyone who raises plants from these seeds and obtains seed from them would let us know. Those seeds may be useful in the future for revegetation projects. Allocation: Donors may receive up to 60 packets and non-donors 30 packets, limit of one packet of each selection. Donors receive preference for seeds in short supply. (USDA will permit no more than 50 packets for those living in the USA.) List first choices by number only, in strict numerical order, from left to right on the order form.
    [Show full text]
  • 2018 Catalog Compressed.Pdf
    2018 Plant Catalogue Hemerocallis ‘Bold Tiger’ Bold Tiger Daylily As bold as its name, bright orange petals with Zone 4-9 Height Spacing a large red eye and yellow-green throat. 28” 18-24” Bloom Color Petals are dramatically recurved with a nicely Zone Culture ruffled edge. Well-branched with heavily Orange w/ Red Eye Sun to Part Shade budded scapes. Tetraploid. Dormant winter foliage. Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Brookwood Black Kitten’ Brookwood Black Kitten Daylily Thus unusual color will wow you and your Zone 3-9 Height Spacing guests with its Black Red flower with 22” 18-24” Bloom Color contrasting midrib stripe. Zone Culture Diploid. Dormant winter foliage. Black Red Sun to Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Celebrity Elite’ Celebrity Elite Daylily A cherry-red flower with yellow throats over Zone 3-9 Height Spacing grass-like leaf blades. Blooms in mid July. 25” 18-24” Bloom Color Dormant foliage in winter. Diploid. Zone Culture Red Self Sun to Part Shade Moist, Well Drained Bloom Season Attracts Mid Summer Butterflies, Hummers Hemerocallis ‘Chicago Apache’ Chicago Apache Daylily Intense scarlet red blooms with a golden Zone 4-9 Height Spacing throat are 5” across. Petals have a loosely 28” 18-24” Bloom Color ruffled edge. Very sun-fast. Zone Culture Dormant foliage, Tetraploid. Red Self Sun or Part Shade Rabbit resistant. Moist, Well Drained Bloom Season Attracts Mid-Late Summer Butterflies, Hummers Hemerocallis ‘Daring Deception’ Daring Deception Daylily Features dusky cream-pink trumpet-shaped Zone 3-9 Height Spacing flowers with a burgundy-purple throat and 24” 18-24” Bloom Color pie-crust edging.
    [Show full text]
  • Serbia and Montenegro Biodiversity Analysis, 2002
    FAA SECTION 119 BIODIVERSITY ANALYSIS FOR SERBIA AND MONTENEGRO Prepared for: United States Agency for International Development Mission to the Federal Republics of Yugoslavia Submitted By: Loren L. Schulze and The Environmental Information Systems and Networking Project (Contract No. EE-C-00-98-00001-00) DevTech Systems, Inc. May 2002 Final Report Note This document was prepared under the auspices of United States Agency for International Development (USAID) by a Biodiversity Analysis Team. The team was comprised of Dr. Loren L. Schulze, team leader and consultants from the Environmental Information Systems and Networking Project managed by DevTech Systems, Inc. Dr. Bruce A Byers consultant ecologist was responsible for the ecological analysis and Violeta Orlovic was responsible for the institutional analysis. The statements and opinions expressed herein are not necessarily those of either USAID or DevTech Systems, Inc. Table of Contents Table of Contents ............................................................................................................................... 1 List of Appendices ............................................................................................................................. 3 Executive Summary ........................................................................................................................... 4 Introduction ........................................................................................................................................ 5 Section One: Conservation
    [Show full text]
  • SUPPLEMENTARY TABLES LIST of TABLES 1 List of Primers
    SUPPLEMENTARY TABLES LIST OF TABLES 1 List of Primers . .1 2 List of Reference Plant Accessions (lemongrass and carnation) . .1 3 Genbank sequence Accessions (cytoplasmic) . .2 4 Genbank sequence Accessions (nuclear) . .3 5 Anatomical diagnostic key . .5 Table 1. List of universal and diagnostic (ARMS) primer used in the current study. Name Sequence (5’...3’) Tm (◦C) Design rbcLa fu ATGTCACCACAAACAGAGACTAAAGC 62.2 ? rbcLa revu GTAAAATCAAGTCCACCRCG 74.7 ? rbcLb-Sfu AGACCTTTTTGAAGAAGGTTCTGT 62.2 ? rbcLb-Sru TCGGTCAGAGCAGGCATATGCCA 74.7 ? 1R KIM ru ACCCAGTCCATCTGGAAATCTTGGTTC 72.1 Ki-Joong Kimp 3F KIM fu CGTACAGTACTTTTGTGTTTACGAG 60.6 Ki-Joong Kimp ITS5u GGAAGTAAAAGTCGTAACAAGG 58.4 ? ITS4u TCCTCCGCTTATTGATATGC 61.5 ? Bbo-C-407-rd AGGBGGRCCTSGRAAAGTTTTCGA 58.7 current study Dian-T-223-rd CGGGCTCGATGTGGTAGTAA 64.9 current study Cym-A-254-rd AGCTACATAACAGATATATTGATCAGG 59.5 current study d diagnostic primer (ARMS), destabilizing nucleotide underlined u universal primer p unpublished Table 2. Reference plant accessions (Acc) of lemongrass (Cymbopogon, Panicoideae) (L1 - L2) and carnation (Dianthus, Caryophyllaceae) (D1 - D10) their taxon names and Genbank sequence accessions of three plastid DNA regions (rbcLa, rbcLb and matK-KIM) and for carnation accessions also for one nuclear DNA region (ITS). Acc Taxon rbcLa rbcLb matK-KIM ITS Panicoideae L1 Cymbopogon citratus KU722908 KU748525 KU722906 - L2 Cymbopogon citratus KU722907 KU748524 KU722905 - Caryophyllaceae D1 Dianthus caryophyllus KU722895 KU722853 KU722867 KU722881 D2 Dianthus chinensis KU722896 KU722854 KU722868 KU722882 D3 Dianthus deltoides KU722898 KU722856 KU722870 KU722884 D4 Dianthus deltoides KU722897 KU722855 KU722869 KU722883 D5 Dianthus gratianopolitanus KU722899 KU722857 KU722871 KU722885 D6 Dianthus imereticus KU722900 KU722858 KU722872 KU722886 D7 Dianthus longicalyx KU722901 KU722859 KU722873 KU722887 D8 Dianthus superbus KU722902 KU722860 KU722874 KU722888 D9 Dianthus superbus KU722903 KU722861 KU722875 KU722889 D10 Dianthus turkestanicus KU722904 KU722862 KU722876 KU722890 1/5 Table 3.
    [Show full text]
  • Cultiu in Vitro
    INTRODUCCIÓ EXPERIMENTAL A LA BIOTECNOLOGIA AMB CLAVELLINA: CULTIU IN VITRO AGRAÏMENTS Vull donar les gràcies al meu tutor del Treball de Recerca, Jordi Sanfeliu, per la seva disposició a ajudar-me i col·laborar, sobretot en la part pràctica. També als meus amics, Cristian, Carla , Adrià i Arantxa per estar sempre al meu costat ajudant-me i animant-me. Moltes gràcies. 2on de Batxillerat TdR. Cultiu in vitro amb clavellina ÍNDEX AGRAÏMENTS................................................................................................................ 2 ARTICLE ......................................................................................................................... 4 INTRODUCCIÓ............................................................................................................. 15 La clavellina ................................................................................................................... 16 Taxonomia.............................................................................................................. 16 Origen geogràfic..................................................................................................... 17 Descripció............................................................................................................... 18 Multiplicació........................................................................................................... 19 Usos .......................................................................................................................
    [Show full text]
  • North American Rock Garden Society |
    Bulletin of the American Rock Garden Society VOL. 43 FALL 85 NO. 4 THE BULLETIN CONTENTS VOL. 43 NO. 4 FALL 1985 And Then, There Are the Dianthus — Richard L. Critz 167 Donald E. Havens — Olive Thomson 180 Award Winners — 1985: Award of Merit, Donald E. Havens, Norman Singer; LePiniec Award, William J. Hamilton; Carleton R. Worth Prize, Mark McDonough 181 Native Plants of Vermont — Arthur Gilman 189 European Notebook: A 50th Anniversary, Floraire, and H. Correvon — Margaret and Paul Halladin 195 Hazel Feakins Smith 200 Portable Frames — Frederick K. Watson, Jr. 201 Six Idaho Batholith Endemics — Roy Davidson 205 Garden Ecology — Paul Palomino 208 A Field Trip to Mt. Dobson — Brenda Snadon 209 Book Review: The Cultivated Hemlocks by Dr. John C. Swartley 210 Omnium-Gatherum 212 CALENDAR OF COMING EVENTS — 1986 Jan. 24-26 Eastern Winter Study Weekend Hotel duPont Wilmington, DE Feb. 28- Western Winter Study Weekend Empress Hotel March 2 Victoria, B.C. June 28- Second Interim International Alpine Boulder and July 2 Conference (and Annual Meeting) Denver Cover Picture: Dodecatheon sp., Ice Lake, Wallowa Mountains Phil Pearson, photographer Published quarterly by the AMERICAN ROCK GARDEN SOCIETY, a tax-exempt, non-profit organization incor• porated under the laws of the state of New Jersey. You are invited to join. Annual dues (Bulletin included), to be sub• mitted in U.S. funds or International Money Order, are: General Membership, $15.00 (includes domestic or foreign, single or joint — two at same address to receive one Bulletin, one Seed List); Patron, $50.00; Life Member (individual only), over 55, $300; under 55, $350.
    [Show full text]
  • 2020–2021 Seed Exchange Catalog
    MID-ATLANTIC GROUP 2020–2021 Seed Exchange Catalog The 27th annual edition of the Seed Exchange Our Seed Donors Catalog includes 916 seed donations con- Catalog listed seed was generously contributed by our members. tributed by 51 gardeners, from beginners to Where the initial source name is followed by “/”and other member names, the latter identifies those who actually selected, collected, professionals. Approximately 90 new plants cleaned, and then provided descriptions to the members who pre- were donated for the first time. As you can pared the catalog. If a donor reported their zone, you will find it in see, this seed program includes new plants parenthesis. Our sincere thanks to our donors—they make this Seed not previously offered as well as old favorites. Exchange possible. We realize how important this Seed Exchange Bartlett, John 45 (6b) Mahony, Peter 590 (7a) is to HPS and to our members and that is why Bartram’s Garden/ Malarek, David 2608 Katie Jacoby 9975 Malocsay, Jan-Paul 592 (6) we decided to continue the tradition during Berger, Clara 65 McGowan, Brian 3666 (5) the pandemic. Bittmann, Frank 2937 (6a) McShane, Nadeen 627 Bowditch, Margaret 84 (6b) Mills, Michael 2504 We’re sure you’ll enjoy perusing this year’s Boylan, Rebecca 2137 (6b) Nachlas, Sally 2621 (6) selections and you will find plants your gar- Cresson, Charles 199 (7) Norfolk Botanical Staff/ den can’t do without! Since some listed seed Creveling, Beth 200 (7) Julie Finn 1999 (8a) Cyphers, Barry 1181 Perron, William 3321 (6) is in short supply, you are encouraged to Doblmaier, Susan 2515 (6b) Plant Delights 32 place your order early.
    [Show full text]
  • French (2.287Mb)
    EP Programme des Nations Unies pour l’Environnement UNEP(DEPI)/MED WG.308/3 2 Mai 2007 I ORIGINAL: FRANÇAIS PLAN D’ACTION POUR LA MEDITERRANEE Huitième réunion des Points Focaux Nationaux pour les ASP Palerme, Italie, 6-9 juin 2007 Synthèse des Rapports Nationaux sur la Mise en Œuvre du Protocole Relatif aux Aires Spécialement Protégées et à la Diversité Biologique en Méditerranée, pour la Période Mars 2005 – Mars 2007 PNUE CAR/ASP - Tunis, 2007 Note : Les appellations employées dans ce document et la présentation des données qui y figurent n’impliquent de la part du CAR/ASP et du PNUE aucune prise de position quant au statut juridique des pays, territoires, villes ou zones, ou de leur autorité, ni quant au tracé de leur frontière ou limites. © 2007 Programme des Nations Unies pour l'Environnement Plan d'action pour la Méditerranée Centre d’Activités Régionales pour les Aires Spécialement Protégées (CAR/ASP) B.P. 337 - 1080 Tunis CEDEX E-mail : [email protected] La synthèse des rapports nationaux a été préparé pour le Centre d’Activité Régional pour les Aires Spécialement Protégées (CAR/ASP) par : C. LE RAVALLEC 13 bd Perrin 13013 Marseille (France) Avec le concours de C. RAIS OKIANOS 1, Boulevard de l'Environnement 8110 Tabarka (Tunisia) SOMMAIRE I. INTRODUCTION ..................................................................................................................................................1 II. INFORMATIONS GENERALES.........................................................................................................................1
    [Show full text]