Developmental Biology 353 (2011) 275–289

Contents lists available at ScienceDirect

Developmental Biology

journal homepage: www.elsevier.com/developmentalbiology

The zebrafish maternal-effect gene mission impossible encodes the DEAH-box helicase Dhx16 and is essential for the expression of downstream endodermal genes

Emily Putiri, Francisco Pelegri ⁎

Laboratory of Genetics, University of Wisconsin, Madison, 425-G Henry Mall, Madison, WI 53706, USA article info abstract

Article history: Early animal embryonic development requires maternal products that drive developmental processes prior to Received for publication 24 May 2010 the activation of the zygotic genome at the mid-blastula transition. During and after this transition, maternal Revised 26 January 2011 products may continue to act within incipient zygotic developmental programs. Mechanisms that control Accepted 1 March 2011 maternally-inherited products to spatially and temporally restrict developmental responses remain poorly Available online 9 March 2011 understood, but necessarily depend on posttranscriptional regulation. We report the functional analysis and molecular identification of the zebrafish maternal-effect gene mission impossible (mis). Our studies suggest Keywords: Zebrafish gastrulation requirements for maternally-derived mis function in events that occur during gastrulation, including cell Maternal-effect gene movement and the activation of some endodermal target genes. Cell transplantation experiments show that the Mission impossible/dhx16 cell movement defect is cell autonomous. Within the endoderm induction pathway, mis is not required for the DEAH-box helicase activation of early zygotic genes, but is essential to implement nodal activity downstream of casanova/sox 32 Endoderm induction but upstream of sox17 expression. Activation of nodal signaling in blastoderm explants shows that the Nodal signaling requirement for mis function in endoderm gene induction is independent of the underlying yolk cell. Positional cloning of mis, including genetic rescue and complementation analysis, shows that it encodes the DEAH-box RNA helicase Dhx16, shown in other systems to act in RNA regulatory processes such as splicing and translational control. Analysis of a previously identified insertional dhx16 mutation shows that the zygotic component of this gene is also essential for embryonic viability. Our studies provide a striking example of the interweaving of maternal and zygotic genetic functions during the egg-to-embryo transition. Maternal RNA helicases have long been known to be involved in the development of the animal germ line, but our findings add to growing evidence that these factors may also control specific gene expression programs in somatic tissues. © 2011 Elsevier Inc. All rights reserved.

Introduction spatial control is particularly relevant for those genes whose products may be inherited maternally but whose actions do not occur until Prior to the activation of the zygotic genome at the midblastula later stages of development, for example, those acting during or after transition, early animal development depends solely on maternal the midblastula transition. factors expressed during oogenesis and stored in the egg (Newport While posttranscriptional mechanisms are used as a general and Kirschner, 1982a, 1982b). Such factors are essential to drive early means of gene regulation, there are an increasing number of examples cellular and developmental programs before transcription from in which dedicated posttranscriptional events convey developmental zygotic genes ensues. Even after zygotic gene activation, some specificity. For example, although upon fertilization the bulk of perduring maternal factors continue to be required for developmental Xenopus transcripts are activated for translation by becoming processes (Putiri and Pelegri, 2008). polyadenylated, a subset of transcripts are activated by poly(A)- Maternal factors can be stored in the egg as proteins, mRNAs, or independent mechanisms (Vardy and Orr-Weaver, 2007). In a second other biomolecules. A crucial issue for the developing embryo is how example, subcellular localization of maternally-derived germ plasm to properly regulate the temporal and/or spatial activity of such mRNAs and their specific stabilization are instrumental in the factors after they are produced during oogenesis, both throughout the activation of the germ cell program (Kloc and Etkin, 2005; Cinalli remainder of oogenesis and in early embryogenesis. In the case of et al., 2008; Lipshitz and Smibert, 2000; Rajyaguru and Parker, 2009). maternally inherited mRNAs, such regulation involves posttranscrip- A third case of selectivity in developmental targets occurs towards the tional control. The importance of posttranscriptional temporal and end of the period of maternal control during embryogenesis, at the midblastula transition, when maternally-derived factors are involved in the degradation of many maternally-derived mRNAs (Giraldez ⁎ Corresponding author at: 425-G Henry Mall, Rm. 2424, Madison, WI 53706, USA. Fax: +1 608 262 2976. et al., 2006; Ferg et al., 2007). In spite of these and other known E-mail address: [email protected] (F. Pelegri). examples, the role of posttranscriptional regulation during early

0012-1606/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2011.03.001 276 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 vertebrate development remains poorly understood. In particular, an Materials and methods important unanswered question is to what extent specific posttran- scriptional networks are involved in cell fate determination and Fish maintenance morphogenetic events within somatic tissues and the establishment of the basic embryonic body plan. Stocks of wild-type AB and mis/dhx16 lines were maintained under A primary event in the definition of the animal embryo is standard conditions at 28.5° (Brand et al., 2002). Fish homozygous gastrulation, the process that generates the three embryonic germ for the mist792 allele were identified by genotyping the flanking SSLP layers, the ectoderm, mesoderm and endoderm. In teleost fish, this markers z9189 using primers TCCAGGTTTGCGTGTGATAG and CCAG- process is additionally coordinated with epiboly, where the cells of TGTGAAACCCGAGAAT and z9746 using primers CCTTTCTGTTCATG- the blastula migrate towards the vegetal pole of the embryo until CCCTTC and ATGTGGGAATGGAAGTGAGC. Maternally mutant embryos the yolk is completely engulfed by cellular layers (Kimmel et al., were obtained by crossing homozygous mis females to AB males. 1990, 1995). Fate map studies have shown that the internal two Heterozygous carriers for the dhx16hi4049 allele were identified through layers originate from a population of bipotential cells, the incrosses that led to the necrosis phenotype in one quarter of the mesendoderm, initially present at the embryonic margin, as it embryos. All embryos were collected and developed in E3 embryonic moves towards the vegetal pole during epiboly (Kimmel et al., medium (Pelegri and Schulte-Merker, 1999) and were staged accord- 1990; Warga and Nüsslein-Volhard, 1999; Montero et al., 2005; ing to the age and morphological standards described in Kimmel et al., Keller et al., 2008). During gastrulation, marginal cells are 1995. internalized, become committed to unipotential cell fates, and acquire characteristic morphologies and positions: endodermal Isolation and genotyping of genomic DNA precursor cells flatten and adhere tightly to the yolk cell, while mesodermal precursors maintain a mesenchymal morphology Fish were anesthetized with MESAB (0.014%) and the tail fin was within an intermediately located layer (Warga and Nüsslein- clipped by razor blade and placed into DNA lysis buffer (10 mM Tris, Volhard, 1999). pH 8.0; 10 mM EDTA, pH 8.0; 200 mM NaCl; 1% Triton X-100; 0.05 μg Induction of the mesendoderm has been shown to be dependent proteinase K). Tissue lysates were incubated overnight at 55 °C, and on the activity of the nodal signaling pathway. Genetic analysis has prior to PCR, lysates were incubated at 95 °C for 10 min to inactivate shown that two zygotic genes of the nodal family of TGFß ligands, proteinase K. For bulk segregation analysis, the DNA concentration of squint and cyclops, become activated at the embryonic margin each lysate was measured and dilutions were made for a 4 ng/μl stock. during embryogenesis and are redundantly required for the For general genotyping, lysates were used directly without dilution, activation of the mesendoderm (Feldman et al., 1998; Gritsman and 1 μl of lysate was used per 20 μl PCR reaction. For each 10 μl PCR, et al., 1999). These nodal factors signal through the Activin type I 1 μl of Hot Start Buffer, 0.2 μl of dNTPs, 0.05 μl of Hot Start Taq receptor, Taram-A (Renucci et al., 1996; Peyriéras et al., 1998; polymerase (Eppendorf), and 10 ng genomic DNA, and 5 μlof5μM Alexander and Stainier, 1999; Aoki et al., 2002b)andtheEGF-CFC primer were used. PCR products were analyzed on a 2% high- co-receptor One-eye pinhead (Oep) (Zhang et al., 1998; Gritsman resolution agarose gel. et al., 1999; Yeo and Whitman, 2001;reviewedinSchier and Talbot, 2005). Activation of nodal signaling results in the phosphorylation Cloning of mission impossible and nuclear translocation of the transcription factor Smad2 in complex with Smad4 (Nomura and Li, 1998; Weinstein et al., 1998; The clone containing dhx16 cDNA, accession # BC045393, was Jia et al., 2008). Within the nucleus, the Smad complex associates obtained through OpenBiosystems.com. The gene contained within with the winged-helix transcription factor FoxH1/Fast1 to activate the vector pME18S-FL3 was excised by EcoRI and XbaI and ligated into downstream targets (Watanabe and Whitman, 1999; Pogoda et al., the same sites within the vector pCS2+. For in vitro transcription of 2000; Sirotkin et al., 2000; Kunwar et al., 2003). In endodermal mRNA, the pCS2+ clone was digested with NotI and transcribed with precursors, this complex is known to additionally require associ- SP6 mMessage mMachine kit (Ambion). Additionally, the clone was ation with the mix-type homeodomain transcription factors Bonnie excised by EcoRI and XbaI and ligated into the same sites within and Clyde (Bon)/Mixer (Alexander and Stainier, 1999; Kikuchi pBluescriptSK+. pBS + dhx16 was used to make antisense digox- et al., 2000, 2001; Kunwar et al., 2003) and Mezzo (Poulain and igenin probe by linearizing with EcoRI and transcribing with T3 RNA Lepage, 2002), and the transcription factor Gata5 (Faust; Reiter polymerase. PCR-based site-directed mutagenesis was used to et al., 1999; Rodaway et al., 1999; Weber et al., 2000; Reiter et al., introduce the mutation corresponding to the maternal-effect mis 2001). These interactions eventually lead to the activation of target allele (isoleucine to asparagine at amino acid 430) in pBS + dhx16, to genes such as no tail (ntl, homologue of mammalian brachyury; generate the mutated construct pBS + dhx16I-NN. The resulting (Schulte-Merker et al., 1994a, 1994b)andspadetail (spt; Griffin construct was verified by fully sequencing the mutated dhx16 cDNA. et al., 1998) in mesodermal precursors, and the HMG-box contain- ing transcription factors casanova (cas)/sox32 (Dickmeis et al., In situ hybridization and immunofluorescence 2001; Kikuchi et al., 2001), foxA2 (Strähle et al., 1993; Odenthal and Nüsslein-Volhard, 1998), and sox17 (Alexander and Stainier, 1999) In situ hybridizations were carried out as described previously in the endodermal lineage. (Pelegri and Maischein, 1998). FISH for casanova was performed using Here, we report the primary characterization and molecular Fast Red Tablets (Roche) as previously described (Hauptmann and identification of the zebrafish maternal-effect gene mission impossible. Gerster, 1994; Hauptmann, 1999). Probes for in situ included bonnie We provide evidence that suggests a role for maternal mission and clyde (Kikuchi et al., 2000), bozozok/nieuwkoid (Koos and Ho, impossible function in the ability to respond to nodal activation during 1998), chordin (Schulte-Merker et al., 1997), casanova/sox32 (Kikuchi gastrulation. Molecular cloning of mission impossible indicates that it et al., 2001), cyclops (Rebagliati et al., 1998b), even skipped (Joly et al., encodes Dhx16, a DEAH box-containing factor of the RNA helicase 1993), foxA2/axial (Odenthal and Nüsslein-Volhard, 1998), foxb1.2 family whose homologues in other organisms have roles in posttran- (Odenthal and Nüsslein-Volhard, 1998), goosecoid (Schulte-Merker scriptional gene regulation. Our analysis suggests that mission et al., 1994a), lefty1 and lefty2 (Bisgrove et al., 1999), no tail (Schulte- impossible/dhx16 is involved in the control of a subset of genes Merker et al., 1994a), snail1a (Hammerschmidt and Nüsslein-Volhard, involved in somatic development, including the activation of several 1993), sox17 (Alexander and Stainier, 1999), squint (Rebagliati et al., endoderm-specific downstream genes. 1998a), and lhx1a (Toyama et al., 1995). For the detection of tubulin, E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 277 dechorionated embryos were fixed and labeled as previously Males homozygous for the mis mutation are viable and fertile. described (Theusch et al., 2006) with the primary antibody for anti- Embryos from homozygous mis mutant females (which we refer to α-tubulin (Sigma, monoclonal B5-1-2, 1:2000). The primary antibody as maternally mutant mis embryos, or simply mis mutant embryos) was recognized with Alexa488-conjugated secondary antibody develop obvious morphogenetic defects and rupture when stage- (Molecular Probes, Jackson Immuno Research Laboratories). F-actin matched wild-type controls have reached approximately 90% epiboly labeling was carried out as described previously (Theusch et al., 2006) (Pelegri et al., 2004). Throughout the cleavage and blastula stages, mis using Alexa488-conjugated phalloidin (Molecular Probes). Subse- mutant embryos are indistinguishable from wild-type embryos: DNA quently, embryos were labeled for DNA by DAPI (0.5 μg/ml in PBS) for segregation and cellularization appear normal (Pelegri et al., 2004). 10 min at room temperature. In situ hybridization and immunoflu- During the initiation of epiboly, embryos show no signs of cell death orescence analysis was carried out using at least 2 independent prior to lysis, including a lack of labeling with dyes that label apoptotic mutant clutches, each consisting of 10 to 50 embryos. cells (Fig. 1 and data not shown), and nuclear and cell division appear normal (Supp. Fig. 1). Most obviously, mis mutants suffer a reduction Imaging in early epiboly movements (Figs. 1B,D, compared to age matched

Imaging of fixed or live fluorescently labeled embryos was per- formed using a Zeiss Axioplan2 fluorescence microscope and Open Lab imaging software. Imaging of casanova FISH and of phalloidin stained embryos was performed by confocal microscopy using a Zeiss Lsm510 microscope and images were processed using Image J software. Images of embryos labeled by in situ hybridization were acquired with a Leica-FLIII microscope and a color camera (Diagnostic Instruments Spot Insight).

Quantitative PCR analysis

For each sample, total RNA was isolated from 50 embryos and reverse transcribed using AMV Reverse Transcriptase. The resulting cDNA was analyzed using a BioRad MyIQ Real-Time PCR Detection System. Forward and reverse primers for the analysis were as follows: ß- actin1: AGAAGATCTGGCATCACACC and CCAGAGTCCATCACAATACC; ntl: GGTTCTTCGATGTCCTACTC and GATTTCCTCCTGAAGCCAAG; sox32: TCGACGAAAGTGCAACAAGC and CCACTTGATGATGTTGCCTC; sox17: TGCAGCAGGTATTTCACGAG and GTGGCTGCTAACACAATGTG. Q-PCR data was analyzed as described in Livak and Schmittgen (2001).

RNA injections and embryo manipulations

RNA for injection was in vitro synthesized using mMessage mMachine kits (Ambion) as described previously (Pelegri and Maischein, 1998). RNA was diluted using DEPC-treated water to a concentration of 200 ng/μl. Embryos were injected with approxi- mately 1 nL of mRNA solution before the 2-cell stage unless otherwise noted. Yolk excisions were performed as described previously (Ober and Schulte-Merker, 1999). dhx16 morpholino analysis

A morpholino oligonucleotide (MO) was designed against the translational start site of dhx16 (5′-GGCCATTGTGAGTTTAGTTGTCTCT- 3′; GeneTools). 0.25–1.0 ng dhx16 MO or standard control MO (5′- CCTCTTACCTCAGTTACAATTTATA-3′; GeneTools) were injected into 1-cell embryos.

Results Fig. 1. Gastrulation defects in maternally mutant mis embryos. Wild-type embryos (A,C) and mis mutant embryos (B,D). mis embryos exhibit reduced epiboly of the blastoderm, as evidenced by the increased thickness of the blastoderm at the animal The maternal effect mutation mission impossible affects cellular movements pole (white solid lines) and reduced coverage of the yolk (white dotted line indicates during gastrulation blastoderm margin). The extent of involution of the hypoblast is also reduced (black brackets). Lateral views (animal top, dorsal right). (E–I) Defects in epiboly and The mission impossible (mis) mutation was derived from a convergence. (E) Labeling strategy, by uncaging a small group of cells at the lateral margin in wild-type (F) and mutant (G) embryos (SV: side view; DV: dorsal view). At a parthenogenesis-based screen for maternal-effect mutations induced time corresponding to 90% epiboly in the wild-type, the extension of labeled cells along by N-ethyl-N-nitroso-urea (ENU) (Pelegri and Schulte-Merker, 1999; the animal–vegetal axis (double-headed arrows) is reduced in the mutant (I) compared Pelegri, 2004), a mutagen that induces point mutations (Pelegri, to wild-type (H). In addition, the width of the band of labeled cells (brackets), 2002). Neither zygotically heterozygous nor zygotically homozygous indicative of cell intercalation during convergence, is reduced in mutant embryos. (F,G) are side views, dorsal to the right. (H,I) are centered on the labeled cells, mutant fish appear affected by the mutation (Pelegri et al., 2004; see corresponding to the dorsal view (DV) in (E). Uncaging was carried out at 5:30 h.p.f. below). However, homozygous mis mutant females generate clutches and time after fertilization is indicated in h:min. Embryos shown in (F–I) are with 100% affected embryos regardless of the genotype of the male. representative of 5 wild-type and 5 mutant embryos. 278 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 controls in A,C; dotted white line indicates blastoderm margin). In marker foxb1.2 (Odenthal and Nüsslein-Volhard, 1998), and the addition, the blastoderm fails to thin in mutants, as evidenced by its ventral-specific gene even skipped (eve; Joly et al., 1993)(Supp. Fig. 4). increased thickness at the animal pole compared to wild-type (solid Overall, expression of these marker genes is properly restricted to white lines, Figs. 1B,D, compared to A,C). dorsal and ventral regions in mis mutant embryos indicating correct In addition to epiboly defects, both involution of the hypoblast cell dorsal–ventral patterning in these embryos. layer and convergence of cells to the dorsal axis appear to be reduced Next we looked at germ layer-specific genes to determine whether in mis mutants. The hypoblast layer forms from internalization and the maternal effect of mis affects germ layer determination during animalward migration of marginal blastomeres beginning at about gastrulation. In situ hybridization of neuroectodermal markers chd 50% epiboly (5.5 h.p.f., reviewed in Solnica-Krezel, 2006). The dorsal and foxb1.2 shows normal levels of transcript expression in mis hypoblast in the wild-type embryo extends from the vegetal margin embryos compared to wild-type up to a time equivalent to 80% toward the animal pole (bracket in Fig. 1C). This animalward epiboly in wild-type, when the embryos begin to undergo lysis due to extension is clearly reduced in live mis mutant embryos (bracket in their abnormal morphogenesis (Figs. 3B,D, compare to A,C), although Fig. 1D). To better visualize this defect, we labeled cells by uncaging a the characteristic anterior “wings” of expression for these genes fluorophore at the blastoderm margin at the initiation of gastrulation (arrows in Figs. 3A,C) appear absent or reduced in mis mutants. These (50% epiboly, 5 h.p.f.), and observed their spatial distribution at late- data also show that, in mis mutant embryos, transcription of at least gastrulation (9 h.p.f.) (Fig. 1E). Embryos were injected at the 1-cell some genes is active until a time at or close to embryonic lysis. stage with the caged fluorophore, which was uncaged in cells at the We also tested for expression of genes in cells fated for mesoderm margin of wild-type and mis embryos (Figs. 1F,G). Marginal cells in and endoderm, which are initially intermingled at the blastoderm wild-type embryos extend along the animal to vegetal axis (Fig. 1H, margin. ntl, snail1a (Hammerschmidt and Nüsslein-Volhard, 1993; double-headed arrow) whereas extension in mis embryos is greatly Thisse et al., 1993), and lhx1a (Toyama et al., 1995), all genes reduced (Fig. 1I). The domain of labeled cells at later stages is also expressed in this mesendodermal layer, show strong expression typically broader in mutant embryos (bracket in Fig. 1I, compare to around the circumference of the embryo at the margin of both wild- H), suggesting defects in the convergence of cells towards the dorsal type and mis embryos (Figs. 3F,H,J, compare to E,G,I). On the other axis. Patterns of hypoblast layer markers lefty2 (lft2; Bisgrove et al., hand, expression of endoderm-specific genes, such as foxA2 (Odenthal 1999), cyclops (cyc; Feldman et al., 1998; Rebagliati et al., 1998b), and and Nüsslein-Volhard, 1998) and sox17 (Alexander and Stainier, no tail/T/brachyury (ntl) are also consistent with a failure of marginal 1999), is dramatically reduced in mis mutant embryos. Endodermal hypoblast cells to extend animally within the axis and converge expression for these genes normally displays a dispersed “salt and towards the dorsal side. By mid-gastrulation in mis mutants, ex- pepper” pattern in the internal-most cell layer (Figs. 3K,M, brackets), pression of these genes is diminished along the animal–vegetal axis and this expression domain is absent in mutant embryos (Figs. 3L,N). and broadened dorsolaterally (Supp. Fig. 2). sox17 expression normally observed in forerunner cells (arrowhead in Additional experiments are consistent with a reduction in the Fig. 3M) is also affected in the mutants (Fig. 3N), possibly related to a ability of mutant cells to move within the blastoderm. Uncaging of a requirement for mis function in nodal signaling (see below) and a role subset of cells at a time coincident with the initiation of epiboly (4.5 h for this pathway in forerunner cell formation (Oteíza et al., 2008). p.f., Fig. 2A) results in a reduction of cell mixing (Figs. 2C, E, compared Quantitative PCR confirms a nearly 100-fold reduction in sox17 to B,D). Observation of wild-type and mutant cells co-transplanted expression relative to ß-actin expression (Supp. Fig. 5). Together, our into wild-type hosts prior to the initiation of epiboly (sphere stage, data indicate a requirement for mis function in the expression of 4 h.p.f., Fig. 2F) indicate that mutant cells (green; Figs. 2M–R) have a endoderm-specific genes. reduced ability to be incorporated into the developing dorsal axis compared to wild-type cells (red; Figs. 2G–L, see also overlay in S–X), Defects in maternal mis function do not affect upstream steps within the again consistent with a reduced ability of cells to undergo cell zygotically-dependent nodal signaling pathway movements. The microtubule network of the yolk syncytial layer (YSL; Supp. Fig. 3), as well as the f-actin enrichment that occurs at the Because nodal signaling is required for the induction of endoder- epibolic margin within the YSL (Supp. Fig. 1), both of which are mal genes, we assayed the expression of several nodal pathway known to be required for normal epibolic movements (Strähle and components by in situ hybridization (Fig. 4). These genes included the Jesuthasan, 1993; Solnica-Krezel and Driever, 1994; Holloway et al., Nodal-related genes squint (Feldman et al., 1998; Rebagliati et al., 2009), do not reveal any apparent defects in mutant embryos. 1998a; Erter et al., 1998) and cyclops (Feldman et al., 1998; Rebagliati Together, our observations indicate that mis function is required in a et al., 1998b), the mix-type transcription factor bonnie and clyde (bon; cell autonomous manner for cell movements during gastrulation. Alexander et al., 1999; Kikuchi et al., 2000) and their downstream target casanova/sox32 (cas; Kikuchi et al., 2001; Dickmeis et al., 2001). Mission impossible is required for the expression of endoderm-specific At 5 h.p.f. sqt transcripts are induced zygotically at the dorsal margin zygotic genes in both wild-type and mis embryos (Figs. 4A,B) and later expand around the blastoderm margin (data not shown). cyc transcripts are Because mis affects processes that occur after initiation of zygotic enriched at the blastoderm margin around the entire circumference of transcription, we asked whether mis mutants exhibit defects in gene the embryo (Figs. 4C,D). Likewise, bon and gata5 transcripts are expression in pathways involved in embryonic patterning. One of the expressed normally at the blastoderm margin during their initiation earliest known patterning events is the induction of the dorsal– until midgastrulation (Figs. 4E,F and data not shown). These results ventral axis in which antagonistic Wnt/β-catenin signaling and BMP indicate that the mis allele does not affect transcription of these signaling establish dorsal and ventral fates, respectively (reviewed in zygotic genes in upstream events within the mesendoderm induction Schier and Talbot, 2005). We assayed for zygotic expression of dorsal pathway. specific and ventral specific target genes by whole-mount in situ In wild-type embryos, cas expression becomes induced indepen- hybridization. nieuwkoid/bozozok/dharma (nwk), a direct target of the dently of nodal signaling at the YSL margin at 40% epiboly (Fig. 4G), Wnt/ß-catenin pathway (Ryu et al., 2001) is expressed in dorsal and then later in a nodal-dependent manner in overlying endodermal domains in both wild-type and mis at 5 h.p.f. (Supp. Fig. 4). We also precursors within the DEL (Fig. 4I, bracket; Kikuchi et al., 2001; assayed the expression of downstream targets of nwk, goosecoid (gsc; Dickmeis et al., 2001). YSL expression of cas appears to be normally Stachel et al., 1993; Schulte-Merker et al., 1994a) and chordin (chd; initiated in mis embryos at 40% epiboly (Fig. 4H). However, at 75% Fisher et al., 1997; Schulte-Merker et al., 1997), the neuroectodermal epiboly mis mutant embryos lack the characteristic salt and pepper E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 279

Fig. 2. Defects in cell movements in maternally mutant mis embryos. (A–E) Defect in cell mixing during early epiboly. (A) Labeling strategy, by uncaging fluorescent tracer at the sphere stage. Uncaging of a group of cells at the sphere stage in wild-type (B) and mis mutant (C) embryos is followed by extensive cell mixing in the wild-type (D) but little mixing in the mutant (E). (B–E) are side views, tilted toward the animal pole. Time after fertilization as indicated in h:min. Uncaging was carried out at 4:30 h.p.f., and some cell mixing has already occurred in (B,C). Embryos shown in (A–E) are representative of 5 wild-type and 5 mutant embryos. (F–X) Cell autonomy of movement defect. (F) Labeling strategy, by co- transplantation of rhodamine-labeled cells from wild-type (red) and fluorescein-labeled cells from maternally mutant mis (green) donors at the sphere stage (4 h.p.f.) into isochronic unlabeled wild-type host embryos. (G–L) Wild-type cells visualized with the rhodamine channel. (M–R) Mutant cells visualized with the fluorescein channel. (S–X) Merged images. Chimeric embryos were monitored for the first 24 h of development, and a subset of time points is shown (h:min p.f., indicated in (S–X)). Wild-type cells populate the embryonic axis of the host, while mutant cells remain in regions overlying the yolk cell. The embryo shown in (G–X) is representative of transplantations into 30 donor embryos. All panels are lateral views with dorsal to the right, except (L,R,X) with dorsal at the top and anterior to the left. endodermal cas pattern (Fig. 4J). Instead, these embryos show an optical sections using confocal microscopy. At 75% epiboly, wild-type abnormally strong expression of cas at the blastoderm margin embryos show a low level of cas expression in the YSL (Fig. 4K, (arrowhead). To determine if this marginal expression was located asterisks), as well as strong cas expression within a dispersed subset in the DEL or the YSL, we performed fluorescent in situ hybridization of DEL cells directly overlying the yolk cell (arrows in Fig. 4K), the of cas in wild-type and mis embryos and examined these cell layers in presumed endodermal precursors. In contrast, in mis embryos at this 280 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 same developmental time point (Fig. 4L), cas continues to be possibility that in these embryos a population of cas-expressing DEL expressed strongly and uniformly in the YSL, and cas DEL expression cells is induced at the margin but fails to migrate animalward. Instead, is drastically reduced. No accumulation of cas expressing cells is mutants seem to be defective in the induction of cas in the DEL. These observed in marginal cells of the DEL in mutants, ruling out the data indicate that mis mutant embryos are defective in dynamic changes in cas expression: although the nodal-independent expres- sion of cas in the YSL during early gastrulation appears to be initiated normally, by midgastrulation the nodal-dependent induction in the DEL is defective. In addition, the downregulation of cas expression in the YSL that occurs during gastrulation is also affected in mis mutants (see Discussion). Together, our results indicate that mis is not required for the initiation of the early (zygotic) nodal signaling pathway. Instead, mis appears to be involved in a relatively downstream event or events within this pathway, ultimately leading to reduced activation within the DEL of endoderm genes such as cas, sox17 and foxA2.

mis function is required for nodal-dependent expression of endoderm- specific genes

To determine if endoderm specification by nodal signaling is dependent on mis, we overexpressed the nodal ligand Cyc or Sqt by injection of its mRNA into one-cell stage embryos and then assayed for expression of downstream target genes (similar results were observed in both cyc- and sqt-injected embryos; Fig. 5 and data not shown). We first tested the expression of genes known to respond to ligand overexpression in wild-type embryo, gsc and ntl (Chen and Schier, 2001). Upon cyc mRNA injection at the one-cell stage, both gsc and ntl are ectopically expressed in wild-type embryos at 30% epiboly (5 h.p.f.)(Figs. 5A,E), as expected. Importantly, both of these genes are activated to the same extent in similarly treated mis embryos (Figs. 5B,F). These results suggest that mis mutant embryos are able to normally activate the nodal signaling pathway upon ligand overexpression, resulting in the expression of some nodal-dependent targets. Interestingly, at a later stage (60% epiboly; 7 h.p.f.), ntl expression is largely absent from cyc-injected wild-type embryos (Fig. 5C) while, in stark contrast, similarly injected mis mutant embryos maintain high ntl expression throughout the blastoderm (Fig. 5D). This can be explained by both the demonstrated ability of cas to inhibit ntl accumulation (Aoki et al., 2002a; see also Chen and Schier, 2001) and our finding that mis activity is required for cas activity (see below). Additional experiments show that mis embryos also can respond to the overactivation of other signaling pathways, such as the Wnt/ß-catenin and the FGF signaling pathways (Schier and Talbot, 2005), to induce the ectopic expression of their target genes (Supp. Fig. 6). Our next experiments directly tested the response of the endoderm-specific genes cas and sox17 to ectopic nodal activation in mutant embryos. cas shows ectopic induction in response to nodal signaling in both wild-type and mis embryos (Figs. 5G,H), indicating that mis function is not essential for cas activation. On the other hand, mis activity is essential for the expression of sox17 after ectopic nodal

Fig. 3. Induction of endoderm-specific genes is affected in maternally mutant mis embryos. Analysis of germ layer gene markers in wild-type (A,C,E,G,I,K,M) and maternally mutant mis embryos (B,D,F,H,J,L,N). Ectodermal markers chordin (A,B) and foxb1.2 (C,D) are induced in wild-type and mis mutants at similar levels, although their anterior-most domains of expression (arrows in A,C) are absent in mis mutants. Mesodermal marker genes no tail (E,F), snail1a (G,H), and lhx1a (I,J) are also induced in the blastoderm margin at normal levels in mis mutants compared to wild-type. On the other hand, mis mutant embryos fail to activate endodermal markers foxA2 (K,L) and sox17 (M,N) in the “salt and pepper” pattern characteristic of endodermal cells (brackets in K,M, compare to no detectable expression in L,N). The axial mesodermal domain of foxA2 (arrowheads in K,L) does become induced in mutant embryos, albeit in an abnormally shaped domain likely caused by the morphogenesis defects associated with the mutation (a similar effect is observed with regards to the axial domain of zlim-1 arrowhead in (I); see also Supp.Fig.2). Expression of sox17 in forerunner cells (arrowhead in M) is absent in the mutant (N) (see text). Stages are 5 h.p.f. (E,F), 6 h.p.f. (G–J,M,N), and 8 h.p.f. (A–D,K,L). All images are dorsal views with the animal pole at the top, except (E,F) which are animal views. E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 281

Fig. 4. Defects in endoderm-specific gene expression in maternally mutant mis embryos occur in downstream steps within the pathway. Wild-type (A,C,E,G,I,K) and mis mutant (B,D,F,H,J,L) embryos assayed for expressed transcripts encoding endoderm signaling components, including the nodal signals squint (A,B) and cyclops (C,D), and the transcription factors bon/mixer (E,F) and casanova/sox32 (cas, G-L). Expression patterns for squint, cyclops, and bon appear similar in wild-type and mis mutant embryos. cas becomes induced in the YSL at 5 h.p.f. in both wild-type and mis mutants (G,H). By 8 h.p.f., endodermal cells extending into the hypoblast layer express cas in a “salt and pepper” distribution in wild-type (I, bracket). However, cas expression in mis mutant embryos at this stage is restricted to the blastoderm margin (J, arrowhead). (K,L) Closer analysis of cas gene expression in the YSL and DEL was carried out by FISH with a cas antisense probe (red) and DAPI labeling (blue), followed by confocal microscopy. The YSL layer can be distinguished from the DEL by the less dense arrangement of its nuclei and their larger size, and a white line has been drawn between the two layers. In wild-type embryos at this stage (K), expression of cas in the YSL is subsiding (asterisks indicate YSL nuclei associated with cas mRNA), while strong expression has begun in interspersed DEL cells tightly adjoining the YSL (arrows), the presumed endodermal precursors. On the other hand, mis embryos (L) show abnormally strong and persistent cas expression in the YSL and very few, if any, cas-expressing cells in the DEL. Stages are 5 h.p.f. (A–D, G,H), 6 h.p.f. (E,F), and 8 h.p.f. (I–L). (A,B,G,H) are lateral views with dorsal to the right, when identifiable. (C–F) are animal pole views (expression in embryos corresponding to these panels is largely symmetric and slight apparent asymmetries in the embryos shown are caused by photographing artifacts). (I,J) are dorsal views. (K,L) are optical sections through the embryonic blastoderm at about 1/3 of the way between the margin and the animal pole. activation (Fig. 5J, compare to I; and data not shown). These results 1.3 cM region between 63.7 cM and 65.0 cM of the MGH zebrafish further confirm a role for mis function in the nodal-dependent recombination map (see Materials and methods). In addition to the induction of downstream endoderm-specific targets. MGH markers, additional polymorphic markers were identified from The fact that nodal overexpression can effectively induce cas but the established mapping families by sequencing candidate genes or not sox17 in mis embryos suggests that mis functions at a level at or non-coding regions predicted by the genome sequence assembly downstream of cas in the endoderm specification cascade. To further version 52.7E (http://www.ensembl.org; Supp. Table 1). Segregation corroborate this, we injected mRNA encoding cas into wild-type and analysis in critical recombinant females further narrowed the region mis embryos and again assayed for endoderm-specific gene induction containing the mis locus to a 0.1 cM interval (3 recombinants out of (Aoki et al., 2002a). In wild-type injected embryos, sox17 is induced 2249 total meiotic events; Supp. Fig. 7). According to the available throughout the blastoderm (Fig. 5K) but mis mutants injected with cas zebrafish genomic databases and excluding genes that include show a reduced ability to induce sox17 (Fig. 5L). A requirement for mis markers genetically separable from the mutation, the resulting region function is also observed in blastoderm explants with ectopically contains 6 known or predicted genes (Supp. Table 2). activated nodal signaling (Fig. 6A; David and Rosa, 2001). Explants In order to identify the mis locus within this region, we generated from mutant embryos exhibit a reduced ability to induce sox17 maternal cDNA from 1-cell embryos derived from both mis mutant (Fig. 6C) compared to the response of wild-type explants (Fig. 6B; and wild-type fish and fully sequenced the open reading frames for David and Rosa, 2001), demonstrating that the requirement for mis the six gene candidates within the critical region (Supp. Table 2). function is independent of the yolk cell. Together, our results indicate Among these genes, only one non-silent mutation was detected: a a role for maternally-derived mis function in a relatively downstream single nucleotide base change in dhx16 resulting in an Isoleucine (Ile) event in the zygotic pathway of endoderm induction, specifically at or to Asparagine (Asn) substitution at amino acid number 430 of the downstream of cas function but upstream of sox17 transcriptional protein (Figs. 7A,B). activation. Sequence comparison to Dhx16 in other organisms shows that Ile 430, a hydrophobic residue, is conserved in the species Takifugu Mission impossible codes for the RNA helicase Dhx16 rubripes, more commonly known as fugu (Fig. 7C). Other eukaryotic Dhx16 sequences, however, possess a Valine at this position, another To determine the molecular identity of mis, linkage segregation hydrophobic amino acid. Although Ile is not absolutely conserved in analysis of the mutation in a genetic background hybrid for two all species, the conservation of its hydrophobicity suggests that this polymorphic strains determined that the mis locus is located in a property is important for normal protein function. Comparison of 282 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289

Fig. 6. Nodal-dependent induction of endoderm-specific genes in blastoderm explants is dependent on maternal mis function. (A) Experimental manipulation: cyc mRNA was injected at the 1-cell stage, and the blastoderm was manually excised away from marginal cells and the yolk cell at the late blastula stage (sphere stage, 4 h.p.f.), as originally carried out by David and Rosa (2001). At 7 h.p.f., explants from wild-type embryos show robust sox17 expression (B), while explants from mis mutant embryos lack sox17 expression (C). Embryos shown are a subset of representative embryos from two experiments with at least 15 wild-type and 15 mis embryos per experiment. Embryonic explants were only included if they were intact after dissection. Embryo diagrams in (A) are adapted from Kimmel et al. (1995) (images courtesy of ZFIN).

sequences of the closely related zebrafish proteins Dhx8 and Dhx38 also reveals the presence of Ile at this residue, further corroborating its functional importance (Fig. 7C). The Zebrafish Dhx16 polypeptide is defined by elements found in the DEAH-box protein family including a DEAH/X helicase domain and putative ATP binding domain (Fig. 7A). Dhx16 is highly similar to other vertebrate and invertebrate molecules including Caenorhabditis elegans Mog-4 (Puoti and Kimble, 2000), and contains some similarity to a maternally expressed Arabidopsis thaliana protein MEE29 (Puoti and Kimble, 2000) and the Saccharomyces cerevisiae protein Prp2p (Arenas and Abelson, 1997) (Supp. Table 3). The residue altered by mis is the first of 4 conserved hydrophobic residues adjacent to sequence with strong similarity to the Walker-A motif for ATP binding (Fig. 7A; Walker et al., 1982). This is one of two motifs, the Walker-A and Walker-B motifs, first recognized in the molecules ATP synthase and myosin and subsequently identified in numerous kinases. The Walker-A motif contains the sequence GxxxxGK[S/T] and is thought to be a critical binding site for ATP to DEAH box polypeptides (Hall and Matson, 1999; Tanner and Linder, 2001). To verify the molecular identity of mis as dhx16, we synthesized mRNA from a full length wild-type zebrafish dhx16 cDNA and injected it into one-cell embryos from wild-type and mis females (Fig. 8; Supp. Table 4). Initial experiments indicated that wild-type embryos injected with wild-type dhx16 mRNA appear normal (Fig. 8A and data not shown). mis uninjected embryos showed the expected delayed gastrulation movements and lysed before the completion of Fig. 5. Nodal-dependent activation of sox17 requires maternally-derived mis function. epiboly (Fig. 8B). mis mutant embryos injected with wild-type dhx16 Wild-type (A,C,E,G,I,K) and mis mutant (B,D,F,H,J,L) embryos were injected at the 1-cell mRNA, however, showed varied degrees of morphological rescue – – stage with cyc (A D,G J), sqt (E,F) or cas (K,L) mRNA, and assayed by in situ including a well-defined shield and normal epiboly progression hybridization for the expression of no tail (A–D), gsc (E,F), cas (G,H) and sox17 (I–L). (A,B) In both wild-type and mis mutant embryos injected with cyc mRNA, ntl is (Fig. 8C), and many were indistinguishable from wild-type uninjected ectopically induced in the blastoderm at 5 h.p.f. By 7 h.p.f., however, ntl ceases to be (not shown) or wild-type injected embryos (Fig. 8A). Embryos expressed in injected wild-type embryos (C), but remains strongly expressed in mis injected with dhx16 mRNA were able to complete gastrulation and mutants (D). (E–H) Activation of nodal signaling results in ectopic gsc (E,F) and cas survive to 24 h.p.f. (56%, of 129 scored embryos). Of those mis mutant (G,H) expression at similar levels in both wild-type and mis mutant embryos, but leads embryos injected with wild-type dhx16 mRNA that survived to 24 h p. to the strong induction of sox17 only in wild-type embryos (I) and not in mis mutants (J). (K,L) Overexpression of cas results in sox17 expression in wild-type (K) but not mis f., a majority of embryos (68%, of 63 scored embryos) showed a wild- mutant (L) embryos. All panels are side views, except (E,F), which are animal views. type body morphology (Fig. 8E, compare to D), while others showed E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 283

Fig. 7. Molecular lesion of the maternally mutant mis allele occurs in a conserved amino acid of the dhx16 gene. (A) Amino acid sequence of the zebrafish DEAH Box Polypeptide 16, accession NP_956318 (Amsterdam et al., 2004; Sambrook et al., 2005) shows four domains (denoted by I, II, III, and IV) predicted by Pfam (http://pfam.sanger.ac.uk/; Finn et al., 2008) and the Conserved Domain Database at NCBI (http://www.ncbi.nlm.nih.gov/; Marchler-Bauer et al., 2007). DEAH16 contains the DEXDc domain of the DEAD-like helicase superfamily at residues 429–568 (underlined, I) and a conserved helicase domain for DEAD/H helicases (Pfam family PF00271) at residues 649–743 (underlined, II). The DEAH region contains a stretch of amino acids similar to the Walker A motif for ATP-binding at residues 435–442 (box “a”), and the DEAH box itself (box “b”). The residue Isoleucine 430 affected in the mist792 allele is indicated by a red star. A predicted HA2 domain (helicase associated domain; pfam04408) is contained in residues 805–895 (box, III) and may be involved in RNA binding. Another domain of unknown function (DUF1605; pfam07717) found near the C-terminus of DEAD box helicases is identified in residues 929–1028 (box, IV). (B) DNA sequence traces of the wild-type heterozygote and mutant homozygous mist792 genomic DNA. The nucleotide and amino acid substitutions are indicated in red. The region of high conservation in Eukaryota is enclosed by a pair of arrows. (C) Protein sequence comparison showing that the amino acid substitution in the mist792 allele occurs in a semi-conserved residue in a highly conserved region. Four conserved hydrophobic residues are underlined in green. Sequence similar to Walker-A motif for ATP binding is underlined in gray (G-X-X-X-X-G-K-T). various morphological defects, such a reduction in axis extension, transcripts can be observed to be ubiquitously expressed throughout possibly associated with incomplete rescue (Fig. 8F). These genetic gastrulation and somitogenesis, and later become enriched in the rescue data confirm that mission impossible codes for dhx16. head region beginning at 24 h.p.f. (Thisse et al., 2004). Additional experiments were carried out to compare in parallel the efficiency of rescue of mRNA corresponding to the maternal-effect mis/dhx16 is required zygotically for embryonic viability mist792 mutant (dhx16I-NN construct, see Materials and methods) and wild-type alleles (Supp. Table 5). As expected, in these experiments Previous studies have identified a retrovirally-induced insertional mis mutant embryos injected with wild-type dhx16 mRNA showed mutation in zebrafish dhx16, dhx16hi4049, which is thought to be a null marked rescue of the mutant phenotype (66% with normal progress mutation (Golling et al., 2002). Zygotically homozygous dhx16hi4049 during gastrulation, n=151). Similarly injected mutant siblings embryos appear morphologically normal during the first 24–36 h of injected with dhx16I-NN mRNA showed no significant rescue, largely development. Moreover, in situ hybridization analysis suggests a exhibiting the delays characteristic of uninjected control mutant normal activation of genes expressed in the mesoderm (ntl) and embryos (0% with normal progress during gastrulation, n=71). endoderm (cas, sox17, foxA2) during gastrulation and somitogenesis (assayed until 24 h.p.f., data not shown). The normal establishment of Expression pattern of mis/dhx16 the basic body plan and induction of meso/endodermal layers is consistent with the presence in these embryos of maternal products The expression pattern of dhx16 during embryogenesis has been inherited from the heterozygous mother. However, starting at around previously found to be not spatially restricted during early embryo- 36–48 h.p.f., these embryos show a general necrosis, throughout the genesis (Thisse et al., 2004). Presence of the transcripts prior to the body but particularly evident in the brain region, and they invariably mid-blastula transition indicate their maternal inheritance (Supp. lyse between days 3 and 6 of embryonic development (Golling et al., Fig. 8), consistent with identification of a maternal-effect mutation in 2002; Fig. 9B, compare to 9A; Supp. Table 6). Defects in these null this gene. As development proceeds, transcript levels appear mutant embryos are likely the result of programmed cell death, as unchanged until gastrulation (Supp. Fig. 8). This suggests the evidenced by increased labeling by the dye acridine orange (Supp. possibility that maternal mRNA may perdure until these later stages, Fig. 9), which labels apoptotic cells (Furutani-Seiki et al., 1996), and when mis has a functional role. Levels or distribution of maternally- the inhibition of this labeling by a general caspase inhibitor (Ikegami derived dhx16 mRNA do not appear affected in mis mutant embryos, et al., 1999; Chan et al., 2001)(Supp. Fig. 9). Labeling of dhx16hi4049 as judged by in situ hybridization analysis (Supp. Fig. 8). mis/dhx16 homozygous mutant embryos to detect key cellular markers, such as 284 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289

compared to dhx16hi4049/dhx16hi4049 homozygotes (Fig. 9C, compare to B; Supp. Table 6). Nevertheless, most if not all transheterozygotes appear to not be viable at day 5 of development, as reflected by a lack of swimbladder inflation (Supp. Table 6 and data not shown), a phenotypic endpoint associated with a wide range of late embryonic lethal conditions (see, for example, Haffter et al., 1996; Carney et al., 2006). The reduced phenotypic strength in mist792/dhx16hi4049 transheterozygotes is consistent with the mist792 allele retaining partial function. In agreement with insertional site assignment by Golling et al. (2002), injection of wild-type dhx16 mRNA at the one-cell stage rescues the zygotic necrosis phenotype normally observed in clutches derived from dhx16hi4049 heterozygous parents (Supp. Fig. 10). We used this assay to test whether the maternal-effect mist792 mutation (dhx16I-NN) may constitute a dominant-negative allele, as the zygotic null phenotype for other genes can be significantly enhanced by the expression of dominant negative products (presumably through their interference with maternally-inherited wild-type product, see Yabe et al., 2009). Injections of mRNA coding for the dhx16I-NN product at the one-cell stage do not significantly enhance the strength of the zygotic phenotype compared to uninjected controls (Supp. Fig. 10), arguing against a dominant-negative nature for this allele. This is further supported by the fully recessive nature of this allele in a large number of mapping crosses (Supp. Fig. 7 and data not shown), as well as the lack of significant effects caused by expression of dhx16I-NN product into wild-type embryos (data not shown). Instead, our genetic complementation analysis suggests that the mist792 allele codes for a hypomorphic (partial loss-of-function) allele. In the context of increased functional requirements often observed during the rapid divisions characteristic of cleavage stages (e.g. Yabe et al., 2007, 2009), this hypomorphic nature may explain the isolation of Fig. 8. Rescue of the maternally mutant mis phenotype with wild-type dhx16 mRNA. fi (A–C) Live embryos observed at 8 h.p.f., corresponding to 75% epiboly stage in an apparently maternal-speci c allele in a gene that has both zygotic unaffected wild-type embryos. Dotted line shows the blastoderm margin, and maternal requirements. indicative of the front of epiboly; a vertical solid white line indicates the thickness of the animal-most cell layer, which normally thins out during gastrulation; and Discussion brackets demarcate the approximate extent of the involuted cell layer. (A) Wild- type embryos injected with dhx16 mRNA appear normal, shown here during fi gastrulation. (B) Control uninjected mis mutant embryos show morphogenetic Here, we present the functional analysis and molecular identi - defects characteristic of the mutation, including a reduction in epiboly, a thickened cation of the gene mission impossible, originally identified through a animal cap and reduced involution. (C) Three mis mutant embryos injected with maternal-effect mutation that results in defects in embryonic dhx16 mRNA at the 1-cell stage, showing largely normal morphogenesis during inviability during gastrulation. mis function appears to be required gastrulation. (D–F) Live embryos observed at 24 h.p.f. (D) Wild-type embryo at 24 h.p.f. (E–F) mis mutant embryos with injected dhx16 mRNA survive gastrulation. within zygotic pathways that act relatively late in embryogenesis, A majority of these embryos exhibit a wild-type morphology (E), indicative of full well after the activation of the zygotic genome at the midblastula genetic rescue. Some embryos, likely those with partial genetic rescue, survive transition, and our results provide a striking example of the gastrulation but have a shortened axis (F). Focal plane in (F) allows observing an interweaving of maternally- and zygotically-derived functions to fl abnormal undulation of the notochord (arrowhead), which may re ect remaining control the vertebrate egg-to-embryo transition. We further show defects in dorsal convergence. As expected, uninjected mis mutant sibling embryos lyse during epiboly (not shown). Side views, animal pole to the top and dorsal side that mission impossible encodes the RNA helicase Dhx16. RNA to the right in (A–C), and anterior to the left and dorsal to the top in (D–F). helicases have been known to be important for the determination of the primordial germ cells (Hay et al., 1988; Roussell and Bennett, 1993; Gruidl et al., 1996; MacArthur et al., 2000; Navarro et al., 2001; microtubules, adhesive membranes and DNA reveals the presence of Palacios et al., 2004; Kotaja et al., 2006; Kloc and Chan, 2007; Salinas compact nuclei characteristic of apoptotic cells but no other obvious et al., 2007) and various other processes in somatic tissues (Tijster- defects in the cytoskeleton or the cell cycle (data not shown). man et al., 2002; Audhya et al., 2005; Yang et al., 2006, 2007; Meignin We also carried out crosses between individuals carrying the and Davis, 2008; Hubert and Anderson, 2009). This study adds to this maternal-effect (mist792) and the insertional (dhx16hi4049) alleles. growing list by demonstrating a role for an RNA helicase in the Crosses between individuals carrying these mutations result in a expression of specific target genes in the early zebrafish embryo. lethal phenotype in the expected Mendelian proportions (Supp. Table 6 and data not shown). A fraction of mist792/dhx16hi4049 Mission impossible encodes Dhx16 transheterozygotes exhibit the necrosis phenotype observed in dhx16hi4049/dhx16hi4049 homozygotes (Fig. 9C; Supp. Table 6), further Positional cloning and genetic analysis of a mutation in mission supporting the idea that this phenotype is caused by a reduction in impossible, initially identified as a recessive maternal-effect mutation, zygotic mis/dhx16 function. In addition, functional reduction of dhx16 indicate that this gene encodes the RNA helicase Dhx16. First, mis with a morpholino-conjugated oligonucleotide directed against the maps to a critical 0.1 cM region that includes Dhx16. Second, dhx16 translational start results in a similar necrosis phenotype sequencing Dhx16 in the chromosome containing the mis mutant (Fig. 9D and data not shown). allele reveals an amino acid substitution in an evolutionarily Interestingly, the penetrance and expressivity of the necrosis conserved residue in the Dhx16 protein, while other genes in the phenotype is reduced in mist792/dhx16hi4049 transheterozygotes critical region do not contain any non-synonymous changes. Third, E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 285

Fig. 9. Complementation analysis and functional reduction of mis/dhx16. Live embryos at day 3 p.f. (A,A’) heterozygous for the dhx16hi4049 mutation have a wild-type morphology. (B,B’) Homozygous dhx16hi4049/dhx16hi4049 embryos exhibit necrosis and overall reduction in the head region, as well as a shortened and bent body axis. (C,C’) Necrosis, head reduction and body shape defects are present in mist792/dhxhi4049 transheterozygotes, albeit not to the extent found in dhx16hi4049 homozygotes. (D,D’) Embryos injected with 0.25–1 ng (shown here with 0.25 ng) of morpholino-conjugated oligonucleotide directed against the dhx16 translational start site develop a phenotype similar to that of dhx16hi4049/dhx16hi4049 homozygotes. Embryos injected with similar amounts of a control morpholino appear normal (not shown). In (B–D), the necrosis phenotype could be observed as early as day 2 p.f. as a darkening in the head (not shown), developed at day 3 p.f. into the smaller head (sometimes still associated with darkening) shown in these panels, and the embryos invariably lyse between days 3 and 6 of development. Side views, anterior left, dorsal up. Right column is a higher-magnification view of the left column focusing on the head region.

injection of mRNA corresponding to the wild-type dhx16 allele into proper cellular movements during gastrulation. Cells in maternally one-cell stage mis mutant embryos rescues the embryonic phenotype mutant mis embryos undergo slower vegetalward movements during characteristic of this mutation. Finally, the maternal effect mis epiboly, a defect that can be observed during early epiboly (5.3 h.p.f.). mutation fails to complement an insertional mutation in the dhx16 Movements that begin somewhat later during epiboly, such as gene. We conclude that mission impossible corresponds to dhx16. involution (5.7 h.p.f.) and dorsal convergence (6–7 h.p.f.) also appear The mutation in the maternal-effect mis allele is a missense reduced in maternally mutant mis embryos. Transplantation of mutation in a highly evolutionarily conserved amino acid in the RNA mutant cells into wild type embryos indicates that these processes helicase Dxh16. This missense mutation results in the substitution of a are cell autonomous. These multiple defects may be most easily nonpolar amino acid found in all Dhx16 homologues from plants to explained if maternally mutant mis cells have a general defect in cell humans to a negatively charged residue, in a conserved hydrophobic migration. We cannot rule out, however, the possibility that such a core just 5 residues upstream of the Walker A motif involved in ATP generalized defect in cell movement stems from an overall reduction binding (Walker et al., 1982). This amino acid change may alter the in cell viability due to a general cellular requirement for mis/dhx16. efficiency of the ATP-dependent helicase activity of this protein and Nevertheless, a possible general requirement for mis/dhx16 function is lead to partial loss of function of the mutant protein. not supported by the robust expression of various genes at later stages of development (see below) as well as the absence of signs of cell Zebrafish mis/dhx16 gene is essential for embryonic development necrosis or apoptosis during gastrulation. A second, perhaps more specific, function for maternally-derived Our analysis of the mission impossible/dhx16 gene indicates an Mis product appears to be in the activation of specific downstream essential role for this gene in zebrafish embryogenesis. Some of the genes within the endoderm induction pathway. This defect appears to essential functions are dependent on maternally derived products. be relatively specific to downstream endodermal genes, as both One such maternally-dependent function appears to be important for ectodermal genes and mesodermal genes appear to be induced to 286 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 normal levels in mutant embryos. Moreover, activation of endodermal (but not mesodermal) gene expression after overexpression of nodal signals is affected in mis mutant embryos. Several lines of evidence suggest that the defects in morphogenetic movements and endoderm induction observed in mis mutant embryos are separable. On one hand, defects in cellular movements can be observed as early as the initiation of epiboly (5 h.p.f.), which begins hours prior to the induction of the affected endodermal genes that normally occurs at 75% epiboly (8 h.p.f.). On the other hand, defects in the induction of endoderm-specific genes in maternally mutant mis embryos occur even under conditions of nodal over- expression in blastoderm explants which do not seem to undergo any of the cellular movements characteristic of gastrulation. However, we cannot entirely rule out that the observed set of defects, in morphogenesis and gene expression, is not causally related by processes that we do not currently understand. The analysis of the null mis/dhx16 mutant phenotype suggests additional roles for this gene during development. Embryos homozy- gous for an insertional allele in dhx16, dxh16hi4049 exhibit a general necrosis observable starting at 24–36 h of development. This indicates that mis/dhx16 also has a function essential for cell viability later during development, in this case relying on zygotically-derived mis/ dhx16. It is presently unclear whether the apparent increased severity of this defect in the brain region represents a greater requirement for mis/dxh16 function in this region, or instead reflects a general requirement for mis/dhx16 function in cell viability that is revealed Fig. 10. Model for the site of action of mis/dhx16 function within the endoderm by the faster rates of cell division and exhaustion of maternal product induction pathway. Lack of induction of sox17 expression in mis mutants expressing supply in this tissue (see, for example, Wehman et al., 2007; Yabe nodal ligand or Cas suggests a role for maternally-provided mis function, downstream of cas expression but upstream of sox17 expression. Induction of mesodermal genes, in et al., 2009). unperturbed embryos and embryos expressing nodal ligand, is unaffected in mis mutants. Effects of mis mutation on the endogenous expression of cas may reflect a Dependence of the zygotically-driven nodal signaling pathway on requirement for Cas activity for its own expression (Dickmeis et al., 2001; not shown in maternally-derived mis/dhx16 function diagram).

A striking aspect of the phenotype of maternally mutant mis since cas YSL expression has been previously shown to be nodal- embryos is a defect in the activation of a subset of endodermal genes. independent (Dickmeis et al., 2001; Kikuchi et al., 2001). However, It is remarkable that, although mis function is required maternally for mis mutants do show persistent levels of cas in the YSL by endoderm induction, our analysis indicates that its function occurs in midgastrulation, a time when this expression has largely subsided downstream steps within the zygotically driven nodal signaling in wild-type embryos. This suggests a possible scenario for the pathway. In maternally mutant mis embryos, the nodal-related genes dynamic regulation of cas expression, where nodal/mis-independent squint and cyclops, and their immediate downstream target gene bon YSL expression precedes nodal/mis-dependent DEL expression, and are initiated normally. However, in these mutants expression of more negative feedback from nodal/mis-dependent genes in the DEL is downstream genes in the endoderm induction pathway, such as cas, important for subsequent downregulation of cas expression in the sox17 and foxA2 is defective. YSL. Expression analysis in embryos overexpressing nodal ligands suggests that the requirement for mis/dhx16 function occurs down- Molecular mechanisms of potential mis/dhx16 homologues suggest a stream of cas activation and is essential for the expression of sox17. requirement for this gene in posttranscriptional regulation of gene targets This is further supported by the finding that sox17 expression does not occur in mis mutant embryos expressing Cas. Thus, our observations Studies on the function of Dxh16 homologues in other organisms suggest a role for mis/dhx16 function in a step downstream of cas offer clues as to the potential function of zebrafish mis/dhx16. In yeast, function but upstream of sox17 gene activation (Fig. 10). Moreover, the dhx16 homologues prp8 in S. pombe and prp2 in S. cerevisiae, are mis function is essential for the induction of endodermal genes in involved in spliceosome function (Yean and Lin, 1991; Kim et al., blastoderm explants, thus ruling out the possibility that mis function 1992; Lundgren et al., 1996). Expression of the human homologue is essential for target gene activation by mediating a signal from the DBP2 partially rescues lethality in S. pombe prp8 mutants (Imamura yolk cell. et al., 1998), indicating functional conservation between yeast and While a requirement for mis function in cas activation is apparent human proteins. In the nematode C. elegans, the dhx16 ortholog mog-4 in unperturbed embryos, mutant embryos with exogenously activated is among a group of genes shown to have an essential role in the nodal signaling appear to express cas normally. This may be explained translational repression of fem-3, required for the sperm-to-oocyte by the role of mis/dhx16 function downstream of Cas activity and the transition in this organism by FBF (Gallegos et al., 1998; Graham and previously postulated function of Cas in the maintenance of its own Kimble, 1993; Graham et al., 1993; Puoti and Kimble, 1999, 2000; expression (Dickmeis et al., 2001). However, our data do not fully rule Belfiore et al., 2002), which directly binds regulatory elements in the out a separate effect of the mis/dhx16 mutation on cas induction that is fem-3 3′-UTR (Ahringer and Kimble, 1991; Zhang et al., 1997; only apparent in the unperturbed embryo. Crittenden et al., 2002). However, the molecular basis for the In contrast to defects in the induction of endoderm-specific genes requirement for mog genes in this process has not been reported. in the DEL, mis mutant embryos do not exhibit defects in the Interestingly, mutant combinations that allow the production of activation of cas in the YSL layer. This is in agreement with our oocytes from C. elegans mog mutant females reveal maternal-effect findings that mis mediates downstream events in the nodal pathway, morphogenesis defects caused by mog mutations (Graham and E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 287

Kimble, 1993; Graham et al., 1993), reminiscent of those observed in Aoki, T.O., David, N.B., Minchiotti, G., Saint-Etienne, L., Dickmeis, T., Persico, G.M., Strähle, fi U., Mourrain, P., Rosa, F.M., 2002a. Molecular integration of casanova in the nodal zebra sh mis mutants. These observations and our own data suggest signalling pathway controlling endoderm formation. Development 129, 275–286. that zebrafish mis/dhx16 may be required for the regulation of a subset Aoki, T.O., Mathieu, J., Saint-Etienne, L., Rebagliati, M.R., Peyriéras, N., Rosa, F.M., 2002b. of genes involved in early development, possibly at the level of Regulation of Nodal signalling and mesendoderm formation by TARAM-A, a TGFß- related type I receptor. Dev. Biol. 241, 273–288. posttranscriptional regulation. Indeed, the large number of maternal Arenas, J.E., Abelson, J.N., 1997. Prp43: an RNA helicase-like factor involved in transcripts deposited in the zebrafish egg, which await their spliceosome disassembly. Proc. Natl. Acad. Sci. U. S. A. 94, 11798–11802. activation at the right time and place during early embryonic Audhya, A., Hyndman, F., McLeod, I.X., Maddox, A.S., Yates III, J.R., Desai, A., 2005. A development, poses an impending need for precise posttranscrip- complex containing the Sm protein CAR-1 and the RNA helicase CGH-1 is required for embryonic cytokinesis in Caenorhabditis elegans. J. Cell Biol. 171, 267–279. tional regulation. However, the precise molecular mechanism of Mis/ Belfiore, M., Mathies, L.D., Pugnale, P., Moulder, G., Barstead, R., Kimble, J., Puoti, A., 2002. The Dhx16 action remains a question for future studies. MEP-1 zinc finger protein acts with MOG DEAH box proteins to control gene expression ′ – Further studies will also be necessary to identify the targets or sets via the fem-3 3 untranslated region in Caenorhabditis elegans. RNA 8, 725 739. Bisgrove, B.W., Essner, J.J., Yost, H.J., 1999. Regulation of midline development by of targets regulated by mis/dhx16. Lack of maternal spg/pouf51 antagonism of lefty and nodal signaling. Development 126, 3253–3262. function results in defects in morphogenesis and gene expression Bjornson, C.R., Griffin, K.J., Farr III, G.H., Terashima, A., Himeda, C., Kikuchi, Y., Kimelman, defects similar to those observed in maternally mutant mis/dhx16 D., 2005. Eomesodermin is a localized maternal determinant required for endoderm induction in zebrafish. Dev. Cell 9, 523–533. embryos (Lunde et al., 2004; Reim et al., 2004). Thus, it is possible that Brand, M., Granato, M., Nüsslein-Volhard, C., 2002. Keeping and Raising Zebrafish. In: spg/pouf51 is a target of Mis/Dhx16. Another potential Mis/Dhx16 Nüsslein-Volhard, C., Dahm, R. (Eds.), Zebrafish - A Practical Approach, Vol. 261. target is the mRNA for the gene eomesodermin, which has been Oxford University Press, Oxford, pp. 7–37. Bruce, A.E.E., Howley, C., Dixon Fox, M., Ho, R.K., 2005. T-box gene eomesodermin and implicated in the transcriptional regulation of cas and whose maternal the homeobox-containing Mix/Bix gene mtx2 regulate epiboly movements in the mRNA becomes localized to the blastodisc margin during early zebrafish. Dev. Dyn. 233, 105–114. embryonic cell divisions (Bjornson et al., 2005). In addition, Eomes Carney, S.A., Heideman, W., Peterson, R.E., Prasch, A., 2006. Understanding dioxin developmental toxicity using the zebrafish model. Birth Defects Res. Clin. Mol. and its target gene mtx2 are also required for proper epibolic Teratol. 76, 7–18. movements (Bruce et al., 2005; Wilkins et al., 2008). However, in Chan, Y.M., Wu, W., Yip, H.K., So, K.F., Oppenheim, R.W., 2001. Caspase inhibitors promote situ hybridization analysis indicates that maternally mutant mis the survival of avulsed spinal motoneurons in neonatal rats. Neuroreport 12, 541–545. fi embryos do not exhibit readily apparent changes in maternal eomes Chen, Y., Schier, A.F., 2001. The zebra sh Nodal signal Squint functions as a morphogen. Nature 411, 607–610. mRNA localization (our unpublished data). We are currently Cinalli, R.M., Rangan, P., Lehmann, R., 2008. Germ cells are forever. Cell 132, 559–562. investigating whether mis is involved in the regulation of these Crittenden, S.L., Bernstein, D.S., Bachorik, J.L., Thompson, B.W., Gallegos, M., Petcherski, A.G., candidate genes at other posttranscriptional levels, such as splicing or Moulder, G., Barstead, R., Wickens, M., Kimble, J., 2002. A conserved RNA binding protein controls germline stem cells in Caenorhabditis elegans. Nature 417, 660–663. translational control. In addition, genome-wide studies will be David, N.B., Rosa, F.M., 2001. Cell autonomous commitment to an endodermal fate and essential to determine, in an unbiased manner, potential targets for behaviour by activation of Nodal signalling. Development 128, 3937–3947. mis/dhx16 function. Dickmeis, T., Mourrain, P., Saint-Etinne, L., Fischer, N., Aanstad, P., Clark, M., Strähle, U., fi Rosa, F., 2001. A crucial component of the endoderm formation pathway, In summary, we show that the zebra sh maternal-effect gene CASANOVA, is encoded by a novel sox-related gene. Genes Dev. 15, 1487–1492. mission impossible codes for an RNA helicase, Dhx16, that is essential Erter, C.E., Solnica-Krezel, L., Wright, C.V.E., 1998. Zebrafish nodal-related 2 encodes an for embryonic development, including the expression of downstream early mesendodermal inducer signaling from the extraembryonic yolk syncytial – fi layer. Dev. Biol. 204, 361 372. endoderm-speci c genes. The molecular identity of this gene suggests Feldman, B., Gates, M.A., Egan, E.S., Dougan, S.T., Rennebeck, G., Sirotkin, H.I., Schier, A.F., a function of this helicase in the regulation of mRNAs during the Talbot, W.S., 1998. Zebrafish organizer development and germ-layer formation transition between the maternal and zygotic control in vertebrate require nodal-related signals. Nature 395, 181–185. Ferg, M., Sanges, R., Gehrig, J., Kiss, J., Bauer, M., Lovas, A., Szabo, M., Yang, L., Strähle, U., embryogenesis. Pankratz, M.J., Olasz, F., Stupka, E., Müller, F., 2007. The TATA-binding protein Supplementary materials related to this article can be found online regulates maternal mRNA degradation and differential zygotic transcription in at doi:10.1016/j.ydbio.2011.03.001. zebrafish. EMBO J. 26, 3945–3956. Finn, R.D., Tate, J., Mistry, J., Coggill, P.C., Hotz, H.R., Ceric, G., Forslund, K., Eddy, S.R., Sonnhammer, E.L., Bateman, A., 2008. The Pfam protein families database. Nucleic Acids Res. 36, D281–D288. Acknowledgments Fisher, S., Amacher, S.L., Halpern, M.E., 1997. Loss of cerebum function ventralizes the zebrafish embryo. Development 124, 1301–1311. Furutani-Seiki, M., Jiang, Y.-J., Brand, M., Heisenberg, C.-P., Houart, C., Beuchle, D., van We are grateful to Drs. Rebagliati (Stowers Institute), Schier Eeden, F.J.M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D.A., Kelsh, R.N., (Harvard U.), Stainier (UCSF), and other members of the zebrafish Mullins, M.C., Odenthal, J., Nüsslein-Volhard, C., 1996. Neural degeneration community for plasmids, and Drs. Hopkins and Amsterdam (MIT) for mutants in the zebrafish, Danio rerio. Development 123, 229–239. hi4049 Gallegos, M., Ahringer, J., Crittenden, S., Kimble, J., 1998. Repression by the 3′UTR of the dhx16 mutant line. We also thank Drs. Jamie Lyman- fem-3, a sex-determining gene, relies on a ubiquitous mog-dependent control in Gingerich and Sreelaja Nair for sharing unpublished data relevant to Caenorhabditis elegans. EMBO J. 17, 6337–6347. this work, as well as for their comments and those of other members Giraldez, A.J., Mishima, Y., Rihel, J., Grocock, R.J., Van Dongen, S., Inoue, K., Enright, A.J., Schier, A.F., 2006. Zebrafish MiR-430 promotes deadenylation and clearance of of the Pelegri laboratory and anonymous reviewers on the manu- maternal mRNAs. Science 312, 75–79. script. We are also grateful to Drs. Xiaoyan Ge and Sreelaja Nair for Golling, G., Amsterdam, A., Sun, Z., Antonelli, M., Maldonado, E., Chen, W., Burgess, S., assistance with experiments during the revision of this manuscript, Haldi, M., Artzt, K., Farrington, S., Lin, S.-Y., Nissen, R.M., Hopkins, N., 2002. fi fi and to Dr. Scott Kennedy (U.W. Madison) for access to the Real-Time Insertional mutagenesis in zebra sh rapidly identi es genes essential for early vertebrate development. Nat. Genet. 31, 135–140. PCR system. Research in the Pelegri laboratory is funded by grant R01 Graham, P.L., Kimble, J., 1993. The mog-1 gene is required for the switch from GM065303 from NIH. spermatogenesis to oogenesis in Caenorhabditis elegans. Genetics 133, 919–931. Graham, P.L., Schedl, T., Kimble, J., 1993. More mog genes that influence the switch from spermatogenesis to oogenesis in the hermaphrodite germ line of Caenorhabditis elegans. Dev. Genet. 14, 471–484. References Griffin, K.J.P., Amacher, S.L., Kimmel, C.B., Kimelman, D., 1998. Molecular identification of spadetail: regulation of zebrafish trunk and tail mesoderm formation by T-box Ahringer, J., Kimble, J., 1991. Control of the sperm-oocyte switch in Caenorhabditis genes. Development 125, 3379–3388. elegans hermaphrodites by the fem-3 3′ untranslated region. Nature 349, 346–348. Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W.S., Schier, A.F., 1999. The EGF- Alexander, J., Stainier, D.Y.R., 1999. A molecular pathway leading to endoderm CFC protein one-eyed pinhead is essential for nodal signaling. Cell 97, 121–132. formation in zebrafish. Curr. Biol. 9, 1147–1157. Gruidl, M.E., Smith, P.A., Kuznicki, K.A., McCrone, J.S., Kirchner, J., Roussell, D.L., Strome, Alexander, J., Rothenberg, M., Henry, G.L., Stainier, D.Y.R., 1999. casanova plays an early S., Bennett, K.L., 1996. Multiple potential germ-line helicases are components of the and essential role in endoderm formation in zebrafish. Dev. Biol. 215, 343–357. germ-line-specific P granules of Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A. Amsterdam, A., Nissen, R.M., Sun, Z., Swindell, E., Farrington, S., Hopkins, N., 2004. 93, 13837–13842. Identification of 315 genes essential for early zebrafish development. Proc. Natl. Haffter, P., Granato, M., Brand, M., Mullins, M.C., Hammerschmidt, M., Kande, D.A., Acad. Sci. U. S. A. 101, 12792–12797. Odenthal, J., van Eeden, F.J.M., Jiang, Y.-J., Heisenberg, C.-P., Kelsh, R.N., Furutani- 288 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289

Seiki, M., Vogelsang, E., Beuchle, D., Schach, U., Fabian, C., Nüsslein-Volhard, C., Navarro, R.E., Shim, E.Y., Kohara, Y., Singson, A., Blackwell, T.K., 2001. cgh-1, a conserved 1996. The identification of genes with unique and essential functions in the predicted RNA helicase required for gametogenesis and protection from physio- development of the zebrafish, Danio rerio. Development 123, 1–36. logical germline apoptosis in C. elegans. Development 128, 3221–3232. Hall, M.C., Matson, S.W., 1999. Helicase motifs: the engine that powers DNA unwinding. Newport, J., Kirschner, M., 1982a. A major developmental transition in early Xenopus Mol. Microbiol. 34, 867–877. embryos: I. Characterization and timing of cellular changes at the midblastula Hammerschmidt, M., Nüsslein-Volhard, C., 1993. The expression of a zebrafish gene Stage. Cell 30, 675–686. homologous to Drosophila snail suggests a conserved function in invertebrate and Newport, J., Kirschner, M., 1982b. A major developmental transition in early Xenopus vertebrate gastrulation. Development 119, 1107–1118. embryos: II. Control of the onset of transcription. Cell 30, 687–696. Hauptmann, G., 1999. Two-color detection of mRNA transcript localizations in fish and Nomura, M., Li, E., 1998. Smad2 role in mesoderm formation, left-right patterning and fly embryos using alkaline phosphatase and ß-galactosidase conjugated antibodies. craniofacial development. Nature 393, 786–790. Dev. Genes Evol. 209, 317–321. Ober, E.A., Schulte-Merker, S., 1999. Signals from the yolk cell induce mesoderm, Hauptmann, G., Gerster, T., 1994. Two-color whole-mount in situ hybridization to neuroectoderm, the trunk organizer, and the notochord in zebrafish. Dev. Biol. 215, vertebrate and Drosophila embryos. Trends Genet. 10, 266. 167–181. Hay, B., Jan, L.Y., Jan, Y.N., 1988. A protein component of Drosophila polar granules is Odenthal, J., Nüsslein-Volhard, C., 1998. fork head domain genes in zebrafish. Dev. encoded by vasa and has extensive sequence similarity to ATP-dependent Genes Evol. 208, 245–258. helicases. Cell 55, 577–587. Oteíza, P., Köppen, M., Concha, M.L., Heisenberg, C.P., 2008. Origin and shaping of the Holloway, B.A., de la Torre, Gomez, Canny, S., Ye, Y., Slusarski, D.C., Freisinger, C.M., laterality organ in zebrafish. Development 135, 2807–2813. Dosch, R., Chou, M.M., Wagner, D.S., Mullins, D.C., 2009. A novel role for MAPKAPK2 Palacios, I.M., Gatfield, D., St. Johsnton, D., Izaurralde, E., 2004. An eIF4AIII-containing in morphogenesis during zebrafish development. PLoS Genet. 5, e1000413. complex required for mRNA localization and nonsense-mediated mRNA decay. Hubert, A., Anderson, P., 2009. The C. elegans sex determination gene laf-1 encodes a Nature 427. putative DEAD-box RNA helicase. Dev. Biol. 330, 358–367. Pelegri, F., 2002. Mutagenesis. In: Nüsslein-Volhard, C., Dahm, R. (Eds.), Zebrafish - A Ikegami, R., Hunter, P., Yager, T.D., 1999. Developmental activation of the capability to Practical Approach, Vol. 261. Oxford University Press, Oxford, pp. 145–174. undergo checkpoint-induced apoptosis in the early zebrafish embryo. Dev. Biol. Pelegri, F., 2004. The Role of Maternal Factors in Early Zebrafish Development. In: 209, 409–433. Korzh, V., Gong, Z. (Eds.), Fish Development and Genetics, Vol. 2. World Scientific, Imamura, O., Saiki, K., Tani, T., Ohshima, Y., Sugawara, M., Furuichi, Y., 1998. Cloning and Singapore, pp. 1–38. characterization of human DEAH-box RNA helicase, a functional homolog of fission Pelegri, F., Maischein, H.-M., 1998. Function of zebrafish ß-catenin and TCF-3 in yeast Cdc28/Prp8. Nucleic Acids Res. 26, 2063–2068. dorsoventral patterning. Mech. Dev. 77, 63–74. Jia, S., Ren, Z., Li, X., Zheng, Y., Meng, A., 2008. smad2 and smad3 are required for Pelegri, F., Schulte-Merker, S., 1999. A Gynogenesis-Based Screen for Maternal-Effect mesendoderm induction by transforming growth factor-ß/nodal signals in Genes in the Zebrafish, Danio rerio. In: Detrich, W., Zon, L.I., Westerfield, M. (Eds.), zebrafish. J. Biol. Chem. 283, 2418–2426. The Zebrafish: Genetics and Genomics, Vol. 60. Academic Press, San Diego, pp. Joly, J.-S., Joly, C., Schulte-Merker, S., Boulkebache, H., Condamine, H., 1993. The ventral 1–20. and posterior expression of the homeobox gene eve1 is perturbed in dorsalized and Pelegri, F., Dekens, M.P.S., Schulte-Merker, S., Maischein, H.-M., Weiler, C., Nüsslein- mutant embryos. Development 119, 1261–1275. Volhard, C., 2004. Identification of recessive maternal-effect mutations in the Keller, P.J., Schmidt, A.D., Wittbrodt, J., Stelzer, E.H.K., 2008. Reconstruction of zebrafish zebrafish using a gynogenesis-based method. Dev. Dyn. 231, 325–336. early embryonic development by scanned light sheet microscopy. Science 322. Peyriéras, N., Strähle, U., Rosa, F., 1998. Conversion of zebrafish blastomeres to an Kikuchi, Y., Trinh, L.A., Reiter, J.F., Alexander, J., Yelon, D., Stainier, D.Y.R., 2000. The endodermal fate by TGF-ß-related signalling. Curr. Biol. 8, 783–786. zebrafish bonnie and clyde gene encodes a Mix family homeodomain protein that Pogoda, H.-M., Solnica-Krezel, L., Driever, W., Meyer, D., 2000. The zebrafish forkhead regulates the generation of endodermal precursors. Genes Dev. 14, 1279–1289. transcription factor FoxH1/Fast1 is a modulator of Nodal signaling required for Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C., Waldron, S., Yelon, D., Thisse, B., organizer formation. Curr. Biol. 10, 1041–1049. Stainier, D.Y.R., 2001. casanova encodes a novel Sox-related protein necessary and Poulain, M., Lepage, T., 2002. Mezzo, a paired-like homeobox protein is an immediate sufficient for early endoderm formation in zebrafish. Genes Dev. 15, 1493–1505. target of Nodal signalling and regulates endoderm specification in zebrafish. Kim, S.H., Smith, J.C., Claude, A., Lin, R.J., 1992. The purified yeast pre-mRNA splicing Development 129, 4901–4914. factor PRP2 is an RNA-dependent NTPase. EMBO J. 11, 2319–2326. Puoti, A., Kimble, J., 1999. The Caenorhabditis elegans sex determination gene mog-1 Kimmel, C.B., Warga, R.M., Schilling, T.F., 1990. Origin and organization of the zebrafish encodes a member of the DEAH-box protein family. Mol. Cell. Biol. 19, 2189–2197. fate map. Development 108, 581–594. Puoti, A., Kimble, J., 2000. The hermaphrodite sperm/oocyte switch requires the Kimmel, C., Ballard, W.W., Kimmel, S.R., Ullmann, B., Schilling, T.F., 1995. Stages of Caenorhabditis elegans homologs of PRP2 and PRP22. Proc. Natl. Acad. Sci. U. S. A. 97, embryonic development in the zebrafish. Dev. Dyn. 203, 253–310. 3276–3281. Kloc, M., Chan, A.P., 2007. Centroid, a novel putative DEAD-box RNA helicase maternal Putiri, E., Pelegri, F., 2008. Passing the torch at the oocyte to embryo transition. Trends mRNA, is localized in the mitochondrial cloud in Xenopus laevis oocytes. Int. J. Dev. Dev. Biol. 3, 45–60. Biol. 51, 701–706. Rajyaguru, P., Parker, R., 2009. CGH-1 and the control of maternal mRNAs. Trends Cell Kloc, M., Etkin, L.D., 2005. RNA localization mechanisms in oocytes. J. Cell Sci. 118, Biol. 19, 24–28. 269–282. Rebagliati, M.R., Toyama, R., Fricke, C., Haffter, P., Dawid, I.B., 1998a. Zebrafish nodal- Koos, D.S., Ho, R.K., 1998. The nieuwkoid gene characterizes and mediates a Nieuwkoop- related genes are implicated in axial patterning and establishing left-right center-like activity in the zebrafish. Curr. Biol. 8, 1199–1206. asymmetry. Dev. Biol. 199, 261–272. Kotaja, N., Bhattacharyya, S.N., Jaskiewicz, L., Kimmins, S., Parvinen, M., Filipowicz, W., Rebagliati, M.R., Toyama, R., Haffter, P., Dawid, I.B., 1998b. cyclops encodes a nodal- Sassone-Corsi, P., 2006. The chromatoid body of male germ cells: similarity with related factor involved in midline signaling. Proc. Natl. Acad. Sci. U. S. A. 95, processing bodies and presence of Dicer and microRNA pathway components. Proc. 9932–9937. Natl. Acad. Sci. U. S. A. 103, 2647–2652. Reim, G., Mizoguchi, T., Stainier, D.Y.R., Kikuchi, Y., Brand, M., 2004. The POU domain Kunwar, P.S., Zimmerman, S., Bennet, J.T., Chen, Y., Whitman, M., Schier, A.F., 2003. protein spg (pou2/Oct4) is essential for endoderm formation in cooperation with Mixer/Bon and FoxH1/Sur have overlapping and divergent roles in nodal signaling the HMG domain protein casanova. Dev. Cell 6, 91–101. and mesendoderm induction. Development 130, 5589–5599. Reiter, J.F., Alexander, J., Rodaway, A., Yelon, D., Patient, R., Holder, N., Stainier, D.Y.R., Lipshitz, H.D., Smibert, C.A., 2000. Mechanisms of RNA localization and translational 1999. Gata5 is required for the development of the heart and endoderm-derived regulation. Curr. Opin. Genet. Dev. 10, 476–488. organis in zebrafish. Genes Dev. 13, 2983–2995. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using Real- Reiter, J.F., Kikuchi, Y., Stainier, D.Y.R., 2001. Multiple roles for Gata5 in zebrafish Time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. endoderm formation. Development 128, 125–135. Lunde, K., Belting, H.-G., Driever, W., 2004. Zebrafish pou5f1/pou2, homolog of Renucci, A., Lemarchander, V., Rosa, F., 1996. An activated form of type I serine/ mammalian Oct4, functions in the endoderm specification cascade. Curr. Biol. 14, threonine kinase receptor TARAM-A reveals a specific signalling pathway involved 48–55. in fish head organiser formation. Development 122, 3735–3743. Lundgren, K., Allan, S., Urushiyama, S., Tani, T., Oshima, Y., Frendewey, D., Beach, D., Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B., Smith, J.C., Patient, R., 1996. A connection between pre-mRNA splicing and the cell cycle in fission yeast: Holder, N., 1999. Induction of the mesendoderm in the zebrafish germ ring by yolk cdc28+ is allelic with prp8+ and encodes an RNA-dependent ATPase/helicase. cell-derived TGF-ß family signals and discrimination of mesoderm and endoderm Mol. Biol. Cell 7, 1083–1094. by FGF. Development 126, 3067–3078. MacArthur, H., Houston, D.W., Bubunenko, K., Mosquera, L., King, M.L., 2000. DEADSouth Roussell, D.L., Bennett, K.L., 1993. glh-1, a germ-line putative RNA helicase from is a germ plasm specific DEAD-box RNA helicase in Xenopus related to eIF4A. Mech. Caenorhabditis, has four zinc fingers. Proc. Natl. Acad. Sci. U. S. A. 90, 9300–9304. Dev. 95, 291–295. Ryu, S.-L., Fuji, R., Yamanaka, Y., Shimizu, T., Yabe, T., Hirata, T., Hibi, M., Hirano, T., 2001. Marchler-Bauer, A., Anderson, J.B., Derbyshire, M.K., DeWeese-Scott, C., Gonzalez, N.R., Regulation of dharma/bozozok by the Wnt pathway. Dev. Biol. 231, 397–409. Gwadz,M.,Hao,L.,He,S.,Hurwitz,D.I.,Jackson,J.D.,Ke,Z.,Krylov,D.,Lanczyncki, Salinas, S., Maldonado, E., Macias-Silva, M., Blackwell, T.K., Navarro, R.E., 2007. The C.J.,Liebert,C.A.,Liu,C.,Liu,F.,Liu,S.,Marchler,G.H.,Mullokandov,M.,Song,J.S., DEAD box RNA helicase VBH-1 is required for germ cell function in C. elegans. Thanki, N., Yamashita, R.A., Yin, J.J., Zhang, D., Bryant, S.H., 2007. CDD: a conserved Genesis 45, 533–546. domain database for interactive domain family analysis. Nucleic Acids Res. 35, Sambrook, J.G., Figueroa, F., Beck, S., 2005. A genome-wide survey of Major D237–D240. Histocompatibility Complex (MHC) genes and their paralogues in zebrafish. BMC Meignin, C., Davis, I., 2008. UAP56 RNA helicase is required for axis specification and Genomics 6, 152. cytoplasmic mRNA localization in Drosophila. Dev. Biol. 315, 89–98. Schier, A.F., Talbot, W.S., 2005. Molecular genetics of axis formation in zebrafish. Annu. Montero, J.A., Carvalho, A., Wilsch-Brauninger, M., Kilian, B., Mustafa, C., Heisenberg, Rev. Genet. 39, 561–613. C.P., 2005. Shield formation at the onset of zebrafish gastrulation. Development Schulte-Merker, S., Hammerschmidt, M., Beuchle, D., Cho, K., DeRobertis, E.M., 132, 1187–1198. Nüsslein-Volhard, C., 1994a. Expression of the zebrafish goosecoid and no tail E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 289

gene products in wild-type and mutant ntl embryos. Development 120, Walker, J.E., Saraste, M., Runswick, M.J., Gay, N.J., 1982. Distantly related sequences in 843–852. the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP- Schulte-Merker, S., van Eeden, F.J.M., Halpern, M.E., Kimmel, C.B., Nüsslein-Volhard, C., requiring enzymes and a common nucleotide binding fold. EMBO J. 1, 945–951. 1994b. no tail (ntl) is the zebrafish homologue of the mouse T (Brachyury) gene. Warga, R.M., Nüsslein-Volhard, C., 1999. Origin and development of the zebrafish Development 120, 1009–1015. endoderm. Development 126, 827–838. Schulte-Merker, S., Lee, K.J., McMahon, A.P., Hammerschmidt, M., 1997. The zebrafish Watanabe, M., Whitman, M., 1999. FAST-1 is a key maternal effector of mesoderm organizer requires chordino. Nature 387, 862–863. inducers in the early Xenopus embryo. Development 126, 5621–5634. Sirotkin, H.I., Gates, M.A., Kelly, P.D., Schier, A.F., Talbot, W.S., 2000. fast1 is required for Weber, H., Symes, C.E., Walmsley, M.E., Rodaway, A.R., Patient, R.K., 2000. A role for the development of dorsal axial structures in zebrafish. Curr. Biol. 10, 1051–1054. GATA5 in Xenopus endoderm specification. Development 127, 4345–4360. Solnica-Krezel, L., 2006. Gastrulation in zebrafish — all just about adhesion. Curr. Opin. Wehman, A.M., Satub, W., Baier, H., 2007. The anaphase-promoting complex is required Genet. Dev. 16, 433–441. in both dividing and quiescent cells during zebrafish development. Dev. Biol. 303, Solnica-Krezel, L., Driever, W., 1994. Microtubule arrays of the zebrafish yolk cell: 144–156. organization and function during epiboly. Development 120, 2443–2455. Weinstein, M., Yang, X., Li, C., Su, S., Gotay, J., Deng, C.X., 1998. Failure of egg cylinder Stachel, S.E., Grunwald, D.J., Myers, P.Z., 1993. Lithium perturbation and goosecoid elongation and mesoderm induction in mouse embryos lacking the tumor expression identify a dorsal specification pathway in the pregastrula zebrafish. suppressor Smad2. Proc. Natl. Acad. Sci. U. S. A. 95, 9378–9383. Development 117, 1261–1274. Wilkins, S.J., Yoong, S., Verkade, H., Mizoguchi, T., Plowman, S.J., Hancock, J.F., Kikuchi, Strähle, U., Jesuthasan, S., 1993. Ultraviolet irradiation impairs epiboly in zebrafish Y., Heath, J.K., Perkins, A.C., 2008. Mtx2 directs zebrafish morphogenetic move- embryos: evidence for a microtubule-dependent mechanism of epiboly. Develop- ments during epiboly by regulating microfilament formation. Dev. Biol. 314, 12–22. ment 119, 909–919. Yabe, T., Ge, X., Pelegri, F., 2007. The zebrafish maternal-effect gene cellular atoll Strähle, U., Blader, P., Hernique, D., Ingham, P.W., 1993. Axial, a zebrafish gene encodes the centriolar component sas-6 and defects in its paternal function expressed along the developing body axis, shows altered expression in cyclops promote whole genome duplication. Dev. Biol. 312, 44–60. mutant embryos. Genes Dev. 7, 1436–1446. Yabe, T., Ge, X., Lindeman, R., Nair, S., Runke, G., Mullins, M., Pelegri, F., 2009. The Tanner, N.K., Linder, P., 2001. DExD/H box RNA helicases: from generic motors to maternal-effect gene cellular island encodes Aurora B kinase and is essential for specific dissociation functions. Mol. Cell 8, 251–262. furrow formation in the early zebrafish embryo. PLoS Genet. 5, e1000518. Theusch, E.V., Brown, K.J., Pelegri, F., 2006. Separate pathways of RNA recruitment lead Yang, L., Lin, C., Liu, Z.-R., 2006. P68 RNA helicase mediates PDGF-induced epithelial to the compartmentalization of the zebrafish germ plasm. Dev. Biol. 292, 129–141. mesenchymal transition by displacing Axin from ß-catenin. Cell 127, 139–155. Thisse, C., Thisse, B., Schilling, T.F., Postlethwait, J.H., 1993. Structure of the zebrafish Yang, C.-T., Hindes, A.E., Hultman, K.A., Johnson, S.L., 2007. Mutations in gfpt1 and snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. skiv2l2 cause distinct stage-specific defects in larval melanocyte regeneration in Development 119, 1203–1215. zebrafish. PLoS Genet. 3, e88. Thisse, B., Heyer, V., Lux, A., Alunni, V., Degrave, A., Seiliez, I., Kirchner, J., Parkhill, J.P., Yean, S.L., Lin, R.J., 1991. U4 small nuclear RNA dissociates from a yeast spliceosome and Thisse, C., 2004. Spatial and temporal expression of the zebrafish genome by large- does not participate in the subsequent splicing reaction. Mol. Cell. Biol. 11, scale in situ hybridization screening. Methods Cell Biol. 77, 505–519. 5571–5577. Tijsterman, M., Ketting, R.F., Okihara, K.L., Sijen, T., Plasterk, R.H.A., 2002. RNA helicase Yeo, C.-Y., Whitman, M., 2001. Nodal signals to Smads through Cripto-dependent and MUT-14-dependent gene silencing triggered in C. elegans by short antisense RNAs. Cripto-independent mechanisms. Mol. Cell 7, 949–957. Science 295, 694–697. Zhang, B., Gallegos, M., Puoti, A., Durkin, E., Fields, S., Kimble, J., Wickens, M.P., 1997. A Toyama, R., O'Connell, M.L., Wright, C.V.E., Kuehn, M.R., Dawid, I., 1995. Nodal induces conserved RNA-binding protein that regulates sexual fates in the C. elegans ectopic goosecoid and lim1 expression and axis duplication in zebrafish. hermaphrodite germ line. Nature 390, 477–484. Development 121, 383–391. Zhang, J., Talbot, W.S., Schier, A.F., 1998. Positional cloning identifies zebrafish one-eye Vardy, L., Orr-Weaver, T.L., 2007. Regulating translation of maternal messages: multiple pinhead as a permissive EGF-related ligand required during gastrulation. Cell 92, repression mechanisms. Trends Cell Biol. 17, 547–554. 241–251.