DOCSLIB.ORG

The Zebrafish Maternal-Effect Gene Mission Impossible Encodes the DEAH-Box Helicase Dhx16 and Is Essential for the Expression of Downstream Endodermal Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Zebrafish Maternal-Effect Gene Mission Impossible Encodes the DEAH-Box Helicase Dhx16 and Is Essential for the Expression of Downstream Endodermal Genes Developmental Biology 353 (2011) 275–289 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology The zebrafish maternal-effect gene mission impossible encodes the DEAH-box helicase Dhx16 and is essential for the expression of downstream endodermal genes Emily Putiri, Francisco Pelegri ⁎ Laboratory of Genetics, University of Wisconsin, Madison, 425-G Henry Mall, Madison, WI 53706, USA article info abstract Article history: Early animal embryonic development requires maternal products that drive developmental processes prior to Received for publication 24 May 2010 the activation of the zygotic genome at the mid-blastula transition. During and after this transition, maternal Revised 26 January 2011 products may continue to act within incipient zygotic developmental programs. Mechanisms that control Accepted 1 March 2011 maternally-inherited products to spatially and temporally restrict developmental responses remain poorly Available online 9 March 2011 understood, but necessarily depend on posttranscriptional regulation. We report the functional analysis and molecular identification of the zebrafish maternal-effect gene mission impossible (mis). Our studies suggest Keywords: Zebrafish gastrulation requirements for maternally-derived mis function in events that occur during gastrulation, including cell Maternal-effect gene movement and the activation of some endodermal target genes. Cell transplantation experiments show that the Mission impossible/dhx16 cell movement defect is cell autonomous. Within the endoderm induction pathway, mis is not required for the DEAH-box helicase activation of early zygotic genes, but is essential to implement nodal activity downstream of casanova/sox 32 Endoderm induction but upstream of sox17 expression. Activation of nodal signaling in blastoderm explants shows that the Nodal signaling requirement for mis function in endoderm gene induction is independent of the underlying yolk cell. Positional cloning of mis, including genetic rescue and complementation analysis, shows that it encodes the DEAH-box RNA helicase Dhx16, shown in other systems to act in RNA regulatory processes such as splicing and translational control. Analysis of a previously identified insertional dhx16 mutation shows that the zygotic component of this gene is also essential for embryonic viability. Our studies provide a striking example of the interweaving of maternal and zygotic genetic functions during the egg-to-embryo transition. Maternal RNA helicases have long been known to be involved in the development of the animal germ line, but our findings add to growing evidence that these factors may also control specific gene expression programs in somatic tissues. © 2011 Elsevier Inc. All rights reserved. Introduction spatial control is particularly relevant for those genes whose products may be inherited maternally but whose actions do not occur until Prior to the activation of the zygotic genome at the midblastula later stages of development, for example, those acting during or after transition, early animal development depends solely on maternal the midblastula transition. factors expressed during oogenesis and stored in the egg (Newport While posttranscriptional mechanisms are used as a general and Kirschner, 1982a, 1982b). Such factors are essential to drive early means of gene regulation, there are an increasing number of examples cellular and developmental programs before transcription from in which dedicated posttranscriptional events convey developmental zygotic genes ensues. Even after zygotic gene activation, some specificity. For example, although upon fertilization the bulk of perduring maternal factors continue to be required for developmental Xenopus transcripts are activated for translation by becoming processes (Putiri and Pelegri, 2008). polyadenylated, a subset of transcripts are activated by poly(A)- Maternal factors can be stored in the egg as proteins, mRNAs, or independent mechanisms (Vardy and Orr-Weaver, 2007). In a second other biomolecules. A crucial issue for the developing embryo is how example, subcellular localization of maternally-derived germ plasm to properly regulate the temporal and/or spatial activity of such mRNAs and their specific stabilization are instrumental in the factors after they are produced during oogenesis, both throughout the activation of the germ cell program (Kloc and Etkin, 2005; Cinalli remainder of oogenesis and in early embryogenesis. In the case of et al., 2008; Lipshitz and Smibert, 2000; Rajyaguru and Parker, 2009). maternally inherited mRNAs, such regulation involves posttranscrip- A third case of selectivity in developmental targets occurs towards the tional control. The importance of posttranscriptional temporal and end of the period of maternal control during embryogenesis, at the midblastula transition, when maternally-derived factors are involved in the degradation of many maternally-derived mRNAs (Giraldez ⁎ Corresponding author at: 425-G Henry Mall, Rm. 2424, Madison, WI 53706, USA. Fax: +1 608 262 2976. et al., 2006; Ferg et al., 2007). In spite of these and other known E-mail address: [email protected] (F. Pelegri). examples, the role of posttranscriptional regulation during early 0012-1606/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2011.03.001 276 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 vertebrate development remains poorly understood. In particular, an Materials and methods important unanswered question is to what extent specific posttran- scriptional networks are involved in cell fate determination and Fish maintenance morphogenetic events within somatic tissues and the establishment of the basic embryonic body plan. Stocks of wild-type AB and mis/dhx16 lines were maintained under A primary event in the definition of the animal embryo is standard conditions at 28.5° (Brand et al., 2002). Fish homozygous gastrulation, the process that generates the three embryonic germ for the mist792 allele were identified by genotyping the flanking SSLP layers, the ectoderm, mesoderm and endoderm. In teleost fish, this markers z9189 using primers TCCAGGTTTGCGTGTGATAG and CCAG- process is additionally coordinated with epiboly, where the cells of TGTGAAACCCGAGAAT and z9746 using primers CCTTTCTGTTCATG- the blastula migrate towards the vegetal pole of the embryo until CCCTTC and ATGTGGGAATGGAAGTGAGC. Maternally mutant embryos the yolk is completely engulfed by cellular layers (Kimmel et al., were obtained by crossing homozygous mis females to AB males. 1990, 1995). Fate map studies have shown that the internal two Heterozygous carriers for the dhx16hi4049 allele were identified through layers originate from a population of bipotential cells, the incrosses that led to the necrosis phenotype in one quarter of the mesendoderm, initially present at the embryonic margin, as it embryos. All embryos were collected and developed in E3 embryonic moves towards the vegetal pole during epiboly (Kimmel et al., medium (Pelegri and Schulte-Merker, 1999) and were staged accord- 1990; Warga and Nüsslein-Volhard, 1999; Montero et al., 2005; ing to the age and morphological standards described in Kimmel et al., Keller et al., 2008). During gastrulation, marginal cells are 1995. internalized, become committed to unipotential cell fates, and acquire characteristic morphologies and positions: endodermal Isolation and genotyping of genomic DNA precursor cells flatten and adhere tightly to the yolk cell, while mesodermal precursors maintain a mesenchymal morphology Fish were anesthetized with MESAB (0.014%) and the tail fin was within an intermediately located layer (Warga and Nüsslein- clipped by razor blade and placed into DNA lysis buffer (10 mM Tris, Volhard, 1999). pH 8.0; 10 mM EDTA, pH 8.0; 200 mM NaCl; 1% Triton X-100; 0.05 μg Induction of the mesendoderm has been shown to be dependent proteinase K). Tissue lysates were incubated overnight at 55 °C, and on the activity of the nodal signaling pathway. Genetic analysis has prior to PCR, lysates were incubated at 95 °C for 10 min to inactivate shown that two zygotic genes of the nodal family of TGFß ligands, proteinase K. For bulk segregation analysis, the DNA concentration of squint and cyclops, become activated at the embryonic margin each lysate was measured and dilutions were made for a 4 ng/μl stock. during embryogenesis and are redundantly required for the For general genotyping, lysates were used directly without dilution, activation of the mesendoderm (Feldman et al., 1998; Gritsman and 1 μl of lysate was used per 20 μl PCR reaction. For each 10 μl PCR, et al., 1999). These nodal factors signal through the Activin type I 1 μl of Hot Start Buffer, 0.2 μl of dNTPs, 0.05 μl of Hot Start Taq receptor, Taram-A (Renucci et al., 1996; Peyriéras et al., 1998; polymerase (Eppendorf), and 10 ng genomic DNA, and 5 μlof5μM Alexander and Stainier, 1999; Aoki et al., 2002b)andtheEGF-CFC primer were used. PCR products were analyzed on a 2% high- co-receptor One-eye pinhead (Oep) (Zhang et al., 1998; Gritsman resolution agarose gel. et al., 1999; Yeo and Whitman, 2001;reviewedinSchier and Talbot, 2005). Activation of nodal signaling results in the phosphorylation Cloning of mission impossible and nuclear translocation of the transcription factor Smad2 in complex with Smad4 (Nomura and Li, 1998; Weinstein et al., 1998; The clone containing dhx16 cDNA, accession # BC045393, was Jia et al., 2008). Within the nucleus, the Smad complex
Load more

Recommended publications
  • Structural Basis for DEAH-Helicase Activation by G-Patch Proteins
    Structural basis for DEAH-helicase activation by G-patch proteins Michael K. Studera, Lazar Ivanovica, Marco E. Webera, Sabrina Martia, and Stefanie Jonasa,1 aInstitute of Molecular Biology and Biophysics, Department of Biology, Swiss Federal Institute of Technology (ETH) Zürich, 8093 Zürich, Switzerland Edited by Joseph D. Puglisi, Stanford University School of Medicine, Stanford, CA, and approved February 21, 2020 (received for review August 12, 2019) RNA helicases of the DEAH/RHA family are involved in many essential RNA bases are stacked in the RNA binding channel between a long cellular processes, such as splicing or ribosome biogenesis, where β-hairpin in RecA2 (β14 to β15 in hsDHX15/scPrp43; SI Appendix, they remodel large RNA–protein complexes to facilitate transitions Fig. S1) and a conserved loop in RecA1 (termed “Hook-turn”). to the next intermediate. DEAH helicases couple adenosine tri- This means that during progression into the open state, the phosphate (ATP) hydrolysis to conformational changes of their β-hairpin and two other RNA-binding patches in RecA2 (termed catalytic core. This movement results in translocation along RNA, “Hook-loop” and “motif V”; SI Appendix, Fig. S1) have to shift 1 which is held in place by auxiliary C-terminal domains. The activity nucleotide (nt) toward the 5′ end of the RNA. Thus, when the of DEAH proteins is strongly enhanced by the large and diverse RecA domains close back up, at the start of the next hydrolysis class of G-patch activators. Despite their central roles in RNA me- cycle, the RNA is pushed by 1 nt through the RNA channel.
    [Show full text]
  • “The Impact of ART on Genome‐Wide Oxidation of 5‐Methylcytosine and the Transcriptome During Early Mouse Development”
    “The impact of ART on genome‐wide oxidation of 5‐methylcytosine and the transcriptome during early mouse development” Dissertation zur Erlangung des Grades “Doktor der Naturwissenschaften” am Fachbereich Biologie der Johannes Gutenberg-Universität Mainz Elif Diken geb. Söğütcü geb. am 22.07.1987 in Giresun-TURKEY Mainz 2016 Dekan: 1. Berichterstatter: 2. Berichterstatter: Tag der mündlichen Prüfung: Summary Summary The use of assisted reproductive technologies (ART) has been increasing over the past three decades due to the elevated frequency of infertility problems. Other factors such as easier access to medical aid than in the past and its coverage by health insurance companies in many developed countries also contributed to this growing interest. Nevertheless, a negative impact of ART on transcriptome and methylation reprogramming is heavily discussed. Methylation reprogramming directly after fertilization manifests itself as genome-wide DNA demethylation associated with the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) in the pronuclei of mouse zygotes. To investigate the possible impact of ART particularly on this process and the transcriptome in general, pronuclear stage mouse embryos obtained upon spontaneous ovulation or superovulation through hormone stimulation representing ART were subjected to various epigenetic analyses. A whole- transcriptome RNA-Seq analysis of pronuclear stage embryos from spontaneous and superovulated matings demonstrated altered expression of the Bbs12 gene known to be linked to Bardet-Biedl syndrome (BBS) as well as the Dhx16 gene whose zebrafish ortholog was reported to be a maternal effect gene. Immunofluorescence staining with antibodies against 5mC and 5hmC showed that pronuclear stage embryos obtained by superovulation have an increased incidence of abnormal methylation and hydroxymethylation patterns in both maternal and paternal pronuclear DNA compared to their spontaneously ovulated counterparts.
    [Show full text]
  • DHX16 (NM 003587) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP302912 DHX16 (NM_003587) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human DEAH (Asp-Glu-Ala-His) box polypeptide 16 (DHX16) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 119.1 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_003578 Locus ID: 8449 UniProt ID: O60231, Q5SQH4 RefSeq Size: 3477 Cytogenetics: 6p21.33 RefSeq ORF: 3126 Synonyms: DBP2; DDX16; NMOAS; PRO2014; Prp2; PRP8; PRPF2 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 DHX16 (NM_003587) Human Recombinant Protein – TP302912 Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly.
    [Show full text]
  • Mrna Editing, Processing and Quality Control in Caenorhabditis Elegans
    | WORMBOOK mRNA Editing, Processing and Quality Control in Caenorhabditis elegans Joshua A. Arribere,*,1 Hidehito Kuroyanagi,†,1 and Heather A. Hundley‡,1 *Department of MCD Biology, UC Santa Cruz, California 95064, †Laboratory of Gene Expression, Medical Research Institute, Tokyo Medical and Dental University, Tokyo 113-8510, Japan, and ‡Medical Sciences Program, Indiana University School of Medicine-Bloomington, Indiana 47405 ABSTRACT While DNA serves as the blueprint of life, the distinct functions of each cell are determined by the dynamic expression of genes from the static genome. The amount and specific sequences of RNAs expressed in a given cell involves a number of regulated processes including RNA synthesis (transcription), processing, splicing, modification, polyadenylation, stability, translation, and degradation. As errors during mRNA production can create gene products that are deleterious to the organism, quality control mechanisms exist to survey and remove errors in mRNA expression and processing. Here, we will provide an overview of mRNA processing and quality control mechanisms that occur in Caenorhabditis elegans, with a focus on those that occur on protein-coding genes after transcription initiation. In addition, we will describe the genetic and technical approaches that have allowed studies in C. elegans to reveal important mechanistic insight into these processes. KEYWORDS Caenorhabditis elegans; splicing; RNA editing; RNA modification; polyadenylation; quality control; WormBook TABLE OF CONTENTS Abstract 531 RNA Editing and Modification 533 Adenosine-to-inosine RNA editing 533 The C. elegans A-to-I editing machinery 534 RNA editing in space and time 535 ADARs regulate the levels and fates of endogenous dsRNA 537 Are other modifications present in C.
    [Show full text]
  • Lecture 15. Chromhmm & ENCODE
    Lecture 15. ChromHMM & ENCODE Michael Schatz March 23, 2020 JHU 601.749: Applied Comparative Genomics Assignment 5: Due Mon Mar 23 Project Proposal: Due Mon Mar 23 *-seq in 4 short vignettes RNA-seq Methyl-seq ChIP-seq Hi-C Human Evolution ~5 Mya ~75 Mya ~100 Mya ~160 and 210 Mya As expected, the majority of platypus genes (82%; 15,312 out of 18,596) have orthologues in these five other amniotes (Supplementary Table 5). The remaining 'orphan' genes are expected to primarily reflect rapidly evolving genes, for which no other homologues are discernible, erroneous predictions, and true lineage-specific genes that have been lost in each of the other five species under consideration. Genome analysis of the platypus reveals unique signatures of evolution (2008) Nature. 453, 175-183 doi:10.1038/nature06936 Methyl-seq Finding the fifth base: Genome-wide sequencing of cytosine methylation Lister and Ecker (2009) Genome Research. 19: 959-966 Bisulfite Conversion Treating DNA with sodium bisulfite will convert unmethylated C to T • 5-MethyC will be protected and not change, so can look for differences when mapping • Requires great care when analyzing reads, since the complementary strand will also be converted (G to A) • Typically analyzed by mapping to a “reduced alphabet” where we assume all Cs are converted to Ts once on the forward strand and once on the reverse Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications Krueger and Andrews (2010) Bioinformatics. 27 (11): 1571-1572. ChIP-seq Genome-wide mapping of in vivo protein-DNA interactions. Johnson et al (2007) Science.
    [Show full text]
  • Genome-Wide Investigation of Cellular Functions for Trna Nucleus
    Genome-wide Investigation of Cellular Functions for tRNA Nucleus- Cytoplasm Trafficking in the Yeast Saccharomyces cerevisiae DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Hui-Yi Chu Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2012 Dissertation Committee: Anita K. Hopper, Advisor Stephen Osmani Kurt Fredrick Jane Jackman Copyright by Hui-Yi Chu 2012 Abstract In eukaryotic cells tRNAs are transcribed in the nucleus and exported to the cytoplasm for their essential role in protein synthesis. This export event was thought to be unidirectional. Surprisingly, several lines of evidence showed that mature cytoplasmic tRNAs shuttle between nucleus and cytoplasm and their distribution is nutrient-dependent. This newly discovered tRNA retrograde process is conserved from yeast to vertebrates. Although how exactly the tRNA nuclear-cytoplasmic trafficking is regulated is still under investigation, previous studies identified several transporters involved in tRNA subcellular dynamics. At least three members of the β-importin family function in tRNA nuclear-cytoplasmic intracellular movement: (1) Los1 functions in both the tRNA primary export and re-export processes; (2) Mtr10, directly or indirectly, is responsible for the constitutive retrograde import of cytoplasmic tRNA to the nucleus; (3) Msn5 functions solely in the re-export process. In this thesis I focus on the physiological role(s) of the tRNA nuclear retrograde pathway. One possibility is that nuclear accumulation of cytoplasmic tRNA serves to modulate translation of particular transcripts. To test this hypothesis, I compared expression profiles from non-translating mRNAs and polyribosome-bound translating mRNAs collected from msn5Δ and mtr10Δ mutants and wild-type cells, in fed or acute amino acid starvation conditions.
    [Show full text]
  • Learning Chroma\N States from Chip-‐Seq Data
    Learning Chroman States from ChIP-seq data Luca Pinello GC Yuan Lab Outline • Chroman structure, histone modificaons and combinatorial paerns • How to segment the genome in chroman states • How to use ChromHMM step by step • Further references 2 Epigene-cs and chroman structure • All (almost) the cells of our body share the same genome but have very different gene expression programs…. 3 h?p://jpkc.scu.edu.cn/ywwy/zbsw(E)/edetail12.htm The code over the code • The chroman structure and the accessibility are mainly controlled by: 1. Nucleosome posioning, 2. DNA methylaon, 3. Histone modificaons. 4 Histone Modificaons Specific histone modificaons or combinaons of modificaons confer unique biological func-ons to the region of the genome associated with them: • H3K4me3: promoters, gene acva.on • H3K27me3: promoters, poised enhancers, gene silencing • H2AZ: promoters • H3K4me1: enhancers • H3K36me3: transcribed regions • H3K9me3: gene silencing • H3k27ac: acve enhancers 5 Examples of *-Seq Measuring the genome genome fragmentation assembler DNA DNA reads “genome” ChIP-seq to measure histone data fragments Measuring the regulome (e.g., protein-binding of the genome) Chromatin Immunopreciptation genomic (ChIP) + intervals fragmentation Protein - peak caller bound by DNA bound DNA reads proteins REVIEWS fragments a also informative, as this ratio corresponds to the fraction ChIP–chip of nucleosomes with the particular modification at that location, averaged over all the cells assayed. One of the difficulties in conducting a ChIP–seq con- trol experiment is the large amount of sequencing that ChIP–seq may be necessary. For input DNA and bulk nucleosomes, many of the sequenced tags are spread evenly across the genome.
    [Show full text]
  • DEAH)/RNA Helicase a Helicases Sense Microbial DNA in Human Plasmacytoid Dendritic Cells
    Aspartate-glutamate-alanine-histidine box motif (DEAH)/RNA helicase A helicases sense microbial DNA in human plasmacytoid dendritic cells Taeil Kima, Shwetha Pazhoora, Musheng Baoa, Zhiqiang Zhanga, Shino Hanabuchia, Valeria Facchinettia, Laura Bovera, Joel Plumasb, Laurence Chaperotb, Jun Qinc, and Yong-Jun Liua,1 aDepartment of Immunology, Center for Cancer Immunology Research, University of Texas M. D. Anderson Cancer Center, Houston, TX 77030; bDepartment of Research and Development, Etablissement Français du Sang Rhône-Alpes Grenoble, 38701 La Tronche, France; and cDepartment of Biochemistry, Baylor College of Medicine, Houston, TX 77030 Edited by Ralph M. Steinman, The Rockefeller University, New York, NY, and approved July 14, 2010 (received for review May 10, 2010) Toll-like receptor 9 (TLR9) senses microbial DNA and triggers type I Microbial nucleic acids, including their genomic DNA/RNA IFN responses in plasmacytoid dendritic cells (pDCs). Previous and replicating intermediates, work as strong PAMPs (13), so studies suggest the presence of myeloid differentiation primary finding PRR-sensing pathogenic nucleic acids and investigating response gene 88 (MyD88)-dependent DNA sensors other than their signaling pathway is of general interest. Cytosolic RNA is TLR9 in pDCs. Using MS, we investigated C-phosphate-G (CpG)- recognized by RLRs, including RIG-I, melanoma differentiation- binding proteins from human pDCs, pDC-cell lines, and interferon associated gene 5 (MDA5), and laboratory of genetics and physi- regulatory factor 7 (IRF7)-expressing B-cell lines. CpG-A selectively ology 2 (LGP2). RIG-I senses 5′-triphosphate dsRNA and ssRNA bound the aspartate-glutamate-any amino acid-aspartate/histi- or short dsRNA with blunt ends.
    [Show full text]
  • On the Relationship of Protein and Mrna Dynamics in Vertebrate Embryonic Development
    Resource On the Relationship of Protein and mRNA Dynamics in Vertebrate Embryonic Development Graphical Abstract Authors Leonid Peshkin, Martin Wu¨ hr, Esther Pearl, ..., Marko Horb, Steven P. Gygi, Marc W. Kirschner Correspondence [email protected] (S.P.G.), [email protected] (M.W.K.) In Brief Embryos express proteins at the correct time during development, by balancing the maternal contribution with protein synthesis and degradation. Peshkin et al. determine the absolute concentrations of 10,000 proteins and 28,000 transcripts across Xenopus development, uncovering the relative roles of these three processes across the proteome and revealing global trends. Highlights Accession Numbers d A genome-scale resource of mRNA and protein expression GSE73905 for vertebrate embryogenesis GSE73870 PXD002349 d Temporal patterns of change in mRNA and protein abundance are poorly correlated d A simple kinetic model explains protein expression as a function of mRNA levels d Embryogenesis is driven by maternal protein dowry and tissue-specific transcription Peshkin et al., 2015, Developmental Cell 35, 383–394 November 9, 2015 ª2015 Elsevier Inc. http://dx.doi.org/10.1016/j.devcel.2015.10.010 Developmental Cell Resource On the Relationship of Protein and mRNA Dynamics in Vertebrate Embryonic Development Leonid Peshkin,1,5 Martin Wu¨ hr,1,2,5 Esther Pearl,3 Wilhelm Haas,2 Robert M. Freeman, Jr.,1 John C. Gerhart,4 Allon M. Klein,1 Marko Horb,3 Steven P. Gygi,2,* and Marc W. Kirschner1,* 1Department of Systems Biology 2Department of Cell Biology Harvard Medical School, Boston, MA 02115, USA 3National Xenopus Resource, Marine Biological Laboratory, Woods Hole, MA 02543, USA 4Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, CA 96704, USA 5Co-first author *Correspondence: [email protected] (S.P.G.), [email protected] (M.W.K.) http://dx.doi.org/10.1016/j.devcel.2015.10.010 SUMMARY abundance may also not be the whole story: posttranslational modifications may provide crucial regulatory input.
    [Show full text]
  • Supplemental Material.Pdf
    Supplementary Material for “A New Class of Temporarily Phenotypic Enhancers Identified by CRISPR/Cas9 Mediated Genetic Screening “ Yarui Diao, Bin Li, Zhipeng Meng, Inkyung Jung, Ah Young Lee, Jesse Dixon, Lenka Maliskova, Kun-liang Guan, Yin Shen, and Bing Ren 1. Supplementary Methods 2. Supplementary Figures Fig. S1. Experimental design. Fig. S2. The number and quality score of positive hit called from screenings. Fig. S3. Characterization of regulatory elements identified by lentiCRISPR screening. Fig. S4. Characterization of bi-allelic mutants. Fig. S5. Representative FACS plots for clonal characterization of eGFP levels. Fig. S6. Characterization of pluripotency and differentiation potentials of clones with temp enhancer deletion. Fig. S7. Genotype information for mono-allelic mutant clones. Fig. S8. Temp enhancers are bound by multiple TFs. Fig. S9. Conservation study of identified regulatory elements, and characterization of the pluripotent and differentiation properties of KO clones. 3. Supplementary Tables Table S1. A list of candidate regulatory regions (hg18) surveyed in this study. Table S2. A list of sgRNA library sequences designed for lentiCRISPR screening. Table S3. Data analysis of CRISPR/Cas9 screening experiments. We first identified sgRNA candidates that are enriched in eGFP- population by meeting the criteria of (a) each sgRNA should have a sequencing coverage of 50 reads and (b) each sgRNA should have at least two fold enrichment in eGFP- population. We then generated the high confident elements that control POU5F1 expression if they are at least supported by the enrichment two sgRNAs targeting the same elements in three different experiments. 1. Supplementary Methods Array oligo synthesis and pooled library cloning The oligo pool were amplified with primers with 15 bp overlap with BbsI cutting site in LentiCRISPR plasmid: F: AAAGGACGAAACACC R: TTCTAGCTCTAAAAC The PCR product was size selected and gel-purified with NucleoSpin Gel and PCR Clean-Up Kit (Clontech, Cat# 740609), followed by In-fusion cloning (Clontech, Cat# 638909).
    [Show full text]
  • Accurate Prediction of Kinase-Substrate Networks Using
    bioRxiv preprint doi: https://doi.org/10.1101/865055; this version posted December 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Accurate Prediction of Kinase-Substrate Networks Using Knowledge Graphs V´ıtNov´aˇcek1∗+, Gavin McGauran3, David Matallanas3, Adri´anVallejo Blanco3,4, Piero Conca2, Emir Mu~noz1,2, Luca Costabello2, Kamalesh Kanakaraj1, Zeeshan Nawaz1, Sameh K. Mohamed1, Pierre-Yves Vandenbussche2, Colm Ryan3, Walter Kolch3,5,6, Dirk Fey3,6∗ 1Data Science Institute, National University of Ireland Galway, Ireland 2Fujitsu Ireland Ltd., Co. Dublin, Ireland 3Systems Biology Ireland, University College Dublin, Belfield, Dublin 4, Ireland 4Department of Oncology, Universidad de Navarra, Pamplona, Spain 5Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland 6School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland ∗ Corresponding authors ([email protected], [email protected]). + Lead author. 1 bioRxiv preprint doi: https://doi.org/10.1101/865055; this version posted December 4, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Phosphorylation of specific substrates by protein kinases is a key control mechanism for vital cell-fate decisions and other cellular pro- cesses. However, discovering specific kinase-substrate relationships is time-consuming and often rather serendipitous.
    [Show full text]
  • Supporting Information
    Supporting Information Poulogiannis et al. 10.1073/pnas.1009941107 SI Materials and Methods Loss of Heterozygosity (LOH) Analysis of PARK2. Seven microsatellite Bioinformatic Analysis of Genome and Transcriptome Data. The markers (D6S1550, D6S253, D6S305, D6S955, D6S980, D6S1599, aCGH package in R was used to identify significant DNA copy and D6S396) were amplified for LOH analysis within the PARK2 number (DCN) changes in our collection of 100 sporadic CRCs locus using primers that were previously described (8). (1) (Gene Expression Omnibus, accession no. GSE12520). The MSP of the PARK2 Promoter. CpG sites within the PARK2 promoter aCGH analysis of cell lines and liver metastases was derived region were detected using the Methprimer software (http://www. from published data (2, 3). Chromosome 6 tiling-path array- urogene.org/methprimer/index.html). Methylation-specificand CGH was used to identify the smallest and most frequently al- control primers were designed using the Primo MSP software tered regions of DNA copy number change on chromosome 6. (http://www.changbioscience.com/primo/primom.html); bisulfite An integrative approach was used to correlate expression pro- modification of genomic DNA was performed as described pre- files with genomic copy number data from a SNP array from the viously (9). All tumor DNA samples from primary CRC tumors same tumors (n = 48) (4) (GSE16125), using Pearson’s corre- (n = 100) and CRC lines (n = 5), as well as those from the leukemia lation coefficient analysis to identify the relationships between cell lines KG-1a (acute myeloid leukemia, AML), U937 (acute DNA copy number changes and gene expression of those genes lymphoblastic leukemia, ALL), and Raji (Burkitt lymphoma, BL) SssI located within the small frequently altered regions of DCN were screened as part of this analysis.
    [Show full text]