Developmental Biology 353 (2011) 275–289 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology The zebrafish maternal-effect gene mission impossible encodes the DEAH-box helicase Dhx16 and is essential for the expression of downstream endodermal genes Emily Putiri, Francisco Pelegri ⁎ Laboratory of Genetics, University of Wisconsin, Madison, 425-G Henry Mall, Madison, WI 53706, USA article info abstract Article history: Early animal embryonic development requires maternal products that drive developmental processes prior to Received for publication 24 May 2010 the activation of the zygotic genome at the mid-blastula transition. During and after this transition, maternal Revised 26 January 2011 products may continue to act within incipient zygotic developmental programs. Mechanisms that control Accepted 1 March 2011 maternally-inherited products to spatially and temporally restrict developmental responses remain poorly Available online 9 March 2011 understood, but necessarily depend on posttranscriptional regulation. We report the functional analysis and molecular identification of the zebrafish maternal-effect gene mission impossible (mis). Our studies suggest Keywords: Zebrafish gastrulation requirements for maternally-derived mis function in events that occur during gastrulation, including cell Maternal-effect gene movement and the activation of some endodermal target genes. Cell transplantation experiments show that the Mission impossible/dhx16 cell movement defect is cell autonomous. Within the endoderm induction pathway, mis is not required for the DEAH-box helicase activation of early zygotic genes, but is essential to implement nodal activity downstream of casanova/sox 32 Endoderm induction but upstream of sox17 expression. Activation of nodal signaling in blastoderm explants shows that the Nodal signaling requirement for mis function in endoderm gene induction is independent of the underlying yolk cell. Positional cloning of mis, including genetic rescue and complementation analysis, shows that it encodes the DEAH-box RNA helicase Dhx16, shown in other systems to act in RNA regulatory processes such as splicing and translational control. Analysis of a previously identified insertional dhx16 mutation shows that the zygotic component of this gene is also essential for embryonic viability. Our studies provide a striking example of the interweaving of maternal and zygotic genetic functions during the egg-to-embryo transition. Maternal RNA helicases have long been known to be involved in the development of the animal germ line, but our findings add to growing evidence that these factors may also control specific gene expression programs in somatic tissues. © 2011 Elsevier Inc. All rights reserved. Introduction spatial control is particularly relevant for those genes whose products may be inherited maternally but whose actions do not occur until Prior to the activation of the zygotic genome at the midblastula later stages of development, for example, those acting during or after transition, early animal development depends solely on maternal the midblastula transition. factors expressed during oogenesis and stored in the egg (Newport While posttranscriptional mechanisms are used as a general and Kirschner, 1982a, 1982b). Such factors are essential to drive early means of gene regulation, there are an increasing number of examples cellular and developmental programs before transcription from in which dedicated posttranscriptional events convey developmental zygotic genes ensues. Even after zygotic gene activation, some specificity. For example, although upon fertilization the bulk of perduring maternal factors continue to be required for developmental Xenopus transcripts are activated for translation by becoming processes (Putiri and Pelegri, 2008). polyadenylated, a subset of transcripts are activated by poly(A)- Maternal factors can be stored in the egg as proteins, mRNAs, or independent mechanisms (Vardy and Orr-Weaver, 2007). In a second other biomolecules. A crucial issue for the developing embryo is how example, subcellular localization of maternally-derived germ plasm to properly regulate the temporal and/or spatial activity of such mRNAs and their specific stabilization are instrumental in the factors after they are produced during oogenesis, both throughout the activation of the germ cell program (Kloc and Etkin, 2005; Cinalli remainder of oogenesis and in early embryogenesis. In the case of et al., 2008; Lipshitz and Smibert, 2000; Rajyaguru and Parker, 2009). maternally inherited mRNAs, such regulation involves posttranscrip- A third case of selectivity in developmental targets occurs towards the tional control. The importance of posttranscriptional temporal and end of the period of maternal control during embryogenesis, at the midblastula transition, when maternally-derived factors are involved in the degradation of many maternally-derived mRNAs (Giraldez ⁎ Corresponding author at: 425-G Henry Mall, Rm. 2424, Madison, WI 53706, USA. Fax: +1 608 262 2976. et al., 2006; Ferg et al., 2007). In spite of these and other known E-mail address: [email protected] (F. Pelegri). examples, the role of posttranscriptional regulation during early 0012-1606/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2011.03.001 276 E. Putiri, F. Pelegri / Developmental Biology 353 (2011) 275–289 vertebrate development remains poorly understood. In particular, an Materials and methods important unanswered question is to what extent specific posttran- scriptional networks are involved in cell fate determination and Fish maintenance morphogenetic events within somatic tissues and the establishment of the basic embryonic body plan. Stocks of wild-type AB and mis/dhx16 lines were maintained under A primary event in the definition of the animal embryo is standard conditions at 28.5° (Brand et al., 2002). Fish homozygous gastrulation, the process that generates the three embryonic germ for the mist792 allele were identified by genotyping the flanking SSLP layers, the ectoderm, mesoderm and endoderm. In teleost fish, this markers z9189 using primers TCCAGGTTTGCGTGTGATAG and CCAG- process is additionally coordinated with epiboly, where the cells of TGTGAAACCCGAGAAT and z9746 using primers CCTTTCTGTTCATG- the blastula migrate towards the vegetal pole of the embryo until CCCTTC and ATGTGGGAATGGAAGTGAGC. Maternally mutant embryos the yolk is completely engulfed by cellular layers (Kimmel et al., were obtained by crossing homozygous mis females to AB males. 1990, 1995). Fate map studies have shown that the internal two Heterozygous carriers for the dhx16hi4049 allele were identified through layers originate from a population of bipotential cells, the incrosses that led to the necrosis phenotype in one quarter of the mesendoderm, initially present at the embryonic margin, as it embryos. All embryos were collected and developed in E3 embryonic moves towards the vegetal pole during epiboly (Kimmel et al., medium (Pelegri and Schulte-Merker, 1999) and were staged accord- 1990; Warga and Nüsslein-Volhard, 1999; Montero et al., 2005; ing to the age and morphological standards described in Kimmel et al., Keller et al., 2008). During gastrulation, marginal cells are 1995. internalized, become committed to unipotential cell fates, and acquire characteristic morphologies and positions: endodermal Isolation and genotyping of genomic DNA precursor cells flatten and adhere tightly to the yolk cell, while mesodermal precursors maintain a mesenchymal morphology Fish were anesthetized with MESAB (0.014%) and the tail fin was within an intermediately located layer (Warga and Nüsslein- clipped by razor blade and placed into DNA lysis buffer (10 mM Tris, Volhard, 1999). pH 8.0; 10 mM EDTA, pH 8.0; 200 mM NaCl; 1% Triton X-100; 0.05 μg Induction of the mesendoderm has been shown to be dependent proteinase K). Tissue lysates were incubated overnight at 55 °C, and on the activity of the nodal signaling pathway. Genetic analysis has prior to PCR, lysates were incubated at 95 °C for 10 min to inactivate shown that two zygotic genes of the nodal family of TGFß ligands, proteinase K. For bulk segregation analysis, the DNA concentration of squint and cyclops, become activated at the embryonic margin each lysate was measured and dilutions were made for a 4 ng/μl stock. during embryogenesis and are redundantly required for the For general genotyping, lysates were used directly without dilution, activation of the mesendoderm (Feldman et al., 1998; Gritsman and 1 μl of lysate was used per 20 μl PCR reaction. For each 10 μl PCR, et al., 1999). These nodal factors signal through the Activin type I 1 μl of Hot Start Buffer, 0.2 μl of dNTPs, 0.05 μl of Hot Start Taq receptor, Taram-A (Renucci et al., 1996; Peyriéras et al., 1998; polymerase (Eppendorf), and 10 ng genomic DNA, and 5 μlof5μM Alexander and Stainier, 1999; Aoki et al., 2002b)andtheEGF-CFC primer were used. PCR products were analyzed on a 2% high- co-receptor One-eye pinhead (Oep) (Zhang et al., 1998; Gritsman resolution agarose gel. et al., 1999; Yeo and Whitman, 2001;reviewedinSchier and Talbot, 2005). Activation of nodal signaling results in the phosphorylation Cloning of mission impossible and nuclear translocation of the transcription factor Smad2 in complex with Smad4 (Nomura and Li, 1998; Weinstein et al., 1998; The clone containing dhx16 cDNA, accession # BC045393, was Jia et al., 2008). Within the nucleus, the Smad complex