WES) and Bioinformatics Analysis
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
HNF6 Antibody (R31338)
HNF6 Antibody (R31338) Catalog No. Formulation Size R31338 0.5mg/ml if reconstituted with 0.2ml sterile DI water 100 ug Bulk quote request Availability 1-3 business days Species Reactivity Human, Mouse, Rat Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit IgG Purity Antigen affinity Buffer Lyophilized from 1X PBS with 2.5% BSA and 0.025% sodium azide/thimerosal UniProt Q9UBC0 Applications Western blot : 0.5-1ug/ml IHC (FFPE) : 0.5-1ug/ml IHC (Frozen) : 0.5-1ug/ml Immunocytochemistry : 0.5-1ug/ml Limitations This HNF6 antibody is available for research use only. Western blot testing of HNF6 antibody and Lane 1: rat liver; 2: mouse liver; 3: human HeLa cell lysate. Expected/observed size ~51KD IHC-P: HNF6 antibody testing of human liver cancer tissue ICC testing of HNF6 antibody and HCT116 cells IHC-F testing of rat liver tissue IHC-P testing of rat liver tissue Description One cut homeobox 1 (ONECUT1), also called Hepatocyte nuclear factor 6 (HNF6) is found strong expression in liver and lower expression in testis and skin. The gene encodes a member of the Cut homeobox family of transcription factors. Expression of the encoded protein is enriched in the liver, where it stimulates transcription of liver-expressed genes, and antagonizes glucocorticoid-stimulated gene transcription. This gene may influence a variety of cellular processes including glucose metabolism, cell cycle regulation, and it may also be associated with cancer. Application Notes The stated application concentrations are suggested starting amounts. Titration of the HNF6 antibody may be required due to differences in protocols and secondary/substrate sensitivity. -
Polymorphisms of the BARX1 and ADAMTS17 Locus Genes in Individuals with Gastroesophageal Reflux Disease
J Neurogastroenterol Motil, Vol. 25 No. 3 July, 2019 pISSN: 2093-0879 eISSN: 2093-0887 https://doi.org/10.5056/jnm18183 JNM Journal of Neurogastroenterology and Motility Original Article Polymorphisms of the BARX1 and ADAMTS17 Locus Genes in Individuals With Gastroesophageal Reflux Disease Alexandra Argyrou,1 Evangelia Legaki,1 Christos Koutserimpas,2 Maria Gazouli,1* Ioannis Papaconstantinou,3 George Gkiokas,3 and George Karamanolis4 1Department of Basic Medical Sciences, Laboratory of Biology, School of Medicine, National and Kapodistrian University of Athens, Athens, Greece; 22nd Department of General Surgery, “Sismanoglio General Hospital of Athens, Athens, Greece; 32nd Department of Surgery, School of Medicine, National and Kapodistrian University of Athens, Athens, Greece; and 4Gastroenterology Unit, 2nd Department of Surgery, School of Medicine, National and Kapodistrian University of Athens, Athens, Greece Background/Aims Gastroesophageal reflux disease (GERD) represents a common condition having a substantial impact on the patients’ quality of life, as well as the health system. According to many studies, the BARX1 and ADAMTS17 genes have been suggested as genetic risk loci for the development of GERD and its complications. The purpose of this study is to investigate the potential association between GERD and BARX1 and ADAMTS17 polymorphisms. Methods The present is a prospective cohort study of 160 GERD patients and 180 healthy control subjects of Greek origin, examined for BARX1 and ADAMTS17 polymorphisms (rs11789015 and rs4965272) and a potential correlation to GERD. Results The rs11789015 AG and GG genotypes were found to be significantly associated with GERD (P = 0.032; OR, 1.65; 95% CI, 1.06- 2.57 and P = 0.033; OR, 3.00; 95% CI, 1.15-7.82, respectively), as well as the G allele (P = 0.007; OR, 1.60; 95% CI, 1.14- 2.24). -
AN INVESTIGATION of the ROLE of PAK6 in TUMORIGENESIS By
AN INVESTIGATION OF THE ROLE OF PAK6 IN TUMORIGENESIS by JoAnn Roberts A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Medicine In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, Florida August 2012 ACKNOWLEDGMENTS This material is based upon work supported by the National Science Foundation under Grant No. DGE: 0638662. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation. I would like to thank and acknowledge my thesis advisor, Dr. Michael Lu, for his support and guidance throughout the writing of this thesis and design of experiments in this manuscript. I would also like to thank my colleagues for assistance in various trouble-shooting circumstances. Last, but certainly not least, I would like to thank my family and friends for their support in the pursuit of my graduate studies. iii ABSTRACT Author: JoAnn Roberts Title: An Investigation of the Role of PAK6 in Tumorigenesis Institution: Florida Atlantic University Thesis Advisor: Dr. Michael Lu Degree: Master of Science Year: 2012 The function and role of PAK6, a serine/threonine kinase, in cancer progression has not yet been clearly identified. Several studies reveal that PAK6 may participate in key changes contributing to cancer progression such as cell survival, cell motility, and invasiveness. Based on the membrane localization of PAK6 in prostate and breast cancer cells, we speculated that PAK6 plays a role in cancer progression cells by localizing on the membrane and modifying proteins linked to motility and proliferation. -
Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2
Supplementary Table 3 Complete list of RNA-Sequencing analysis of gene expression changed by ≥ tenfold between xenograft and cells cultured in 10%O2 Expr Log2 Ratio Symbol Entrez Gene Name (culture/xenograft) -7.182 PGM5 phosphoglucomutase 5 -6.883 GPBAR1 G protein-coupled bile acid receptor 1 -6.683 CPVL carboxypeptidase, vitellogenic like -6.398 MTMR9LP myotubularin related protein 9-like, pseudogene -6.131 SCN7A sodium voltage-gated channel alpha subunit 7 -6.115 POPDC2 popeye domain containing 2 -6.014 LGI1 leucine rich glioma inactivated 1 -5.86 SCN1A sodium voltage-gated channel alpha subunit 1 -5.713 C6 complement C6 -5.365 ANGPTL1 angiopoietin like 1 -5.327 TNN tenascin N -5.228 DHRS2 dehydrogenase/reductase 2 leucine rich repeat and fibronectin type III domain -5.115 LRFN2 containing 2 -5.076 FOXO6 forkhead box O6 -5.035 ETNPPL ethanolamine-phosphate phospho-lyase -4.993 MYO15A myosin XVA -4.972 IGF1 insulin like growth factor 1 -4.956 DLG2 discs large MAGUK scaffold protein 2 -4.86 SCML4 sex comb on midleg like 4 (Drosophila) Src homology 2 domain containing transforming -4.816 SHD protein D -4.764 PLP1 proteolipid protein 1 -4.764 TSPAN32 tetraspanin 32 -4.713 N4BP3 NEDD4 binding protein 3 -4.705 MYOC myocilin -4.646 CLEC3B C-type lectin domain family 3 member B -4.646 C7 complement C7 -4.62 TGM2 transglutaminase 2 -4.562 COL9A1 collagen type IX alpha 1 chain -4.55 SOSTDC1 sclerostin domain containing 1 -4.55 OGN osteoglycin -4.505 DAPL1 death associated protein like 1 -4.491 C10orf105 chromosome 10 open reading frame 105 -4.491 -
Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human. -
PIK3C2G (NM 004570) Human Mutant ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC402758 PIK3C2G (NM_004570) Human Mutant ORF Clone Product data: Product Type: Mutant ORF Clones Product Name: PIK3C2G (NM_004570) Human Mutant ORF Clone Mutation Description: P146L Affected Codon#: 146 Affected NT#: 437 Nucleotide Mutation: PIK3C2G Mutant (P146L), Myc-DDK-tagged ORF clone of Homo sapiens phosphoinositide-3- kinase, class 2, gamma polypeptide (PIK3C2G) as transfection-ready DNA Effect: Dibees, ype 2, ssoiion wih Symbol: PIK3C2G Synonyms: PI3K-C2-gamma; PI3K-C2GAMMA Vector: pCMV6-Entry (PS100001) Tag: Myc-DDK ACCN: NM_004570 ORF Size: 4335 bp ORF Nucleotide >RC402758 representing NM_004570 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCATATTCTTGGCAAACGGATCCAAATCCTAATGAATCACACGAAAAGCAGTATGAACACCAAGAAT TTCTCTTTGTAAATCAACCCCATTCTTCTAGCCAAGTCAGTCTGGGTTTTGATCAGATAGTAGATGAGAT CAGTGGCAAAATTCCACACTACGAGAGTGAAATTGATGAAAACACCTTTTTTGTGCCCACTGCACCAAAA TGGGACTCAACAGGGCATTCATTAAATGAAGCACACCAAATATCCTTGAATGAATTCACTTCTAAAAGCC GTGAACTCTCCTGGCATCAAGTTAGCAAAGCACCAGCAATTGGTTTTAGTCCTTCTGTGTTACCAAAACC TCAAAATACGAATAAAGAATGCTCCTGGGGAAGCCCCATAGGAAAACATCATGGTGCTGATGATTCCAGA TTCAGTATTTTAGCTCTATCATTCACAAGTTTGGATAAAATTAATCTAGAGAAAGAATTAGAAAATGAAA ATCATAACTACCATATAGGATTTGAAAGTAGCATTCCTCCAACAAATTCATCCTTCTCAAGTGACTTCAT GCCGAAAGAAGAGAATAAAAGGAGTGGACATGTGAACATTGTGGAACCATCTTTGATGCTTTTGAAAGGC -
Sequence Analysis of Familial Neurodevelopmental Disorders
SEQUENCE ANALYSIS OF FAMILIAL NEURODEVELOPMENTAL DISORDERS by Joseph Mark Tilghman A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland December 2020 © 2020 Joseph Tilghman All Rights Reserved Abstract: In the practice of human genetics, there is a gulf between the study of Mendelian and complex inheritance. When diagnosis of families affected by presumed monogenic syndromes is undertaken by genomic sequencing, these families are typically considered to have been solved only when a single gene or variant showing apparently Mendelian inheritance is discovered. However, about half of such families remain unexplained through this approach. On the other hand, common regulatory variants conferring low risk of disease still predominate our understanding of individual disease risk in complex disorders, despite rapidly increasing access to rare variant genotypes through sequencing. This dissertation utilizes primarily exome sequencing across several developmental disorders (having different levels of genetic complexity) to investigate how to best use an individual’s combination of rare and common variants to explain genetic risk, phenotypic heterogeneity, and the molecular bases of disorders ranging from those presumed to be monogenic to those known to be highly complex. The study described in Chapter 2 addresses putatively monogenic syndromes, where we used exome sequencing of four probands having syndromic neurodevelopmental disorders from an Israeli-Arab founder population to diagnose recessive and dominant disorders, highlighting the need to consider diverse modes of inheritance and phenotypic heterogeneity. In the study described in Chapter 3, we address the case of a relatively tractable multifactorial disorder, Hirschsprung disease. -
Genome-Wide Association Study Identifies Eight Novel Loci
cells Article Genome-Wide Association Study Identifies Eight Novel Loci for Susceptibility of Scrub Typhus and Highlights Immune-Related Signaling Pathways in Its Pathogenesis Yong-Chan Kim 1,2, Soriul Kim 3, Hee-Kwon Kim 4, Yi Lee 5 , Chol Shin 3,6, Chang-Seop Lee 7,8,* and Byung-Hoon Jeong 1,2,* 1 Korea Zoonosis Research Institute, Jeonbuk National University, Iksan, Jeonbuk 54531, Korea; [email protected] 2 Department of Bioactive Material Sciences, Jeonbuk National University, Jeonju, Jeonbuk 54896, Korea 3 Institute for Human Genomic Study, College of Medicine, Korea University, Seoul 02841, Korea; [email protected] (S.K.); [email protected] (C.S.) 4 Molecular Imaging & Therapeutic Medicine Research Center, Department of Nuclear Medicine, Biomedical Research Institute, Jeonbuk National University Medical School and Hospital, Jeonju, Jeonbuk 54907, Korea; [email protected] 5 Department of Industrial Plant Science & Technology, Chungbuk National University, Chungju, Chungbuk 28644, Korea; [email protected] 6 Department of Internal Medicine, Division of Pulmonary Sleep and Critical Care Medicine, Korea University Ansan Hospital, Ansan 15355, Korea 7 Department of Internal Medicine, Research Institute of Clinical Medicine, Jeonbuk National University Medical School, Jeonju, Jeonbuk 54907, Korea Citation: Kim, Y.-C.; Kim, S.; Kim, 8 Biomedical Research Institute, Jeonbuk National University Hospital, Jeonju, Jeonbuk 54907, Korea H.-K.; Lee, Y.; Shin, C.; Lee, C.-S.; * Correspondence: [email protected] (C.-S.L.); [email protected] (B.-H.J.); Jeong, B.-H. Genome-Wide Tel.: +82-63-250-2391 (C.-S.L.); +82-63-900-4040 (B.-H.J.); Fax: +82-63-254-1609 (C.-S.L.); +82-63-900-4012 (B.-H.J.) Association Study Identifies Eight Novel Loci for Susceptibility of Scrub Abstract: Scrub typhus is a fatal zoonotic disease caused by Orientia tsutsugamushi. -
Structural Basis for DEAH-Helicase Activation by G-Patch Proteins
Structural basis for DEAH-helicase activation by G-patch proteins Michael K. Studera, Lazar Ivanovica, Marco E. Webera, Sabrina Martia, and Stefanie Jonasa,1 aInstitute of Molecular Biology and Biophysics, Department of Biology, Swiss Federal Institute of Technology (ETH) Zürich, 8093 Zürich, Switzerland Edited by Joseph D. Puglisi, Stanford University School of Medicine, Stanford, CA, and approved February 21, 2020 (received for review August 12, 2019) RNA helicases of the DEAH/RHA family are involved in many essential RNA bases are stacked in the RNA binding channel between a long cellular processes, such as splicing or ribosome biogenesis, where β-hairpin in RecA2 (β14 to β15 in hsDHX15/scPrp43; SI Appendix, they remodel large RNA–protein complexes to facilitate transitions Fig. S1) and a conserved loop in RecA1 (termed “Hook-turn”). to the next intermediate. DEAH helicases couple adenosine tri- This means that during progression into the open state, the phosphate (ATP) hydrolysis to conformational changes of their β-hairpin and two other RNA-binding patches in RecA2 (termed catalytic core. This movement results in translocation along RNA, “Hook-loop” and “motif V”; SI Appendix, Fig. S1) have to shift 1 which is held in place by auxiliary C-terminal domains. The activity nucleotide (nt) toward the 5′ end of the RNA. Thus, when the of DEAH proteins is strongly enhanced by the large and diverse RecA domains close back up, at the start of the next hydrolysis class of G-patch activators. Despite their central roles in RNA me- cycle, the RNA is pushed by 1 nt through the RNA channel. -
High-Fidelity CRISPR/Cas9
ARTICLE DOI: 10.1038/s41467-018-05766-5 OPEN High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis Xingbo Xu1,2, Xiaoying Tan2,3, Björn Tampe 3, Tim Wilhelmi1,2, Melanie S. Hulshoff1,2,4, Shoji Saito3, Tobias Moser 5, Raghu Kalluri6, Gerd Hasenfuss1,2, Elisabeth M. Zeisberg1,2 & Michael Zeisberg2,3 fi 1234567890():,; While suppression of speci c genes through aberrant promoter methylation contributes to different diseases including organ fibrosis, gene-specific reactivation technology is not yet available for therapy. TET enzymes catalyze hydroxymethylation of methylated DNA, reac- tivating gene expression. We here report generation of a high-fidelity CRISPR/Cas9-based gene-specific dioxygenase by fusing an endonuclease deactivated high-fidelity Cas9 (dHFCas9) to TET3 catalytic domain (TET3CD), targeted to specific genes by guiding RNAs (sgRNA). We demonstrate use of this technology in four different anti-fibrotic genes in different cell types in vitro, among them RASAL1 and Klotho, both hypermethylated in kidney fibrosis. Furthermore, in vivo lentiviral delivery of the Rasal1-targeted fusion protein to interstitial cells and of the Klotho-targeted fusion protein to tubular epithelial cells each results in specific gene reactivation and attenuation of fibrosis, providing gene-specific demethylating technology in a disease model. 1 Department of Cardiology and Pneumology, University Medical Center Göttingen, Robert-Koch-Str. 40, 37075 Göttingen, Germany. 2 German Center for Cardiovascular Research (DZHK) Partner Site, Göttingen, Germany. 3 Department of Nephrology and Rheumatology, University Medical Center Göttingen, Robert-Koch-Str. 40, 37075 Göttingen, Germany. 4 Department of Pathology and Medical Biology, University Medical Center Groningen, Hanzeplein 1, 9713 Groningen, GZ, Netherlands. -
De Novo Frameshift Mutation in ASXL3 in a Patient with Global Developmental Delay, Microcephaly, and Craniofacial Anomalies
Children's Mercy Kansas City SHARE @ Children's Mercy Manuscripts, Articles, Book Chapters and Other Papers 9-17-2013 De novo frameshift mutation in ASXL3 in a patient with global developmental delay, microcephaly, and craniofacial anomalies. Darrell L. Dinwiddie Sarah E. Soden Children's Mercy Hospital Carol J. Saunders Children's Mercy Hospital Neil A. Miller Children's Mercy Hospital Emily G. Farrow Children's Mercy Hospital See next page for additional authors Follow this and additional works at: https://scholarlyexchange.childrensmercy.org/papers Part of the Medical Genetics Commons Recommended Citation Dinwiddie, D. L., Soden, S. E., Saunders, C. J., Miller, N. A., Farrow, E. G., Smith, L. D., Kingsmore, S. F. De novo frameshift mutation in ASXL3 in a patient with global developmental delay, microcephaly, and craniofacial anomalies. BMC Med Genomics 6, 32-32 (2013). This Article is brought to you for free and open access by SHARE @ Children's Mercy. It has been accepted for inclusion in Manuscripts, Articles, Book Chapters and Other Papers by an authorized administrator of SHARE @ Children's Mercy. For more information, please contact [email protected]. Creator(s) Darrell L. Dinwiddie, Sarah E. Soden, Carol J. Saunders, Neil A. Miller, Emily G. Farrow, Laurie D. Smith, and Stephen F. Kingsmore This article is available at SHARE @ Children's Mercy: https://scholarlyexchange.childrensmercy.org/papers/1414 Dinwiddie et al. BMC Medical Genomics 2013, 6:32 http://www.biomedcentral.com/1755-8794/6/32 CASE REPORT Open Access De novo frameshift -
A Heterozygous Microdeletion of 20Q13.13 Encompassing ADNP Gene in a Child with Helsmoortel–Van Der Aa Syndrome
European Journal of Human Genetics (2018) 26:1497–1501 https://doi.org/10.1038/s41431-018-0165-8 ARTICLE A heterozygous microdeletion of 20q13.13 encompassing ADNP gene in a child with Helsmoortel–van der Aa syndrome 1,2 1 3 1 4 Minh-Tuan Huynh ● Elise Boudry-Labis ● Alfred Massard ● Caroline Thuillier ● Bruno Delobel ● 4 5 Bénédicte Duban-Bedu ● Catherine Vincent-Delorme Received: 8 September 2017 / Revised: 3 April 2018 / Accepted: 11 April 2018 / Published online: 13 June 2018 © European Society of Human Genetics 2018 Abstract Helsmoortel–van der Aa (SWI/SNF autism-related or ADNP syndrome) is an autosomal dominant monogenic syndrome caused by de novo variants in the last exon of ADNP gene and no deletions have been documented to date. We report the first case of a 3 years and 10 months old boy exhibiting typical features of ADNP syndrome, including intellectual disability, autistic traits, facial dysmorphism, hyperlaxity, mood disorder, behavioral problems, and severe chronic constipation. 60K Agilent array-comparative genomic hybridization (CGH) identified a heterozygous interstitial microdeletion at 20q13.13 chromosome region, encompassing ADNP and DPM1. Taking into account the clinical phenotype of previously reported cases with ADNP single-point variants, – – 1234567890();,: 1234567890();,: genotype phenotype correlation in the proband was established and the diagnosis of Helsmoortel van der Aa syndrome was made. Our report thus confirms that ADNP haploinsufficiency is associated with Helsmoortel–van der Aa syndrome as well as highlights the utility of whole-genome array-CGH for detection of unbalanced submicroscopic chromosomal rearrangements in routine clinical setting in patients with unexplained intellectual disability and/or syndromic autism.