The Mouse Ascending: Perspectives for Human-Disease Models

Total Page:16

File Type:pdf, Size:1020Kb

The Mouse Ascending: Perspectives for Human-Disease Models FOCUS ON DEVELOPMENT AND DISEASE COMMENTARY The mouse ascending: perspectives for human-disease models Nadia Rosenthal1 and Steve Brown2 The laboratory mouse is widely considered the model organism of choice for studying the diseases of humans, with whom they share 99% of their genes. A distinguished history of mouse genetic experimentation has been further advanced by the development of powerful new tools to manipulate the mouse genome. The recent launch of several international initiatives to analyse the function of all mouse genes through mutagenesis, molecular analysis and phenotyping underscores the utility of the mouse for translating the information stored in the human genome into increasingly accurate models of human disease. Mice and humans share most physiologi- China and Japan, where the first ‘fancy’ mouse Mice with various immunodeficiencies are par- cal and pathological features: similarities in breeds were developed. By the late 1800s, these ticularly valuable for studying tumour growth nervous, cardiovascular, endocrine, immune, mutants attracted the attention of mouse col- and infectious diseases, and can act as hosts to musculoskeletal and other internal organ lectors and distributors in Europe and the human tissues and cells6. Metabolic, physiolog- systems have been extensively documented. United States. Unusual coat colours and other ical and behavioural stresses can be tested on Comparative analyses of mouse and human variations in visible features attracted Victorian mice models, the results of which can be com- genomes have provided insight into our mouse fanciers to these animals, many of pared directly with human clinical informa- common features and have guided powerful which are the direct forebears of today’s stand- tion. Through these advances, the lowly mouse, genomic manipulations in the mouse to gener- ard laboratory mouse strains. The economics once vilified as vermin and agricultural pests, ate models of human pathologies. These mice of supplying inbred strains to mouse fanciers has now emerged as the premier mammalian can then be subjected to biomedical experi- was soon dwarfed by a burgeoning investment model system for biomedical exploration. mentation not possible in patients. As more is in mammalian genetics, as researchers noted learned about human diseases that mice do not a striking resemblance between the charac- New tricks of the mouse trade usually contract, a growing armamentarium of teristics of some mouse mutants and certain The mouse’s current appeal as a model for experimental approaches is being applied to human diseases. human disease has its origins in the histori- ‘humanize’ mouse physiology and mimic our To many scientists in the 1930s, mice were cal selection and breeding initiatives used clinical manifestations. the obvious choice for genetic experimenta- for producing offspring with specific traits. How did the mouse ascend to such promi- tion2. Small, docile, rapid and prolific breed- Numerous mutants were generated by expos- nence in biological research? Compared with ers, they were also readily available from the ing mice to radiation or DNA-damaging other mammals that contract our diseases, the fancy mouse collectors of the day. Since then, chemicals1,2. Although rapid and relatively mouse is cheap, easy to maintain and straight- the mouse has attracted the attention of biolo- inexpensive, these early approaches intro- forward to breed in captivity . Mice also have gists and biomedical researchers, and a new bil- duced multiple unknown genomic altera- a long history of cohabitation with humans1. lion-dollar industry has sprung up in response, tions that required extensive follow-up work Our chequered relationship with the mouse breeding and shipping over 25 million mice to to locate and characterize. More recently, has its roots in the battle over agriculture and research laboratories each year. Repositories researchers have generated single targeted food stores in Africa more than 10,000 years routinely distribute hundreds of unique inbred mutations using an array of innovative genetic ago. The subsequent domestication of the mouse strains3 to laboratories around the world, technologies that produce specific genomic house mouse is likely to have originated in as well arranging the transport of genetically changes5. For example, transgenic mice, in engineered mutants prone to different cancers, which the gene of interest is injected into a heart disease, hypertension, diabetes, obesity, fertilized mouse egg, produce offspring with 1Mouse Biology Unit, EMBL Monterotondo Outstation, via Ramarini 32, 00016, osteoporosis, glaucoma, blindness and deaf- extra copies of the transgene; this transgene Monterotondo, Rome, Italy. ness, neuropathologies such as Huntington is often engineered to be expressed in a tis- 2MRC Mammalian Genetics Unit, Harwell, Oxfordshire, OX11 0RD, UK. or Lou Gehrig disease, and behavioural dis- sue-specific pattern or to be inducible with [email protected] turbances including anxiety and depression4,5. certain drugs. NATURE CELL BIOLOGY VOLUME 9 | NUMBER 9 | SEPTEMBER 2007 993 © 2007 Nature Publishing Group COMMENTARY FOCUS ON DEVELOPMENT AND DISEASE Critical Frt loxP 5′ Homology exon 3′ Homology arm arm SA-βgeo-pA ES cell Homologous recombination ES-cell gene locus ‘Floxed’ gene SA-βgeo-pA Drug selection Injection into blastocyst Germline offspring Chimeric offspring Figure 1 Large-scale strategy for mutagenesis of the mouse genome: a conditional knockout vector is created for each gene and introduced into mouse embryonic stem (ES) cells. The exon of the target gene is flanked by DNA motifs (loxP) that are recognized by a specific bacterial Cre recombinase. Homologous recombination between the cellular gene and the knockout vector flanking DNA sequences (green and yellow) results in the incorporation of the vector into the host ES-cell genome. The presence of a drug-resistance and marker gene (β-geo; purple) in the knockout vector allows targeted ES cells to survive drug selection, but these markers can be removed by a second recombinase (Flp) that recognizes a unique sequence (known as FRT). Mutant ES cells are injected into a host mouse blastocyst, which, when implanted into a foster mother, gives rise to chimeric offspring. This effect can be seen in their coat colour. Incorporation of mutant ES cells into germ cells results in germ-line transmission of the ES-cell genome to subsequent offspring. Alternative methods for mutagenesis rely carrying the target gene, a mutation is induced ES-cell mutations can be readily transformed on the manipulation of mouse embryonic by recombination in a spatially and tempo- into mice by using blastocyst injection, and stem (ES) cells. At present, a number of muta- rally controlled way (Fig. 2). Because most the mutation is activated by crossing with the genesis strategies based on ES cells are used, common human diseases are acquired later desired Cre recombinase driver strain. all of which use homologous recombination to in life, the generation of new mouse models As a complementary strategy, forward genet- alter genes in their original location, produc- of human disease currently relies heavily on ics — where the observation of a phenotype ing either ‘knock outs’ to cripple gene func- this conditional mutagenesis technology that is followed by the identification of the respon- tion or ‘knock ins’ to introduce an altered gene limits gene mutation to specific tissues or to a sible genetic loci — has been valuable for version. Knockout technology is extraordinar- specific life stage. discovering new and unexpected gene–func- ily powerful and generally produces loss-of- To meet the growing demand for conditional tion relationships. In common with the early function mutations, which disrupt the earliest mutant models, internationally coordinated random-mutagenesis strategies, more recent role of a gene in embryogenesis, but this often initiatives have been established for the sys- methods for unbiased, random mutation in confounds the analysis of gene dysfunction tematic generation of mouse mutants on a large the mouse rely on post-mutagenesis detec- at later stages of development or adulthood, scale using various strategies7,8,9 (Table 1). The tion of the sequence change, which has now which is when many human diseases are man- majority of these initiatives are committed to been streamlined with the advent of positional ifest. Further refinements to these manipula- the production of mutant mouse ES-cell lines, cloning, haplotype maps, single-nucleotide tions include the conditional induction of each of which carries an altered — or ‘floxed’ polymorphisms (SNPs) and high-throughput genomic changes (Fig. 1). By crossing a mouse (Fig. 1) — allele of a particular gene that har- genome sequencing. Newly developed reagents bearing a recombinase effector gene with one bours Cre recombinase sites. These mutant for mutagenesis include the reconstructed 994 NATURE CELL BIOLOGY VOLUME 9 | NUMBER 9 | SEPTEMBER 2007 © 2007 Nature Publishing Group FOCUS ON DEVELOPMENT AND DISEASE COMMENTARY Table 1 International mouse genetics and genomics initiatives Consortium Mission and aims URL European Conditional Mouse EUCOMM Genome-wide mouse mutagenesis www.eucomm.org Mutagenesis Programme www.nih.gov/science/models/mouse/knock- KOMP Knock-out Mouse Project Genome-wide mouse mutagenesis out/ North Americam Conditional NorCOMM Genome-wide mouse mutagenesis www.norcomm.org Mouse Mutagenesis Programme http://www.informatics.jax.org/mgihome/
Recommended publications
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Mouse Models of Human Disease an Evolutionary Perspective Robert L
    170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms.
    [Show full text]
  • (Ubl-Ptms): Small Peptides with Huge Impact in Liver Fibrosis
    cells Review Ubiquitin-Like Post-Translational Modifications (Ubl-PTMs): Small Peptides with Huge Impact in Liver Fibrosis 1 1, 1, Sofia Lachiondo-Ortega , Maria Mercado-Gómez y, Marina Serrano-Maciá y , Fernando Lopitz-Otsoa 2, Tanya B Salas-Villalobos 3, Marta Varela-Rey 1, Teresa C. Delgado 1,* and María Luz Martínez-Chantar 1 1 Liver Disease Lab, CIC bioGUNE, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), 48160 Derio, Spain; [email protected] (S.L.-O.); [email protected] (M.M.-G.); [email protected] (M.S.-M.); [email protected] (M.V.-R.); [email protected] (M.L.M.-C.) 2 Liver Metabolism Lab, CIC bioGUNE, 48160 Derio, Spain; fl[email protected] 3 Department of Biochemistry and Molecular Medicine, School of Medicine, Autonomous University of Nuevo León, Monterrey, Nuevo León 66450, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +34-944-061318; Fax: +34-944-061301 These authors contributed equally to this work. y Received: 6 November 2019; Accepted: 1 December 2019; Published: 4 December 2019 Abstract: Liver fibrosis is characterized by the excessive deposition of extracellular matrix proteins including collagen that occurs in most types of chronic liver disease. Even though our knowledge of the cellular and molecular mechanisms of liver fibrosis has deeply improved in the last years, therapeutic approaches for liver fibrosis remain limited. Profiling and characterization of the post-translational modifications (PTMs) of proteins, and more specifically NEDDylation and SUMOylation ubiquitin-like (Ubls) modifications, can provide a better understanding of the liver fibrosis pathology as well as novel and more effective therapeutic approaches.
    [Show full text]
  • Micromys Minutus)
    Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area.
    [Show full text]
  • DRE-1/FBXO11, a Conserved F Box Protein, Regulates Apoptosis in C
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2011 DRE-1/FBXO11, A Conserved F Box Protein, Regulates Apoptosis in C. elegans and is Mutated in Human Lymphoma Michael Chiorazzi Follow this and additional works at: http://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons Recommended Citation Chiorazzi, Michael, "DRE-1/FBXO11, A Conserved F Box Protein, Regulates Apoptosis in C. elegans and is Mutated in Human Lymphoma" (2011). Student Theses and Dissertations. Paper 139. This Thesis is brought to you for free and open access by Digital Commons @ RU. It has been accepted for inclusion in Student Theses and Dissertations by an authorized administrator of Digital Commons @ RU. For more information, please contact [email protected]. DRE-1/FBXO11, A CONSERVED F BOX PROTEIN, REGULATES APOPTOSIS IN C. ELEGANS AND IS MUTATED IN HUMAN LYMPHOMA A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Michael Chiorazzi June 2011 © Copyright by Michael Chiorazzi 2011 DRE-1/FBXO11, a conserved F box protein, regulates apoptosis in C. elegans and is mutated in human lymphoma Michael Chiorazzi, Ph.D. The Rockefeller University 2011 In the course of metazoan embryonic and post-embryonic development, more cells are generated than exist in the mature organism, and these cells are deleted by the process of programmed cell death. In addition, cells can be pushed toward death when they accumulate genetic errors, are virally-infected or are otherwise deemed potentially-harmful to the overall organism. Caenorhabditis elegans has proved to be an excellent model system for elucidating the genetic underpinnings of cell death, and research has shown that the core machinery, made up of the egl-1, ced-9, ced-4 and ced-3 genes, is conserved across metazoans, and their homologues are crucial for such diseases as cancer, neurodegeneration and autoimmunity.
    [Show full text]
  • Laboratory Animal Management: Rodents
    THE NATIONAL ACADEMIES PRESS This PDF is available at http://nap.edu/2119 SHARE Rodents (1996) DETAILS 180 pages | 6 x 9 | PAPERBACK ISBN 978-0-309-04936-8 | DOI 10.17226/2119 CONTRIBUTORS GET THIS BOOK Committee on Rodents, Institute of Laboratory Animal Resources, Commission on Life Sciences, National Research Council FIND RELATED TITLES SUGGESTED CITATION National Research Council 1996. Rodents. Washington, DC: The National Academies Press. https://doi.org/10.17226/2119. Visit the National Academies Press at NAP.edu and login or register to get: – Access to free PDF downloads of thousands of scientific reports – 10% off the price of print titles – Email or social media notifications of new titles related to your interests – Special offers and discounts Distribution, posting, or copying of this PDF is strictly prohibited without written permission of the National Academies Press. (Request Permission) Unless otherwise indicated, all materials in this PDF are copyrighted by the National Academy of Sciences. Copyright © National Academy of Sciences. All rights reserved. Rodents i Laboratory Animal Management Rodents Committee on Rodents Institute of Laboratory Animal Resources Commission on Life Sciences National Research Council NATIONAL ACADEMY PRESS Washington, D.C.1996 Copyright National Academy of Sciences. All rights reserved. Rodents ii National Academy Press 2101 Constitution Avenue, N.W. Washington, D.C. 20418 NOTICE: The project that is the subject of this report was approved by the Governing Board of the National Research Council, whose members are drawn from the councils of the National Academy of Sciences, National Academy of Engineering, and Institute of Medicine. The members of the committee responsible for the report were chosen for their special competences and with regard for appropriate balance.
    [Show full text]
  • Molecular Players Affecting the Biological Timer System to Determine Pupation Timing in Drosophila
    Molecular players affecting the biological timer system to determine pupation timing in Drosophila ショウジョウバエの蛹化タイミングを決める 生物タイマーシステムに影響を及ぼす分子 September 2018 Hamdy Aly Mohamed Aly The Graduate School of Natural Science and Technology (Doctor’s Course) Okayama University ACKNOWLEDGMENTS First of all, I would like to thank my supervisor Prof. Hitoshi Ueda for giving me the opportunity of being in Japan to performing my Ph.D. in his laboratory. I am very grateful to you for advice, guidance, valuable comments, for your suggestions and for your didactic way in clarifying the ideas, because of you, I have learned how to always think with a scientific essence. A special appreciation is extended to the Japanese Ministry of Education, Culture, Sports, Science, and Technology for providing me the financial assistance which kept away the irritating sensation of financial instability. In our days when role models have become fewer and fewer, I had the privilege of being shaped by an intelligent researcher, Dr. Moustafa Sarhan. I gratefully acknowledge Dr. Moustafa, my mentor, and my best friend, whose passion for helping sets new standards for anyone involved in training and development, or any other endeavor in which one human being seeks to support the growth and improvement of another. I would also like to thank all previous and current members of our laboratory especially Haruka Takase, Shiho Koyama, Koichi Miyagawa, Mayo Nakanishi for their help and for providing useful comments during my research. Special thanks to Dr. Haruka Nishida who helped me to set up my stay and take care of every single detail to make my life more enjoyable in Japan.
    [Show full text]
  • A Guide to Mites
    A GUIDE TO MITES concentrated in areas where clothes constrict the body, or MITES in areas like the armpits or under the breasts. These bites Mites are arachnids, belonging to the same group as can be extremely itchy and may cause emotional distress. ticks and spiders. Adult mites have eight legs and are Scratching the affected area may lead to secondary very small—sometimes microscopic—in size. They are bacterial infections. Rat and bird mites are very small, a very diverse group of arthropods that can be found in approximately the size of the period at the end of this just about any habitat. Mites are scavengers, predators, sentence. They are quite active and will enter the living or parasites of plants, insects and animals. Some mites areas of a home when their hosts (rats or birds) have left can transmit diseases, cause agricultural losses, affect or have died. Heavy infestations may cause some mites honeybee colonies, or cause dermatitis and allergies in to search for additional blood meals. Unfed females may humans. Although mites such as mold mites go unnoticed live ten days or more after rats have been eliminated. In and have no direct effect on humans, they can become a this area, tropical rat mites are normally associated with nuisance due to their large numbers. Other mites known the roof rat (Rattus rattus), but are also occasionally found to cause a red itchy rash (known as contact dermatitis) on the Norway rat, (R. norvegicus) and house mouse (Mus include a variety of grain and mold mites. Some species musculus).
    [Show full text]
  • A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens
    A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens Pascale Chevret1*, Terence J. Robinson2, Julie Perez3, Fre´de´ric Veyrunes3, Janice Britton-Davidian3 1 Laboratoire de Biome´trie et Biologie Evolutive, UMR CNRS 5558, Universite´ Lyon 1, Villeurbanne, France, 2 Evolutionary Genomics Group, Department of Botany and Zoology, University of Stellenbosch, Stellenbosch, South Africa, 3 Institut des Sciences de l’Evolution de Montpellier, UMR CNRS 5554, Universite´ Montpellier 2, Montpellier, France Abstract The African pygmy mice (Mus, subgenus Nannomys) are a group of small-sized rodents that occur widely throughout sub- Saharan Africa. Chromosomal diversity within this group is extensive and numerous studies have shown the karyotype to be a useful taxonomic marker. This is pertinent to Mus minutoides populations in South Africa where two different cytotypes (2n = 34, 2n = 18) and a modification of the sex determination system (due to the presence of a Y chromosome in some females) have been recorded. This chromosomal diversity is mirrored by mitochondrial DNA sequences that unambiguously discriminate among the various pygmy mouse species and, importantly, the different M. minutoides cytotypes. However, the geographic delimitation and taxonomy of pygmy mice populations in South Africa is poorly understood. To address this, tissue samples of M. minutoides were taken and analysed from specimens housed in six South African museum collections. Partial cytochrome b sequences (400 pb) were successfully amplified from 44% of the 154 samples processed. Two species were identified: M. indutus and M. minutoides. The sequences of the M. indutus samples provided two unexpected features: i) nuclear copies of the cytochrome b gene were detected in many specimens, and ii) the range of this species was found to extend considerably further south than is presently understood.
    [Show full text]
  • A Haplotype Map for the Laboratory Mouse
    NEWS AND VIEWS Sample size dictates inference dogma collection, rather than to data generation or ent experimental approaches provides insight The technical revolution that made the cur- analysis. The open question is whether the com- into mechanism and helps specify the genetic rent data boom possible has matured; genetics munity of funding agencies, peer reviewers and model. In fact, genomic convergence is a spe- laboratories now routinely generate millions of regulatory bodies will be prepared to encourage cific embodiment of the concept of ‘consilience genotypes per day. However, more data can be a and support the assembly of subjects and mate- of inductions’, formulated by William Whewell problem when we do not have the discipline to rials needed to accomplish these goals. in the 1840s11, which says that valid inductions apply the scientific method. Replication is also will be supported by data from many different a problem when working with effects so small Candidate gene success experimental approaches. that replication success could not be reasonably Rather than being discovered initially through a Although they benefit greatly from the expected, even if the marker is associated with genome-wide scan of hundreds of thousands of impressive acceleration provided by genome- the disease. genetic markers, which is now the rage, IL7R is wide scans, virtually all genetic association Larger sample size is the mantra of the hour. a candidate gene that refused to quit. Certainly, disease studies ultimately become candidate Experimentalists and funding agencies no longer the first paper on IL7R polymorphisms in mul- gene projects. Additional susceptibility genes in scoff at theoretical analyses showing that thou- tiple sclerosis7 would not have satisfied the strin- multiple sclerosis—siblings of HLA-DRB2, IL7R sands of cases and controls are needed to dem- gent replication criteria advocated by a recent and, probably, IL2RA4—might now stand above onstrate modest genetic associations (Fig.
    [Show full text]
  • Enrichment for Laboratory Zebrafish—A Review of the Evidence and the Challenges
    animals Review Enrichment for Laboratory Zebrafish—A Review of the Evidence and the Challenges Chloe H. Stevens *, Barney T. Reed and Penny Hawkins Animals in Science Department, RSPCA, Wilberforce Way, Southwater, West Sussex RH13 9RS, UK; [email protected] (B.T.R.); [email protected] (P.H.) * Correspondence: [email protected] Simple Summary: The zebrafish is one of the most commonly used animals in scientific research, but there remains a lack of consensus over good practice for zebrafish housing and care. One such area which lacks agreement is whether laboratory zebrafish should be provided with environmental enrichment—additions or modifications to the basic laboratory environment which aim to improve welfare, such as plastic plants in tanks. The need for the provision of appropriate environmental enrichment has been recognised in other laboratory animal species, but some scientists and animal care staff are hesitant to provide enrichment for zebrafish, arguing that there is little or no evidence that enrichment can benefit zebrafish welfare. This review aims to summarise the current literature on the effects of enrichment on zebrafish physiology, behaviour and welfare, and identifies some forms of enrichment which are likely to benefit zebrafish. It also considers the possible challenges that might be associated with introducing more enrichment, and how these might be addressed. Abstract: Good practice for the housing and care of laboratory zebrafish Danio rerio is an increasingly discussed topic, with focus on appropriate water quality parameters, stocking densities, feeding Citation: Stevens, C.H.; Reed, B.T.; regimes, anaesthesia and analgesia practices, methods of humane killing, and more.
    [Show full text]
  • Genetic Analysis of Complex Traits in the Emerging Collaborative Cross
    Downloaded from genome.cshlp.org on October 5, 2021 - Published by Cold Spring Harbor Laboratory Press Research Genetic analysis of complex traits in the emerging Collaborative Cross David L. Aylor,1 William Valdar,1,13 Wendy Foulds-Mathes,1,13 Ryan J. Buus,1,13 Ricardo A. Verdugo,2,13 Ralph S. Baric,3,4 Martin T. Ferris,1 Jeff A. Frelinger,4 Mark Heise,1 Matt B. Frieman,4 Lisa E. Gralinski,4 Timothy A. Bell,1 John D. Didion,1 Kunjie Hua,1 Derrick L. Nehrenberg,1 Christine L. Powell,1 Jill Steigerwalt,5 Yuying Xie,1 Samir N.P. Kelada,6 Francis S. Collins,6 Ivana V. Yang,7 David A. Schwartz,7 Lisa A. Branstetter,8 Elissa J. Chesler,2 Darla R. Miller,1 Jason Spence,1 Eric Yi Liu,9 Leonard McMillan,9 Abhishek Sarkar,9 Jeremy Wang,9 Wei Wang,9 Qi Zhang,9 Karl W. Broman,10 Ron Korstanje,2 Caroline Durrant,11 Richard Mott,11 Fuad A. Iraqi,12 Daniel Pomp,1,14 David Threadgill,5,14 Fernando Pardo-Manuel de Villena,1,14 and Gary A. Churchill2,14 1Department of Genetics, University of North Carolina–Chapel Hill, Chapel Hill, North Carolina 27599, USA; 2The Jackson Laboratory, Bar Harbor, Maine 04609, USA; 3Department of Epidemiology, University of North Carolina–Chapel Hill, Chapel Hill, North Carolina 27599, USA; 4Department of Microbiology and Immunology, University of North Carolina–Chapel Hill, Chapel Hill, North Carolina 27599, USA; 5Department of Genetics, North Carolina State University, Raleigh, North Carolina 27695, USA; 6Genome Technology Branch, National Human Genome Research Institute, National Institutes of Health, Bethesda, Maryland
    [Show full text]