DOCSLIB.ORG

A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens Pascale Chevret1*, Terence J. Robinson2, Julie Perez3, Fre´de´ric Veyrunes3, Janice Britton-Davidian3 1 Laboratoire de Biome´trie et Biologie Evolutive, UMR CNRS 5558, Universite´ Lyon 1, Villeurbanne, France, 2 Evolutionary Genomics Group, Department of Botany and Zoology, University of Stellenbosch, Stellenbosch, South Africa, 3 Institut des Sciences de l’Evolution de Montpellier, UMR CNRS 5554, Universite´ Montpellier 2, Montpellier, France Abstract The African pygmy mice (Mus, subgenus Nannomys) are a group of small-sized rodents that occur widely throughout sub- Saharan Africa. Chromosomal diversity within this group is extensive and numerous studies have shown the karyotype to be a useful taxonomic marker. This is pertinent to Mus minutoides populations in South Africa where two different cytotypes (2n = 34, 2n = 18) and a modification of the sex determination system (due to the presence of a Y chromosome in some females) have been recorded. This chromosomal diversity is mirrored by mitochondrial DNA sequences that unambiguously discriminate among the various pygmy mouse species and, importantly, the different M. minutoides cytotypes. However, the geographic delimitation and taxonomy of pygmy mice populations in South Africa is poorly understood. To address this, tissue samples of M. minutoides were taken and analysed from specimens housed in six South African museum collections. Partial cytochrome b sequences (400 pb) were successfully amplified from 44% of the 154 samples processed. Two species were identified: M. indutus and M. minutoides. The sequences of the M. indutus samples provided two unexpected features: i) nuclear copies of the cytochrome b gene were detected in many specimens, and ii) the range of this species was found to extend considerably further south than is presently understood. The phylogenetic analysis of the M. minutoides samples revealed two well-supported clades: a Southern clade which included the two chromosomal groups previously identified in South Africa, and an Eastern clade that extended from Eastern Africa into South Africa. Congruent molecular phylogenetic and chromosomal datasets permitted the tentative chromosomal assignments of museum specimens within the different clades as well as the correction of misidentified museum specimens. Citation: Chevret P, Robinson TJ, Perez J, Veyrunes F, Britton-Davidian J (2014) A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens. PLoS ONE 9(6): e98499. doi:10.1371/journal.pone.0098499 Editor: Dorothee Huchon, Tel-Aviv University, Israel Received February 6, 2014; Accepted May 3, 2014; Published June 6, 2014 Copyright: ß 2014 Chevret et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Funders: Ellerman Fellowship from the University of Stellenbosch (http://www.sun.ac.za) to JBD and TJR; and ANR (http://www.agence-nationale-recherche.fr/) grant ‘‘SEXYMUS’’ (Nu 10-JCJC-1605) to FV. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] Introduction existence of at least three well-supported clades within M. minutoides: Western Africa, West-Central Africa and East/South The African pygmy mice (subgenus Nannomys) represent an early Africa [3,7,8] and these intraspecific relationships are in agree- African offshoot of the Mus lineage and are characterized by their ment with an extensive chromosomal diversity. In the East/South overall small size (,10 g). Colonization of Africa brought about an African clade for example, in addition to the centric fusion extensive diversification of this monophyletic subgenus [1–3] between the sex chromosomes and autosome 1, two divergent which comprises 18 species distributed south of the Sahara [4]. chromosomal groups (2n = 34, 2n = 18) exist that differ in the Preliminary molecular data have shown that some of the Nannomys number of autosomal fusions present in each [9]. The concordant species are highly divergent, although they are often difficult to patterns illustrated by chromosomal and molecular markers [2,9] discriminate on morphological grounds owing to geographic suggests that the accumulation of chromosomal rearrangements variability and the lack of unambiguous diagnostic characters may have played a role in accelerating the genetic divergence [2,4,5]. On the contrary, chromosomal characters have been between the taxa. Third, M. minutoides is one of the very few species useful taxonomic markers, and cytogenetic investigations have of mammals that presents an atypical sex chromosome system–it is uncovered extensive karyotypic evolution within this group [6]. A noteworthy for a high proportion of sex-reversed XY females [10]. case in point is Mus minutoides which shows three noteworthy The existence of XY females was first detected in South African features. First, this species has the most widespread distribution of specimens and subsequently confirmed in West African popula- the recognized taxa extending as it does throughout most of sub- tions suggesting that the mutation likely occurred at the onset of Saharan Africa [7]. Second, phylogenetic analyses highlighted the the diversification of the lineage [11]. In summary, this species has PLOS ONE | www.plosone.org 1 June 2014 | Volume 9 | Issue 6 | e98499 Phylogeography of Museum Specimen of Pygmy Mouse in South Africa undergone a remarkable karyotypic evolution that is paralleled by (Applied Biosystems), 2 mM MgCl2, 0.5 mM of each primer, a high level of genetic structure making it a useful model for 0.25 mM of dNTP, and 2 ml of sample extraction. For each PCR, studying chromosomal evolution and speciation processes in the negative controls of each extraction batch and a PCR blank general, and in small mammals in particular. were included. The cycling conditions were: denaturation at 94uC African pygmy mice are, however, notorious for their low for 5 min followed by 55 cycles at 94uC for 45 s, 50uC for 45 s and trapping success and M. minutoides is no exception. This has 72uC for 1 min, with a final extension at 72uC for 5 min. In order hindered advances in studying their taxonomic and chromosomal to check for the presence of contaminant DNA, the first PCR diversity since their collection is time-consuming, expensive and products were cloned using the TOPO TA Cloning Kit according largely serendipitous. Access to museum types and specimens to the manufacturer’s instructions (Invitrogen). Eight to ten offers an unprecedented opportunity to resolve taxonomic positive clones per specimen were sequenced by Cogenics France questions and engage in long-term biodiversity studies. Here, we (Grenoble, France). We used MEGA 5.1 [16] to edit the raw report the outcome of a museum-based phylogeographic survey of sequences and to build a consensus sequence for each sample. As M. minutoides throughout South Africa that highlights the usefulness these first steps sometimes led to the amplification of contaminant of this approach for investigations of rare or difficult to sample DNA, we designed primers specific to the subgenus Nannomys and/ taxa. or M. minutoides based on the alignment of cytb sequences of several Mus species. These new primers and their positions are Materials and Methods indicated in Figure 1; they are all located within the first 500 bases of the cytb gene, and were used in different combinations. Some Material samples (,50%) were independently amplified twice to check the Tissue samples were taken from imperfectly cleaned skulls or authenticity of the sequences. PCR products were sequenced in dried skins of 287 specimens housed in the small mammal both directions by Macrogen Europe Laboratory (Amsterdam, collections of six South African Museums (Table 1). Although the The Netherlands). Mus minutoides collections were our main interest, tissues from M. The PCR products of eight specimens yielded two sequences bufo, M. neavei and M. musculoides specimens were included when using two different sets of primers; these were cloned and available. All samples were stored dry in eppendorf tubes and a subset of these (154) were processed in the ‘Degraded DNA sequenced as described above. Comparison with the sequences facility’ in Montpellier, France (dedicated to processing low from the ethanol-preserved tissues of the same species allowed us quality/quantity DNA tissue samples). Alcohol-preserved tissue to determine which amplicons were from the mitochochondrial samples were available for 19 individuals in the Durban and Iziko cytb gene and which were nuclear copies (numts). Museum collections; the DNA from these samples was extracted in For the ethanol-preserved tissues, the complete mitochondrial a separate room to avoid contamination. Additional ethanol- cytb gene was amplified as described in [2]. In instances where preserved tissue samples of four wild-caught M. minutoides (1 amplification failed (8 samples), a shorter fragment was sequenced specimen) and M. indutus (3 specimens) were included in the as described
Load more

Recommended publications
  • Diet and Microhabitat Use of the Woodland Dormouse Graphiurus Murinus at the Great Fish River Reserve, Eastern Cape, South Africa
    Diet and microhabitat use of the woodland dormouse Graphiurus murinus at the Great Fish River Reserve, Eastern Cape, South Africa by Siviwe Lamani A dissertation submitted in fulfilment of the requirements for the degree of MASTER OF SCIENCE (ZOOLOGY) in the Faculty of Science and Agriculture at the University of Fort Hare 2014 Supervisor: Ms Zimkitha Madikiza Co-supervisor: Prof. Emmanuel Do Linh San DECLARATION I Siviwe Lamani , student number 200604535 hereby declare that this dissertation titled “Diet and microhabitat use of the woodland dormouse Graphiurus murinus at the Great Fish River Reserve , Eastern Cape, South Africa” submitted for the award of the Master of Science degree in Zoology at the University of Fort Hare, is my own work that has never been submitted for any other degree at this university or any other university. Signature: I Siviwe Lamani , student number 200604535 hereby declare that I am fully aware of the University of Fort Hare policy on plagiarism and I have taken every precaution on complying with the regulations. Signature: I Siviwe Lamani , student number 200604535 hereby declare that I am fully aware of the University of Fort Hare policy on research ethics and have taken every precaution to comply with the regulations. The data presented in this dissertation were obtained in the framework of another project that was approved by the University Ethics committee on 31 May 2013 and is covered by the ethical clearance certificate # SAN05 1SGB02. Signature: ii SUPERVISOR’S FOREWORD The format of this Master’s dissertation (abstract, general introduction and two independent papers) has been chosen with two purposes in mind: first, to train the MSc candidate to the writing of scientific papers, and second, to secure and allow for a quicker dissemination of the scientific knowledge.
    [Show full text]
  • TAXONOMIC STUDIES from RODENT OUTBREAK AREAS in the CHITTAGONG HILL TRACTS Nikhil
    Bangladesh J. Zool. 46(2): 217-230, 2018 ISSN: 0304-9027 (print) 2408-8455 (online) NEW RECORDS OF RODENT SPECIES IN BANGLADESH: TAXONOMIC STUDIES FROM RODENT OUTBREAK AREAS IN THE CHITTAGONG HILL TRACTS Nikhil Chakma*, Noor Jahan Sarker, Steven Belmain1, Sohrab Uddin Sarker, Ken Aplin2 and Sontosh Kumar Sarker3 Department of Zoology, University of Dhaka, Dhaka-1000, Bangladesh Abstract: Rodents are regarded as crop pests, significant reservoirs and vectors for many zoonotic diseases around the world. Basic taxonomic information of rodents present in a locality can help understand which species are responsible as crop pest in that habitat. The phenomenon of the 50-year cycle of gregarious bamboo flowering and rodent outbreaks in the Chittagong Hill Tracts (CHT) of Bangladesh, rodents trapping were carried out in four habitats from March, 2009 to December, 2011 in Ruma upazila of Bandarban hill district. Variety of traps were used to capture small mammals. The captured species were measured and identified using taxonomical dichotomous keys and DNA bar-coding performed in Australia. A total of 14 different small mammalian species were captured of which nine belonging to the Muridae family, and one species each of Spalacidae, Sciuridae, Tupaiidae and Soricidae families. The dominant small mammal species captured were Rattus rattus (54.06%) followed by Mus musculus (26.39%), Rattus nitidus (10.98%), Suncus murinus (5.45%), Mus terricolor (1.09%), Mus cookii nagarum (0.97%), Cannomys badius (0.16%), Leopoldamys edwardsi (0.12%), Berylmys bowersi (0.12%), Vernaya fulva (0.08%), Rattus andamanensis (0.08%), Tupaia glis (0.04%) and Callosciurus pygerythrus (0.04%).
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Mouse Models of Human Disease an Evolutionary Perspective Robert L
    170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms.
    [Show full text]
  • Quaternary Murid Rodents of Timor Part I: New Material of Coryphomys Buehleri Schaub, 1937, and Description of a Second Species of the Genus
    QUATERNARY MURID RODENTS OF TIMOR PART I: NEW MATERIAL OF CORYPHOMYS BUEHLERI SCHAUB, 1937, AND DESCRIPTION OF A SECOND SPECIES OF THE GENUS K. P. APLIN Australian National Wildlife Collection, CSIRO Division of Sustainable Ecosystems, Canberra and Division of Vertebrate Zoology (Mammalogy) American Museum of Natural History ([email protected]) K. M. HELGEN Department of Vertebrate Zoology National Museum of Natural History Smithsonian Institution, Washington and Division of Vertebrate Zoology (Mammalogy) American Museum of Natural History ([email protected]) BULLETIN OF THE AMERICAN MUSEUM OF NATURAL HISTORY Number 341, 80 pp., 21 figures, 4 tables Issued July 21, 2010 Copyright E American Museum of Natural History 2010 ISSN 0003-0090 CONTENTS Abstract.......................................................... 3 Introduction . ...................................................... 3 The environmental context ........................................... 5 Materialsandmethods.............................................. 7 Systematics....................................................... 11 Coryphomys Schaub, 1937 ........................................... 11 Coryphomys buehleri Schaub, 1937 . ................................... 12 Extended description of Coryphomys buehleri............................ 12 Coryphomys musseri, sp.nov.......................................... 25 Description.................................................... 26 Coryphomys, sp.indet.............................................. 34 Discussion . ....................................................
    [Show full text]
  • Micromys Minutus)
    Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area.
    [Show full text]
  • A Guide to Mites
    A GUIDE TO MITES concentrated in areas where clothes constrict the body, or MITES in areas like the armpits or under the breasts. These bites Mites are arachnids, belonging to the same group as can be extremely itchy and may cause emotional distress. ticks and spiders. Adult mites have eight legs and are Scratching the affected area may lead to secondary very small—sometimes microscopic—in size. They are bacterial infections. Rat and bird mites are very small, a very diverse group of arthropods that can be found in approximately the size of the period at the end of this just about any habitat. Mites are scavengers, predators, sentence. They are quite active and will enter the living or parasites of plants, insects and animals. Some mites areas of a home when their hosts (rats or birds) have left can transmit diseases, cause agricultural losses, affect or have died. Heavy infestations may cause some mites honeybee colonies, or cause dermatitis and allergies in to search for additional blood meals. Unfed females may humans. Although mites such as mold mites go unnoticed live ten days or more after rats have been eliminated. In and have no direct effect on humans, they can become a this area, tropical rat mites are normally associated with nuisance due to their large numbers. Other mites known the roof rat (Rattus rattus), but are also occasionally found to cause a red itchy rash (known as contact dermatitis) on the Norway rat, (R. norvegicus) and house mouse (Mus include a variety of grain and mold mites. Some species musculus).
    [Show full text]
  • Blood Parasites of Mound-Building Mouse, Mus Spicilegus Petényi, 1882 (Mammalia, Rodentia)
    Wiadomoœci Parazytologiczne 2010, 56(1), 63–65 Copyright© 2010 Polskie Towarzystwo Parazytologiczne Blood parasites of mound-building mouse, Mus spicilegus Petényi, 1882 (Mammalia, Rodentia) Grzegorz Karbowiak 1, Jana Fričova 2, Michal Stanko 2,3 , Joanna Hapunik 1, Denisa Varfalvyova 2 1W. Stefański Institute of Parasitology, Polish Academy of Sciences, Twarda Street, 51/55, 00-818 Warsaw, Poland 2Institute of Zoology of Slovak Academy of Sciences, Löfflerova Street, 10, 040 01, Košice, Slovakia 3Matej Bel University, Faculty of Natural Sciences, Tajovského 40, 97401 Banská Bystrica, Slovakia Corresponding author: Grzegorz Karbowiak; E-mail: [email protected] ABSTRACT. Mound-building mice, Mus spicilegus , were studied for the blood parasites in Eastern Slovakia, vicinity Kechnec village near Košice town (Košická kotlina basin, 21°14’ E, 48°33’ N) during years 2002–2005. Overall, 251 specimens were examined. The parasites were detected using microhematokrit centrifugation technique and on the Giemsa’s method stained blood smears and light microscopy. The parasites were found in 3.57% of specimens; 1.20% of mice were infected with Bartonella sp., 2.39% were infected with Babesia piroplasms. No Hepatozoon hemogregarines and trypanosomes were observed. The intensity of infection with Bartonella was low, less than 0.01% of erythrocytes were invaded, the percent of the erythrocytes with Babesia sp. was less than 0.01%. The morphological description and measurements of parasites were made using the „Analysis” software combined with a video camera and a microscope. The mean size of Bartonella sp. bacteria’s were 0.8×0.3 mm, range 0.4–1.5×0.1–0.9 mm, Babesia sp.
    [Show full text]
  • Rodents Prevention and Control
    RODENTS PREVENTION AND CONTROL Santa Cruz County Mosquito & Vector Control 640 Capitola Road • Santa Cruz, CA 95062 (831) 454-2590 www.agdept.com/mvc.html [email protected] Protecting Public Health Since 1994 RODENT SERVICES Residents, property managers, and businesses in Santa Cruz County can request a site visit to assist them with rodent issues to protect public health. Our services include an exterior inspection of your home in which a certified technician looks for rodent entry points and gives advice on preventing rodents from getting into your home. Employees do not bait or trap, but provide guidance and recommendations such as blocking openings and reducing food sources and hiding places. GENERAL INFORMATION Control strategies may vary depending on pest species. ROOF RAT Rattus rattus (also known as black rat, fruit rat or ship rat) Tail Longer than head and body combined Body Slender, belly can be white, light gray, or light tan Ear Large Eye Large Nose Pointed Habits Climb Feces Smaller, pointy ends (actual size) Roof Rat (Rattus rattus)** NORWAY RAT Rattus novegicus (also known as wharf rat,brown rat, sewer rat, common rat) Tail Shorter than head and body combined (If you fold tail back, it cannot reach its head) Body Heavy, thick Ear Small Eye Small Nose Blunt Habits Burrow, can enter through a hole the size of a quarter, likes water Feces Rounder, blunt ends (actual size) Norway Rat (Rattus novegicus)** 2 HOUSE MOUSE Mus musculus Feet Small Head Small Habits Common in homes and buildings, can enter through a hole as small
    [Show full text]
  • Mammals of the Kafa Biosphere Reserve Holger Meinig, Dr Meheretu Yonas, Ondřej Mikula, Mengistu Wale and Abiyu Tadele
    NABU’s Follow-up BiodiversityAssessmentBiosphereEthiopia Reserve, Follow-up NABU’s Kafa the at NABU’s Follow-up Biodiversity Assessment at the Kafa Biosphere Reserve, Ethiopia Small- and medium-sized mammals of the Kafa Biosphere Reserve Holger Meinig, Dr Meheretu Yonas, Ondřej Mikula, Mengistu Wale and Abiyu Tadele Table of Contents Small- and medium-sized mammals of the Kafa Biosphere Reserve 130 1. Introduction 132 2. Materials and methods 133 2.1 Study area 133 2.2 Sampling methods 133 2.3 Data analysis 133 3. Results and discussion 134 3.1 Soricomorpha 134 3.2 Rodentia 134 3.3 Records of mammal species other than Soricomorpha or Rodentia 140 4. Evaluation of survey results 143 5. Conclusions and recommendations for conservation and monitoring 143 6. Acknowledgements 143 7. References 144 8. Annex 147 8.1 Tables 147 8.2 Photos 152 NABU’s Follow-up Biodiversity Assessment at the Kafa Biosphere Reserve, Ethiopia Small- and medium-sized mammals of the Kafa Biosphere Reserve Holger Meinig, Dr Meheretu Yonas, Ondřej Mikula, Mengistu Wale and Abiyu Tadele 130 SMALL AND MEDIUM-SIZED MAMMALS Highlights ´ Eight species of rodents and one species of Soricomorpha were found. ´ Five of the rodent species (Tachyoryctes sp.3 sensu (Sumbera et al., 2018)), Lophuromys chrysopus and L. brunneus, Mus (Nannomys) mahomet and Desmomys harringtoni) are Ethiopian endemics. ´ The Ethiopian White-footed Mouse (Stenocephalemys albipes) is nearly endemic; it also occurs in Eritrea. ´ Together with the Ethiopian Vlei Rat (Otomys fortior) and the African Marsh Rat (Dasymys griseifrons) that were collected only during the 2014 survey, seven endemic rodent species are known to occur in the Kafa region, which supports 12% of the known endemic species of the country.
    [Show full text]
  • Biodiversity in Sub-Saharan Africa and Its Islands Conservation, Management and Sustainable Use
    Biodiversity in Sub-Saharan Africa and its Islands Conservation, Management and Sustainable Use Occasional Papers of the IUCN Species Survival Commission No. 6 IUCN - The World Conservation Union IUCN Species Survival Commission Role of the SSC The Species Survival Commission (SSC) is IUCN's primary source of the 4. To provide advice, information, and expertise to the Secretariat of the scientific and technical information required for the maintenance of biologi- Convention on International Trade in Endangered Species of Wild Fauna cal diversity through the conservation of endangered and vulnerable species and Flora (CITES) and other international agreements affecting conser- of fauna and flora, whilst recommending and promoting measures for their vation of species or biological diversity. conservation, and for the management of other species of conservation con- cern. Its objective is to mobilize action to prevent the extinction of species, 5. To carry out specific tasks on behalf of the Union, including: sub-species and discrete populations of fauna and flora, thereby not only maintaining biological diversity but improving the status of endangered and • coordination of a programme of activities for the conservation of bio- vulnerable species. logical diversity within the framework of the IUCN Conservation Programme. Objectives of the SSC • promotion of the maintenance of biological diversity by monitoring 1. To participate in the further development, promotion and implementation the status of species and populations of conservation concern. of the World Conservation Strategy; to advise on the development of IUCN's Conservation Programme; to support the implementation of the • development and review of conservation action plans and priorities Programme' and to assist in the development, screening, and monitoring for species and their populations.
    [Show full text]
  • Briefdefinitive Report
    Brief Definitive Report ANALYSIS OF RESTRICTION FRAGMENT LENGTH POLYMORPHISM IN LYMPHOKINE GENES OF NORMAL AND AUTOIMMUNE MICE BY GUNTHER RICHTER, ZHIHAI QIN, TIBOR DIAMANTSTEIN, AND THOMAS BLANKENSTEIN From the Freie Universitat Berlin, Klinikum Steglitz, Institut fur Immunologie, 1000 Berlin 45, Federal Republic of Germany The genetic origin for the lupus-like disease in (NZB x NZW)F1, MRL/lpr or BxSB mice is largely unknown (reviewed in reference 1) . The mice develop symp- toms such as generalized B cell hyperactivation, early IgM to IgG class switch, or functional abnormalities in the CD4+ T cell subpopulation indicating the poten- tial involvement oflymphokines in the pathogenesis ofthe disease . This assumption is supported by findings such as decreased IL-2 and IL-2 receptor expression in (NZB x NZW)F1, MRL/lpr and BxSB mice (2), abnormal IL-1 transcripts (3), in- creased IL-4 expression (4), spontaneous transcription of IFN--y (5), and increased TNFa activity in MRL/lpr mice (6) . In contrast, TNFa production was found to be decreased in NZW and (NZB x NZW)F, mice (7) . The authors proposed that decreased TNFet production might be related to a mutation in the TNF-a gene as demonstrated by RFLP analysis . Moreover, administration of TNFa partially abolished the development of the disease . Altogether, the participation of lymphokines in autoimmunity suggested to analyze lymphokine genes at the genetic level . First, we sought to reevaluate the relevance of the TNFa polymorphism in NZB by deter- mining the frequency of this allele in a large number of laboratory and wild mice and found that the TNFa allele ofNZW is inherited in most normal inbred strains and wild mice arguing against an involvement of the NZW TNFa gene as a causal agent in the development of lupus in (NZB x NZW)Fi hybrids .
    [Show full text]