DOCSLIB.ORG

Mice Are Here to Stay

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mice Are Here to Stay Mice A re Here to Stay Wherever people live, there are mice. It would be difficult to find another animal that has adapted to the habitats created by humans as well as the house mouse has. It thus seemed obvious to Diethard Tautz at the Max Planck Institute for Evolutionary Biology in Plön that the species would make an ideal model system for investigating how evolution works. BIOLOGY & MEDICINE_Evolution Mice A re Here to Stay TEXT CORNELIA STOLZE he mice at the Max Planck mice themselves only within a range of can be a key factor in the emergence of Institute in Plön live in their 30 to 50 centimeters, they convey high- new species. For Tautz, the house very own house: they have ly complex messages. mouse is a model for the processes of 16 rooms where they can Diethard Tautz and his colleagues evolution: it would be difficult to find form their family clans and have discovered that house mice be- another animal species that lends itself T territories as they see fit. The experi- have naturally only when they live in so well to the study of the genetic ments Tautz and his colleagues carry a familiar environment and interact mechanisms of evolution. out to study such facets as the rodents’ with other members of their species. “Not only is this species extremely communication, behavior and partner- When animals living in the wild are adaptable, as demonstrated by its dis- ships sometimes take months. During captured, they lose their familiar envi- persal all over the globe, but we also this time, the mice are largely left to ronment: everything smells and tastes know its genome better than that of al- their own devices. Humans enter their different, and they are no longer able most any other species,” says Tautz. Af- realm only to clean up and provide to move about freely. And most impor- ter all, scientists have been breeding them with food and water. tantly, they lack contact with the fam- and studying mice in the laboratory for The mouse house in Plön meets its ily – a key element in the lives of these more than a hundred years, observing inhabitant’s requirements fully. After extremely social animals. their behavior and decoding their ge- all, house mice also live in large family nome. Today’s laboratory mice are de- clans in the wild and maintain exten- A MODEL FOR EVOLUTION scendants of the house mouse, but they sive physical contact and communica- are far less genetically diverse than tion with each other. The squeaking fa- The mice in the mouse house, in con- their wild relatives. miliar to humans is only a small excerpt trast, can indulge in their entire reper- The house mouse’s first ancestors of the rodents’ vocal and sound reper- toire of behaviors. This is the only way lived around 500,000 years ago in the toire. Most of their communication oc- the latest evolutionary development of region that is now Iran, where they curs in the ultrasound range, which is the rodents can be studied, as the re- split into subspecies. When humans not perceptible to the human ear. And sults of research carried out in the past settled there around 14,000 years ago while the sounds can be heard by the showed that differences in behavior and started farming, a new age began While the eyes of the house mouse (Mus musculus) tend to be underdeveloped, the rodent’s nose and ears play a very important role in the social life of its species: their vocalizations are so complex that the animals can even develop “dialects.” Such regional differences influence the mice’s choice of reproductive partner. Photo: MPI for Evolutionary Biology 1 | 18 MaxPlanckResearch 57 Mus musculus musculus Mus musculus domesticus America Mus musculus molossinus Original populations Mus musculus domesticus Mus musculus castaneus Mus spretus Mus spicilegus Mus macedonicus Mus musculus domesticus Colonization routes Contact zone between M. m. domesticus and M. m. musculus Additional contact zones for the mice: they couldn’t resist the tures of just under 5 degrees Celsius. To functional genes can form from parts corn fields and storerooms of the first research this diversity, there are mice of the genome within a short period of farmers. It’s hard to imagine a more re- from all over the world living at the time. These genome sections had pre- liable and convenient source of food. Max Planck Institute in Plön: in addi- viously baffled researchers, as they From then on, the house mouse tion to mice from Germany and France, don’t contain any information that conquered the world in the wake of there are conspecifics from the Faroe Is- can be translated into functional pro- humans. As part of this process, it fol- lands, Spain, Austria, Kazakhstan, Iran teins. For this reason, up to 90 percent lowed different dispersal routes: the and even Taiwan. of the mouse genome was classified as eastern European house mouse (Mus junk DNA. However, the Max Planck musculus musculus) populated north- FROM VEGETARIAN working group discovered that these ern Asia and eastern Europe and adapt- TO CARNIVORE originally functionless DNA sequenc- ed to the continental climate there. es could give rise to new genes. “They The western European house mouse When necessary, the house mouse even really are complete reinventions – some- (Mus musculus domesticus) reached adapted its originally vegetarian eating thing that previously would have been western Europe, with its Atlantic cli- habits. The descendants of the former considered impossible,” explains the mate, on Phoenician merchant ships sea-faring mice, for instance, feed on evolutionary biologist. crossing the Mediterranean. Then, insects, worms and larvae. On the is- By genetically analyzing several with the first European seafarers, they land of Helgoland, they even became mouse species, Tautz and his colleagues made it as far as America, Australia, Tai- accustomed to eating dead sea birds. discovered that only a small percent- wan and even remote archipelagoes They are so flexible that, as long as they age of the DNA is translated into pro- such as the Faroe Islands. have a good food supply, mice don’t teins. Nevertheless, almost every DNA With the first European whalers, the even need direct access to water. section is transcribed into an RNA mol- mouse also penetrated almost as far as A few years ago, Diethard Tautz dis- ecule and can thus be a candidate for a Antarctica, populating regions where it covered a possible key to the evolution- new gene. Sections of DNA that are quickly adapted to average tempera- ary success of the house mouse: new, read but not translated into proteins Graphic: TRENDS in Genetics, vol.19, no.1, January 2003 58 MaxPlanckResearch 1 | 18 BIOLOGY & MEDICINE_Evolution Left page Origin and range of the house mouse: Two million years ago, their closest relatives M. spretus (yellow), M. spicilegus (gray) and M. macedonicus (green) separated; today their ranges overlap in different regions of Europe. Half a million years ago, subspecies of the house mouse then emerged in the area that is now India and Iran. The rodents gradually spread across the globe in the wake of the first farmers: the eastern European house mouse (M. m. musculus) migrated to northern Asia and eastern Europe, the southeastern Asian house mouse (M. m. castaneus) to eastern Asia, and the western European house mouse (M. m. domesticus) to western Europe. From there, the western European house mouse spread to all the other continents by ship. The different subspecies encountered each other in different regions of the world and cross-bred with each other (purple). One example of this is a narrow hybrid zone in central Europe (red line). A new hybrid subspecies, M. m. molossinus, emerged in Japan as a result of the contact between the eastern and Asian house mice. Right Diethard Tautz at the demonstration enclosure in the visitors room at the Max Planck Institute for Evolutionary Biology. The mice live here in a highly diverse environ- ment under nearly natural conditions. The actual experiment rooms are fitted with the same structural elements. are thus called precursor genes or pro- togenes. Whether they become genes or not depends on the environment: if an RNA molecule assumes an import- ant function, the coding section of the DNA remains active and is retained. If the RNA molecule fails to find a useful task, the section becomes non-coding DNA again. But new genes also arise through a second mechanism: when a gene for a protein arises from an originally non-coding section due to a change in the DNA reading frame. A reading frame comprises three consecutive let- ters of the genetic alphabet. Each of these triplets stands for an amino acid into which the genetic code is trans- lated. If this reading frame shifts, new triplets arise and the sequence of let- ters can be translated into amino ac- ids. The scientists in Plön identified several genes that were overwritten due to such a change in the reading Graphic: TRENDS in Genetics, vol.19, no.1, January 2003 Photo: Tom Pingel frame. One example is the Hoxa9 gene 1 | 18 MaxPlanckResearch 59 BIOLOGIE & MEDIZIN_xxxxxxx Diethard Tautz and his colleague – a gene that controls embryonic de- nosaurs became extinct, and in the most Christine Pfeifle have completed all the velopment. In rodents and primates, recent lineage leading to mice. preparations. The inhabitants will now this gene uses an additional, alterna- In addition, whenever the house be left undisturbed for months; their behavior is recorded by cameras. tive reading frame of this kind. mouse encountered a new habitat over The rooms are equipped with wood The researchers suspect that genes the course of evolution, new popula- shavings for burrowing and digging, frequently form anew.
Load more

Recommended publications
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Mouse Models of Human Disease an Evolutionary Perspective Robert L
    170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms.
    [Show full text]
  • Micromys Minutus)
    Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area.
    [Show full text]
  • A Guide to Mites
    A GUIDE TO MITES concentrated in areas where clothes constrict the body, or MITES in areas like the armpits or under the breasts. These bites Mites are arachnids, belonging to the same group as can be extremely itchy and may cause emotional distress. ticks and spiders. Adult mites have eight legs and are Scratching the affected area may lead to secondary very small—sometimes microscopic—in size. They are bacterial infections. Rat and bird mites are very small, a very diverse group of arthropods that can be found in approximately the size of the period at the end of this just about any habitat. Mites are scavengers, predators, sentence. They are quite active and will enter the living or parasites of plants, insects and animals. Some mites areas of a home when their hosts (rats or birds) have left can transmit diseases, cause agricultural losses, affect or have died. Heavy infestations may cause some mites honeybee colonies, or cause dermatitis and allergies in to search for additional blood meals. Unfed females may humans. Although mites such as mold mites go unnoticed live ten days or more after rats have been eliminated. In and have no direct effect on humans, they can become a this area, tropical rat mites are normally associated with nuisance due to their large numbers. Other mites known the roof rat (Rattus rattus), but are also occasionally found to cause a red itchy rash (known as contact dermatitis) on the Norway rat, (R. norvegicus) and house mouse (Mus include a variety of grain and mold mites. Some species musculus).
    [Show full text]
  • A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens
    A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens Pascale Chevret1*, Terence J. Robinson2, Julie Perez3, Fre´de´ric Veyrunes3, Janice Britton-Davidian3 1 Laboratoire de Biome´trie et Biologie Evolutive, UMR CNRS 5558, Universite´ Lyon 1, Villeurbanne, France, 2 Evolutionary Genomics Group, Department of Botany and Zoology, University of Stellenbosch, Stellenbosch, South Africa, 3 Institut des Sciences de l’Evolution de Montpellier, UMR CNRS 5554, Universite´ Montpellier 2, Montpellier, France Abstract The African pygmy mice (Mus, subgenus Nannomys) are a group of small-sized rodents that occur widely throughout sub- Saharan Africa. Chromosomal diversity within this group is extensive and numerous studies have shown the karyotype to be a useful taxonomic marker. This is pertinent to Mus minutoides populations in South Africa where two different cytotypes (2n = 34, 2n = 18) and a modification of the sex determination system (due to the presence of a Y chromosome in some females) have been recorded. This chromosomal diversity is mirrored by mitochondrial DNA sequences that unambiguously discriminate among the various pygmy mouse species and, importantly, the different M. minutoides cytotypes. However, the geographic delimitation and taxonomy of pygmy mice populations in South Africa is poorly understood. To address this, tissue samples of M. minutoides were taken and analysed from specimens housed in six South African museum collections. Partial cytochrome b sequences (400 pb) were successfully amplified from 44% of the 154 samples processed. Two species were identified: M. indutus and M. minutoides. The sequences of the M. indutus samples provided two unexpected features: i) nuclear copies of the cytochrome b gene were detected in many specimens, and ii) the range of this species was found to extend considerably further south than is presently understood.
    [Show full text]
  • Rats and Mice Have Always Posed a Threat to Human Health
    Rats and mice have always posed a threat to human health. Not only do they spread disease but they also cause serious damage to human food and animal feed as well as to buildings, insulation material and electricity cabling. Rats and mice - unwanted house guests! RATS AND MICE ARE AGILE MAMMALS. A mouse can get through a small, 6-7 mm hole (about the diameter of a normal-sized pen) and a rat can get through a 20 mm hole. They can also jump several decimetres at a time. They have no problem climbing up the inside of a vertical sewage pipe and can fall several metres without injuring themselves. Rats are also good swimmers and can be underwater for 5 minutes. IN SWEDEN THERE ARE BASICALLY four different types of rodent that affect us as humans and our housing: the brown rat, the house mouse and the small and large field mouse. THE BROWN RAT (RATTUS NORVEGICUS) THRIVES in all human environments, and especially in damp environments like cellars and sewers. The brown rat is between 20-30 cm in length not counting its tail, which is about 15-23 cm long. These rats normally have brown backs and grey underbellies, but there are also darker ones. They are primarily nocturnal, often keep together in large family groups and dig and gnaw out extensive tunnel systems. Inside these systems, they build large chambers where they store food and build their nests. A pair of rats can produce between 800 and 1000 offspring a year. Since their young are sexually mature and can have offspring of their own at just 2-4 months old, rats reproduce extraordinarily quickly.
    [Show full text]
  • United States Patent (19) 11 Patent Number: 5,348,854 Webster, Jr
    US00534.8854A United States Patent (19) 11 Patent Number: 5,348,854 Webster, Jr. 45) Date of Patent: Sep. 20, 1994 54 METHOD FORDETECTINGPROKARYOTIC vol. 10, No. 2, "Overview of Automation and Identifi ORGANISMS cation,” pp. 18-20, William J. Martin (1979). 76 Inventor: John A. Webster, Jr., 5 Kenmar Dr., American Society for Microbiology News, vol. 49, No. 2, Bldg. 5, Apt. 21, Billerica, Mass. "Impact of Modern Taxonomy on Microbiology,” Don 01821 J. Brenner. International Code of Nomenclature of Bacteria and 21) Appl. No.: 21,551 Selected Statutes... Bacteriological Code, 1976 Revi 22 Filed: Mar. 2, 1987 sions; ASM, Washington, D.C. (1975). Arnot et al., Mol. Biochem. Parasitol. 3:47-56 (1981). Related U.S. Application Data Dunn et al., Cell 12:23-36 (1977). Mattei et al., Chem. Absts, vol. 86, No. 19, p. 267, Ab 63) Continuation of Ser. No. 695,223, Jan. 25, 1985, aban doned, Continuation-in-part of Ser. No. 305,498, Sep. stract No. 1362(e) (1977). 25, 1981, Pat. No. 4,717,653. Moseley, S. L. et al., J. Infect. Dis. 142:892-898 (1980). Acore, R. U., Current Topics in Microbiology and Im 51 Int. Cl. ............................................... C12Q 1/68 munobiology 64:105-128 (1974), edited by Springer, 52 U.S. C. .......................................... 435/6; 435/34; New York. 435/172.1; 435/810; 436/504; 436/545; 436/501; 436/804 Boros et al., Nucl. Acids Res, 6:1817-1830 (1979). 58) Field of Search .................. 435/6, 34, 172.1, 810; Saillard, Colette, J. N. Bove, "Methods in Mycro 436/504, 543, 545, 801, 501; 535/695, 223, 78, plasma,’ vol.
    [Show full text]
  • APPENDIX K: Accepted ECOTOX Data Table
    APPENDIX K: Accepted ECOTOX Data Table The code list for ECOTOX can be found at: http://cfpub.epa.gov/ecotox/blackbox/help/codelist.pdf CAS Number Chemical Name Genus Species Common Name Effect Group Effect Meas Endpt1 Endpt2 Dur Preferred Conc Value1 Preferred Conc Value2 Preferred Conc Units Preferred % Purity Ref # 330541 Diuron Pimephales promelas Fathead minnow ACC ACC GACC BCF 1 TO 24 0.00315 TO 0.0304 mg/L 100 12612 330541 Diuron Rattus norvegicus Norway rat BCM BCM PHPH NOAEL 140 2500 ppm 100 90555 330541 Diuron Zostera capricorni Eelgrass BCM BCM FLRS LOAEL 8.33E-02 0.01 mg/L 100 72996 330541 Diuron Zostera capricorni Eelgrass BCM BCM FLRS LOAEL 8.33E-02 0.01 mg/L 100 72996 330541 Diuron Zostera capricorni Eelgrass BCM BCM FLRS LOAEL 8.33E-02 0.01 mg/L 100 72996 330541 Diuron Seriatopora hystrix Coral BCM BCM FLRS NOEC LOEC 0.416666667 0.0003 0.0003 mg/L 100 75334 330541 Diuron Seriatopora hystrix Coral BCM BCM FLRS EC25 0.416666667 0.00085 mg/L 100 75334 330541 Diuron Seriatopora hystrix Coral BCM BCM FLRS EC50 0.416666667 0.0023 mg/L 100 75334 330541 Diuron Acropora formosa Stony coral BCM BCM FLRS NOEC LOEC 1 0.00003 0.0003 mg/L 100 75334 330541 Diuron Acropora formosa Stony coral BCM BCM FLRS EC25 1 0.0012 mg/L 100 75334 330541 Diuron Acropora formosa Stony coral BCM BCM FLRS EC50 1 0.0027 mg/L 100 75334 330541 Diuron Synechococcus sp. Blue-green algae BCM BCM CHCT NOAEL 3 0.0033 mg/L 99 98904 330541 Diuron Lemna minor Duckweed BCM BCM GLTH LOAEL 2 0.02475 mg/L >99 64164 330541 Diuron Scenedesmus acutus Green Algae BCM BCM
    [Show full text]
  • Growth Hormone Data, No Bootstrap NJ ME MP UPGMA
    Growth hormone data, no bootstrap dog GH dog GH domestic cat GH domestic cat GH pig GH pig GH cattle GH cattle GH sheep GH sheep GH human GH2 human GH2 human GH1 human GH1 rhesus monkey GH1 rhesus monkey GH1 Norway rat Gh1 Norway rat Gh1 house mouse Gh house mouse Gh gray short-tailed opossum GH gray short-tailed opossum GH chicken GH1 chicken GH1 Japanese quail GH complete cds Japanese quail GH complete cds African clawed frog Gh A African clawed frog Gh A beluga GH complete cds beluga GH complete cds banded houndshark GH complete cds banded houndshark GH complete cds zebrafish gh1 zebrafish gh1 North African catfish GH complete cds North African catfish GH complete cds 0.05 0.05 NJ ME dog GH zebrafish gh1 domestic cat GH North African catfish GH complete cds pig GH African clawed frog Gh A cattle GH beluga GH complete cds sheep GH banded houndshark GH complete cds Norway rat Gh1 chicken GH1 house mouse Gh Japanese quail GH complete cds gray short-tailed opossum GH gray short-tailed opossum GH chicken GH1 Norway rat Gh1 Japanese quail GH complete cds house mouse Gh human GH2 human GH2 human GH1 human GH1 rhesus monkey GH1 rhesus monkey GH1 African clawed frog Gh A cattle GH beluga GH complete cds sheep GH banded houndshark GH complete cds dog GH zebrafish gh1 domestic cat GH North African catfish GH complete cds pig GH 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0.00 MP UPGMA Growth hormone data, 1000x bootstrapping 96 dog GH 95 dog GH 85 domestic cat GH 93 domestic cat GH 79 pig GH 81 pig GH cattle GH cattle GH 92 77 100 sheep GH 100 sheep GH
    [Show full text]
  • Controlling House Mice Stephen M
    ® ® University of Nebraska–Lincoln Extension, Institute of Agriculture and Natural Resources Know how. Know now. G1105 (Revised March 2012) Controlling House Mice Stephen M. Vantassel, Project Coordinator—Wildlife Damage; Scott E. Hygnstrom, Extension Wildlife Damage Specialist; and Dennis M. Ferraro, Extension Educator are surprised to learn that house mice can be responsible for so This publication discusses ways to recognize and much noise. A musky odor can occur in areas with long-term control damage caused by house mice. presence by house mice. Finally, mice may be seen during their nocturnal travels, or less frequently, during daylight hours. House mice (Mus musculus) House Mouse Facts are highly adapted House mice are small rodents with relatively large ears and to human environ- small black eyes. They weigh about ½-1 ounce and usually are ments and can thrive light gray in color. An adult is about 5½- to 7½-inches long, under a variety of including the 3- to 4-inch tail. conditions (Figure Although house mice prefer cereal grains, they will eat 1). They are found in almost anything. An adult consumes only 1/10-ounce of food and around homes, per day by nibbling bits of food during its travels. Mice also farms, and urban cache food as supply permits. Mice maintain contact with walls lots, as well as open Figure 1. House mouse. Photo by Robert Timm. with their whiskers and guard hairs to guide them during their fields and agricultural lands. House mice are uncommon in nocturnal travels. Mice are capable of exponential population undisturbed areas away from farms or towns.
    [Show full text]
  • 2Jrb Lichtarge Lab 2006
    Pages 1–5 2jrb Evolutionary trace report by report maker December 2, 2009 4.3.3 DSSP 4 4.3.4 HSSP 4 4.3.5 LaTex 4 4.3.6 Muscle 4 4.3.7 Pymol 4 4.4 Note about ET Viewer 4 4.5 Citing this work 4 4.6 About report maker 4 4.7 Attachments 5 1 INTRODUCTION From the original Protein Data Bank entry (PDB id 2jrb): Title: C-terminal domain of orf1p from mouse line-1 Compound: Mol id: 1; molecule: orf 1 protein; chain: a; fragment: residues 261-347; engineered: yes Organism, scientific name: Mus Musculus; CONTENTS 2jrb contains a single unique chain 2jrbA (65 residues long). This is an NMR-determined structure – in this report the first model in the 1 Introduction 1 file was used. 2 Chain 2jrbA 1 2.1 Q91V68 overview 1 2.2 Multiple sequence alignment for 2jrbA 1 2.3 Residue ranking in 2jrbA 1 2.4 Top ranking residues in 2jrbA and their position on 2 CHAIN 2JRBA the structure 1 2.1 Q91V68 overview 2.4.1 Clustering of residues at 25% coverage. 1 From SwissProt, id Q91V68, 100% identical to 2jrbA: 2.4.2 Possible novel functional surfaces at 25% Description: PORF1. coverage. 2 Organism, scientific name: Mus musculus domesticus (western 3 Notes on using trace results 3 European house mouse). 3.1 Coverage 3 Taxonomy: Eukaryota; Metazoa; Chordata; Craniata; Verte- 3.2 Known substitutions 3 brata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; 3.3 Surface 3 Rodentia; Sciurognathi; Muridae; Murinae; Mus. 3.4 Number of contacts 3 3.5 Annotation 3 3.6 Mutation suggestions 3 2.2 Multiple sequence alignment for 2jrbA 4 Appendix 3 For the chain 2jrbA, the alignment 2jrbA.msf (attached) with 45 4.1 File formats 3 sequences was used.
    [Show full text]
  • Gene Regulation and the Genomic Basis of Speciation and Adaptation in House Mice (Mus Musculus)
    Gene regulation and the genomic basis of speciation and adaptation in house mice (Mus musculus) By Katya L. Mack A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Integrative Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Michael W. Nachman, Chair Professor Rasmus Nielsen Professor Craig T. Miller Fall 2018 Abstract Gene regulation and the genomic basis of speciation and adaptation in house mice (Mus musculus) by Katya Mack Doctor of Philosophy in Integrative Biology University of California, Berkeley Professor Michael W. Nachman, Chair Gene expression is a molecular phenotype that is essential to organismal form and fitness. However, how gene regulation evolves over evolutionary time and contributes to phenotypic differences within and between species is still not well understood. In my dissertation, I examined the role of gene regulation in adaptation and speciation in house mice (Mus musculus). In chapter 1, I reviewed theoretical models and empirical data on the role of gene regulation in the origin of new species. I discuss how regulatory divergence between species can result in hybrid dysfunction and point to areas that could benefit from future research. In chapter 2, I characterized regulatory divergence between M. m. domesticus and M. m. musculus associated with male hybrid sterility. The major model for the evolution of post-zygotic isolation proposes that hybrid sterility or inviability will evolve as a product of deleterious interactions (i.e., negative epistasis) between alleles at different loci when joined together in hybrids. As the regulation of gene expression is inherently based on interactions between loci, disruption of gene regulation in hybrids may be a common mechanism for post-zygotic isolation.
    [Show full text]