DOCSLIB.ORG

Gastrulation in Mus Musculus (Common House Mouse) [1]

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gastrulation in Mus Musculus (Common House Mouse) [1] Published on The Embryo Project Encyclopedia (https://embryo.asu.edu) Gastrulation in Mus musculus (common house mouse) [1] By: Wolter, Justin M. Keywords: Model organisms [2] Mice [3] Gastrulation [4] Germ layers [5] As mice embryos develop, they undergo a stage of development calledg astrulation [7]. The hallmark of vertebrate gastrulation [7] is the reorganization of the inner cell mass [8] (ICM) into the three germ layers [9]: ectoderm [10], mesoderm [11], and endoderm [12]. Mammalian embryogenesis [13] occurs within organisms; therefore, gastrulation [7] was originally described in species with easily observable embryos. For example, the African clawed frog [14] (Xenopus laevis [15]) is a widely used organism to study gastrulation [7] because the large embryos develop inside a translucent membrane. Domestic chickens G( allus gallus) provided researchers another early model to study gastrulation [7] because researchers could open the egg [16] during development to look inside. Despite the challenges associated with studying mammalian gastrulation [7], the common house mouse [17] (Mus musculus) has helped to shed light on the unique adaptations associated with mammalian development. Gastrulation in the mouse [6] begins shortly after a blastula [18] implants into the uterine wall of the mother, and is immediately followed by the development of the various organ systems (organogenesis [19]). This coordinated movement of cells results in a spatially organized embryo, and assembles the framework upon which future developmental processes will build the body. The term for an embryo undergoing gastrulation [7] is the gastrula [20], a term coined by Ernst Haeckel [21] Germany in 1872, and expanded upon in his 1874 Studien zur Gastraea-theorie (Studies for the Gastrea Theory). The Latin root gaster means stomach, and the term gastrulation [7] refers to the formation of the gut. In the mouse [6] there is a two-day gap between implantation [22] and the beginning of gastrulation [7]; the blastocyst [23] implants in the uterine wall four and a half days post coitum (DPC), and gastrulation [7] begins six and a half DPC. During that two-day period, cells change within the developing fertilized egg [24] (zygote [25]). During cleavage cells are held together by adhesion proteins, which must be deactivated to allow individual cells to move. The relaxed cellular bonds allow the inner cell mass [8] (ICM) to expand and reorganize into distinct layers. One of these layers, the epiblast [26], is a sheet of cells, which are the precursors of all the cells of the embryo. As the epiblast [26] grows, it takes the shape of a cup, with the rim located on dorsal side of the embryo. Gastrulation begins with the formation of the primitive node on the posterior side of the epiblast [26]. The primitive node is a knot of cells that secretes cellular signals in the form of proteins, such as fibroblast growth factor (FGF). Those signals help cells migrate within the embryo during gastrulation [7]. The appearance of the node is also the first indication of head to tail distinction (anterior-posterior polarity [27]). From the node a structure called the primitive streak [28] forms. The primitive streak [28] is a groove that extends from the primitive node towards the ventral side of the embryo. As the primitive streak [28] elongates, epiblast [26] cells that are on the inside of the cup ingress up into the streak. As a cell moves into the primitive streak [28], it interacts with cellular signals, which restrict the type of tissues the cell can form. The cells that move through the streak become mesendoderm, which are the precursors of mesoderm [11] cells and endoderm [12] cells. After they exit the primitive streak [28], the cells disperse and create a wave of mesendoderm that expands to cover the outside of the embryo. In the mouse [6] the mesendoderm engulfs the ectoderm [10], which will later form the nervous system and epidermis. The mesendoderm differentiates into mesoderm [11]; which becomes the skeleton, muscles, and various internal organs; and the endoderm [12], which then becomes the gastrointestinal and respiratory systems. The mesoderm [11] forms on the anterior portion of the embryo, and the endoderm [12] forms on the posterior side where the primitive streak [28] originated. The endoderm [12] and mesoderm [11] completely differentiate from each other around sixteen DPC. At that time, the organizer [29] node of the mouse [6] embryo forms from mesoderm [11] at the ventral pole of the cup shaped gastrula [20]. The node is functionally similar to the Spemann-Mangold organizer [29] in amphibians [30] and to Henson's node in chicks. The formation of the organizer [29] node establishes a left-right axis in the mouse [6] embryo. Similar to cells that emerge from the primitive streak [28] at the posterior end, cells moving through the node move in an anterior direction, creating a U- shaped area of mesoderm [11] that will fold into the gut tube. Next, the precursors of the neural plate [31] form from the ectoderm [10] on the inside of the cup. This anterior-ventral ectoderm [10] originates adjacent to the node and migrates to the anterior pole, marking the initial step in the development of the nervous system. While scientists often use gastrulation [7] in the mouse [6] as a model for gastrulation [7] in other mammals, the ordering of the germ layers [9] is exactly opposite of most other mammals. In humans—as is typical with most mammals—the gastrula [20] arranges in flat shape, called a planar arrangement, with the ectoderm [10] located on the dorsal side of the mesoderm [11] and endoderm [12]. Despite this morphological peculiarity of the mouse [6], the cup-shaped mouse [6] gastrula [20] has a similar surface 1 area compared to the planar configurations found in other mammals. Later, during organogenesis [19], the mouse [6] gastrula [20] inverts into a shape more consistent with other mammals. Gastrulation is a process common to all animals, and researchers investigate its evolutionary origins partly to understand how complex animals evolved. Gastrulation recapitulates the evolutionary transition from organisms with two germ layers [9] (diploblastic), to organism with three germ layers [9] (triploblastic) and a digestive system. Some researchers map the gene regulatory networks [32] that operate during gastrulation [7]. They do so to expand our molecular knowledge of the signaling factors involved, and to uncover the evolutionary origins of gastrulation [7]. Sources 1. Gilbert, Scott F. Developmental Biology [33], 9th edition. Sunderland, MA: Sinauer, 2010. 2. Haeckel, Ernst. Die Kalkschwämme. Eine Monographie [The calcareous sponges. A Monograph]. Berlin: Georg Reimer, 1872. http://dx.doi.org/10.5962/bhl.title.11323 [34] (Accessed October 4, 2012). 3. Haeckel, Ernst. Studien zur Gastraea-theorie [Studies for the Gastrea Theory]. Jena: Hermann Dufft, 1877. http://dx.doi.org/10.5962/bhl.title.3970 [35] (Accessed October 4, 2012) 4. Stern, Claudio D. Gastrulation: from cells to embryo. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory [36] Press, 2004. 5. Tam, Patrick, Richard Behringer. “Mouse Gastrulation: The Formation of a Mammalian Body Plan.”M echanisms of Development 68 (1997): 3–25. As mice embryos develop, they undergo a stage of development called gastrulation. The hallmark of vertebrate gastrulation is the reorganization of the inner cell mass (ICM) into the three germ layers: ectoderm, mesoderm, and endoderm. Mammalian embryogenesis occurs within organisms; therefore, gastrulation was originally described in species with easily observable embryos. For example, the African clawed frog (Xenopus laevis) is the most widely used organism to study gastrulation because the large embryos develop inside a translucent membrane. Domestic chicken (Gallus gallus) gastrulation was also an early model organism because researchers could open the egg during development to look inside. Despite the challenges associated with studying mammalian gastrulation, the common house mouse (Mus musculus) has helped to shed light on the unique adaptations associated with mammalian development, and on the subtle differences in structure that give rise to significant divergence in late embryogenesis. Subject Gastrulation [37] [38] mice [39] Germ Cells [40] Somatic embryogenesis [41] Embryos [42] Embryological development [43] Cell differentiation [44] Embryology [45] Fertilization (Biology) [46] Gastrulation [47] Topic Processes [48] Experiments [49] Publisher Arizona State University. School of Life Sciences. Center for Biology and Society. Embryo Project Encyclopedia. Rights © Arizona Board of Regents Licensed as Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported (http://creativecommons.org/licenses/by-nc-sa/3.0/) Format Articles [50] Last Modified Wednesday, July 4, 2018 - 04:40 DC Date Accessioned Monday, November 5, 2012 - 19:10 DC Date Available Monday, November 5, 2012 - 19:10 DC Date Created 2012-10-04 2 DC Date Created Standard Thursday, October 4, 2012 - 07:00 Contact Us © 2019 Arizona Board of Regents The Embryo Project at Arizona State University, 1711 South Rural Road, Tempe Arizona 85287, United States Source URL: https://embryo.asu.edu/pages/gastrulation-mus-musculus-common-house-mouse Links [1] https://embryo.asu.edu/pages/gastrulation-mus-musculus-common-house-mouse [2] https://embryo.asu.edu/keywords/model-organisms [3] https://embryo.asu.edu/keywords/mice [4] https://embryo.asu.edu/keywords/gastrulation [5] https://embryo.asu.edu/keywords/germ-layers
Load more

Recommended publications
  • From Bipotent Neuromesodermal Progenitors to Neural-Mesodermal Interactions During Embryonic Development
    International Journal of Molecular Sciences Review From Bipotent Neuromesodermal Progenitors to Neural-Mesodermal Interactions during Embryonic Development Nitza Kahane and Chaya Kalcheim * Department of Medical Neurobiology, Institute of Medical Research Israel-Canada (IMRIC) and the Edmond and Lily Safra Center for Brain Sciences (ELSC), Hebrew University of Jerusalem-Hadassah Medical School, P.O. Box 12272, Jerusalem 9112102, Israel; [email protected] * Correspondence: [email protected] Abstract: To ensure the formation of a properly patterned embryo, multiple processes must operate harmoniously at sequential phases of development. This is implemented by mutual interactions between cells and tissues that together regulate the segregation and specification of cells, their growth and morphogenesis. The formation of the spinal cord and paraxial mesoderm derivatives exquisitely illustrate these processes. Following early gastrulation, while the vertebrate body elongates, a pop- ulation of bipotent neuromesodermal progenitors resident in the posterior region of the embryo generate both neural and mesodermal lineages. At later stages, the somitic mesoderm regulates aspects of neural patterning and differentiation of both central and peripheral neural progenitors. Reciprocally, neural precursors influence the paraxial mesoderm to regulate somite-derived myogen- esis and additional processes by distinct mechanisms. Central to this crosstalk is the activity of the axial notochord, which, via sonic hedgehog signaling, plays pivotal roles in neural, skeletal muscle and cartilage ontogeny. Here, we discuss the cellular and molecular basis underlying this complex Citation: Kahane, N.; Kalcheim, C. developmental plan, with a focus on the logic of sonic hedgehog activities in the coordination of the From Bipotent Neuromesodermal Progenitors to Neural-Mesodermal neural-mesodermal axis.
    [Show full text]
  • Disease and Clinical Signs Poster
    African Clawed Frog Xenopus laevis Diseases and Clinical Signs in Photographs Therese Jones-Green University Biomedical Services Abstract Reported clinical signs associated with ill health and Clinical signs found between 2016 to 2018 Many diseases of Xenopus laevis frogs have been described in the • Opened in 2005, the biofacility can hold up to 900 female and 240 disease Clinical signs found between 2016 to 2018 male frogs in a Marine Biotech (now serviced by MBK Installations Ltd.) • 80 recirculating aquatic system. • Buoyancy problems 70 bridge this gap using photographs taken of frogs with clinical signs. The system monitors parameters such as: temperature, pH, • • Changes in activity e.g. lethargy or easily startled. My aims are: conductivity, and Total Gas Pressure. 60 • Unusual amount of skin shedding. 2018 • To share my experiences, via images, to help improve the welfare and • Frogs are maintained on mains fed water with a 20% water exchange. 50 ases • Weight loss, or failure to feed correctly. c husbandry of this species. • 2017 • Coelomic (body cavity) distention. 40 • To stimulate a dialogue which results in further sharing of ideas and 2016 Whole body bloat. 30 information. • Frogs are held under a 12 hour light/dark cycle. • Number of • Each tank has a PVC enrichment tube (30cm x 10cm), with smoothed • Fungal strands/tufts. 20 Introduction cut edges. • Sores or tremors at extremities (forearms and toes). 10 Between January 2016 and October 2018, cases of ill health and disease • Frogs are fed three times a week with a commercial trout pellet. • Redness or red spots. 0 Oedema Red leg Red leg (bad Red leg Gas bubble Sores on forearm Opaque cornea Skeletal Growth (cartilage Scar Cabletie Missing claws Eggbound in a colony of Xenopus laevis frogs housed by the University Biological hormone) (nematodes) disease deformity under skin) • The focus of the research undertaken in the biofacility is embryonic and • Excessive slime/mucous production or not enough (dry dull skin).
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Mouse Models of Human Disease an Evolutionary Perspective Robert L
    170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms.
    [Show full text]
  • Micromys Minutus)
    Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area.
    [Show full text]
  • A Guide to Mites
    A GUIDE TO MITES concentrated in areas where clothes constrict the body, or MITES in areas like the armpits or under the breasts. These bites Mites are arachnids, belonging to the same group as can be extremely itchy and may cause emotional distress. ticks and spiders. Adult mites have eight legs and are Scratching the affected area may lead to secondary very small—sometimes microscopic—in size. They are bacterial infections. Rat and bird mites are very small, a very diverse group of arthropods that can be found in approximately the size of the period at the end of this just about any habitat. Mites are scavengers, predators, sentence. They are quite active and will enter the living or parasites of plants, insects and animals. Some mites areas of a home when their hosts (rats or birds) have left can transmit diseases, cause agricultural losses, affect or have died. Heavy infestations may cause some mites honeybee colonies, or cause dermatitis and allergies in to search for additional blood meals. Unfed females may humans. Although mites such as mold mites go unnoticed live ten days or more after rats have been eliminated. In and have no direct effect on humans, they can become a this area, tropical rat mites are normally associated with nuisance due to their large numbers. Other mites known the roof rat (Rattus rattus), but are also occasionally found to cause a red itchy rash (known as contact dermatitis) on the Norway rat, (R. norvegicus) and house mouse (Mus include a variety of grain and mold mites. Some species musculus).
    [Show full text]
  • A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens
    A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens Pascale Chevret1*, Terence J. Robinson2, Julie Perez3, Fre´de´ric Veyrunes3, Janice Britton-Davidian3 1 Laboratoire de Biome´trie et Biologie Evolutive, UMR CNRS 5558, Universite´ Lyon 1, Villeurbanne, France, 2 Evolutionary Genomics Group, Department of Botany and Zoology, University of Stellenbosch, Stellenbosch, South Africa, 3 Institut des Sciences de l’Evolution de Montpellier, UMR CNRS 5554, Universite´ Montpellier 2, Montpellier, France Abstract The African pygmy mice (Mus, subgenus Nannomys) are a group of small-sized rodents that occur widely throughout sub- Saharan Africa. Chromosomal diversity within this group is extensive and numerous studies have shown the karyotype to be a useful taxonomic marker. This is pertinent to Mus minutoides populations in South Africa where two different cytotypes (2n = 34, 2n = 18) and a modification of the sex determination system (due to the presence of a Y chromosome in some females) have been recorded. This chromosomal diversity is mirrored by mitochondrial DNA sequences that unambiguously discriminate among the various pygmy mouse species and, importantly, the different M. minutoides cytotypes. However, the geographic delimitation and taxonomy of pygmy mice populations in South Africa is poorly understood. To address this, tissue samples of M. minutoides were taken and analysed from specimens housed in six South African museum collections. Partial cytochrome b sequences (400 pb) were successfully amplified from 44% of the 154 samples processed. Two species were identified: M. indutus and M. minutoides. The sequences of the M. indutus samples provided two unexpected features: i) nuclear copies of the cytochrome b gene were detected in many specimens, and ii) the range of this species was found to extend considerably further south than is presently understood.
    [Show full text]
  • Rats and Mice Have Always Posed a Threat to Human Health
    Rats and mice have always posed a threat to human health. Not only do they spread disease but they also cause serious damage to human food and animal feed as well as to buildings, insulation material and electricity cabling. Rats and mice - unwanted house guests! RATS AND MICE ARE AGILE MAMMALS. A mouse can get through a small, 6-7 mm hole (about the diameter of a normal-sized pen) and a rat can get through a 20 mm hole. They can also jump several decimetres at a time. They have no problem climbing up the inside of a vertical sewage pipe and can fall several metres without injuring themselves. Rats are also good swimmers and can be underwater for 5 minutes. IN SWEDEN THERE ARE BASICALLY four different types of rodent that affect us as humans and our housing: the brown rat, the house mouse and the small and large field mouse. THE BROWN RAT (RATTUS NORVEGICUS) THRIVES in all human environments, and especially in damp environments like cellars and sewers. The brown rat is between 20-30 cm in length not counting its tail, which is about 15-23 cm long. These rats normally have brown backs and grey underbellies, but there are also darker ones. They are primarily nocturnal, often keep together in large family groups and dig and gnaw out extensive tunnel systems. Inside these systems, they build large chambers where they store food and build their nests. A pair of rats can produce between 800 and 1000 offspring a year. Since their young are sexually mature and can have offspring of their own at just 2-4 months old, rats reproduce extraordinarily quickly.
    [Show full text]
  • Helical Insertion of Peptidoglycan Produces Chiral Ordering of the Bacterial Cell Wall
    Helical insertion of peptidoglycan produces PNAS PLUS chiral ordering of the bacterial cell wall Siyuan Wanga,b, Leon Furchtgottc,d, Kerwyn Casey Huangd,1, and Joshua W. Shaevitza,e,1 aLewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544; bDepartment of Molecular Biology, Princeton University, Princeton, NJ 08544; cBiophysics Program, Harvard University, Cambridge, MA 02138; dDepartment of Bioengineering, Stanford University, Stanford, CA 94305; and eDepartment of Physics, Princeton University, Princeton, NJ 08854 AUTHOR SUMMARY Cells from all kingdoms of wall growth to demonstrate life face the task of that patterning of cell-wall constructing a specific, synthesis by left-handed mechanically robust three- MreB polymers leads to a dimensional (3D) cell shape right-handed chiral from molecular-scale organization of the glycan components. For many strands. This organization bacteria, maintaining a rigid, produces a left-handed rod-like shape facilitates a twisting of the cell body diverse range of behaviors during elongational growth. including swimming motility, We then confirm the detection of chemical existence of right-handed gradients, and nutrient access Fig. P1. Helical insertion of material into the bacterial cell wall (green) glycan organization in E. coli during elongational growth, guided by the protein MreB (yellow), leads and waste evacuation in by osmotically shocking biofilms. The static shape of to an emergent chiral order in the cell-wall network and twisting of the cell that can be visualized using surface-bound beads (red). surface-labeled cells and a bacterial cell is usually directly measuring the defined by the cell wall, a difference in stiffness macromolecular polymer network composed of glycan strands between the longitudinal and transverse directions.
    [Show full text]
  • High Abundance of Invasive African Clawed Frog Xenopus Laevis in Chile: Challenges for Their Control and Updated Invasive Distribution
    Management of Biological Invasions (2019) Volume 10, Issue 2: 377–388 CORRECTED PROOF Research Article High abundance of invasive African clawed frog Xenopus laevis in Chile: challenges for their control and updated invasive distribution Marta Mora1, Daniel J. Pons2,3, Alexandra Peñafiel-Ricaurte2, Mario Alvarado-Rybak2, Saulo Lebuy2 and Claudio Soto-Azat2,* 1Vida Nativa NGO, Santiago, Chile 2Centro de Investigación para la Sustentabilidad & Programa de Doctorado en Medicina de la Conservación, Facultad de Ciencias de la Vida, Universidad Andres Bello, Republica 440, Santiago, Chile 3Facultad de Ciencias Exactas, Departamento de Matemáticas, Universidad Andres Bello, Santiago, Republica 470, Santiago, Chile Author e-mails: [email protected] (CSA), [email protected] (MM), [email protected] (DJP), [email protected] (APR), [email protected] (MAR), [email protected] (SL) *Corresponding author Citation: Mora M, Pons DJ, Peñafiel- Ricaurte A, Alvarado-Rybak M, Lebuy S, Abstract Soto-Azat C (2019) High abundance of invasive African clawed frog Xenopus Invasive African clawed frog Xenopus laevis (Daudin, 1802) are considered a major laevis in Chile: challenges for their control threat to aquatic environments. Beginning in the early 1970s, invasive populations and updated invasive distribution. have now been established throughout much of central Chile. Between September Management of Biological Invasions 10(2): and December 2015, we studied a population of X. laevis from a small pond in 377–388, https://doi.org/10.3391/mbi.2019. 10.2.11 Viña del Mar, where we estimated the population size and evaluated the use of hand nets as a method of control. First, by means of a non-linear extrapolation Received: 26 October 2018 model using the data from a single capture session of 200 min, a population size of Accepted: 7 March 2019 1,182 post-metamorphic frogs (range: 1,168–1,195 [quadratic error]) and a density Published: 16 May 2019 of 13.7 frogs/m2 (range: 13.6–13.9) of surface water were estimated.
    [Show full text]
  • Genes for Extracellular Matrix-Degrading Metalloproteinases and Their Inhibitor, TIMP, Are Expressed During Early Mammalian Development
    Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Genes for extracellular matrix-degrading metalloproteinases and their inhibitor, TIMP, are expressed during early mammalian development Carol A. Brenner, 1 Richard R. Adler, 2 Daniel A. Rappolee, Roger A. Pedersen, and Zena Werb 3 Laboratory of Radiobiology and Environmental Health, and Department of Anatomy, University of California, San Francisco, California 94143-0750 USA Extracellular matrix (ECM) remodeling accompanies cell migration, cell--cell interactions, embryo expansion, uterine implantation, and tissue invasion during mammalian embryogenesis. We have found that mouse embryos secrete functional ECM-degrading metalloproteinases, including collagenase and stromelysin, that are inhibitable by the tissue inhibitor of metalloproteinases (TIMP) and that are regulated during peri-implantation development and endoderm differentiation, mRNA transcripts for collagenase, stromelysin, and TIMP were detected as maternal transcripts in the unfertilized egg, were present at the zygote and cleavage stages, and increased at the blastocyst stage and with endoderm differentiation. These data suggest that metalloproteinases function in cell-ECM interactions during growth, development, and implantation of mammalian embryos. [Key Words: Collagenase; stromelysin; polymerase chain reaction; tissue inhibitor of metalloproteinases; maternal mRNA; endoderm differentiation] January 31, 1989; revised version accepted March 15, 1989. The extracellular matrix (ECM) forms a substrate for cell 1988}. The activity of these proteinases is regulated by attachment and migration and directs cell form and the tissue inhibitor of metalloproteinases {TIMPI function through cell-ECM interactions. ECM macro- (Murphy et al. 1985; Herron et al. 1986a, b; Gavrilovic et molecules first appear in the mammalian embryo in the al.
    [Show full text]
  • Mice Are Here to Stay
    Mice A re Here to Stay Wherever people live, there are mice. It would be difficult to find another animal that has adapted to the habitats created by humans as well as the house mouse has. It thus seemed obvious to Diethard Tautz at the Max Planck Institute for Evolutionary Biology in Plön that the species would make an ideal model system for investigating how evolution works. BIOLOGY & MEDICINE_Evolution Mice A re Here to Stay TEXT CORNELIA STOLZE he mice at the Max Planck mice themselves only within a range of can be a key factor in the emergence of Institute in Plön live in their 30 to 50 centimeters, they convey high- new species. For Tautz, the house very own house: they have ly complex messages. mouse is a model for the processes of 16 rooms where they can Diethard Tautz and his colleagues evolution: it would be difficult to find form their family clans and have discovered that house mice be- another animal species that lends itself T territories as they see fit. The experi- have naturally only when they live in so well to the study of the genetic ments Tautz and his colleagues carry a familiar environment and interact mechanisms of evolution. out to study such facets as the rodents’ with other members of their species. “Not only is this species extremely communication, behavior and partner- When animals living in the wild are adaptable, as demonstrated by its dis- ships sometimes take months. During captured, they lose their familiar envi- persal all over the globe, but we also this time, the mice are largely left to ronment: everything smells and tastes know its genome better than that of al- their own devices.
    [Show full text]