Brachyury Mice

Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Rescue of the tail defect of Brachyury mice

David Stott, ~'2 Andreas Kispert, and Bernhard G. Herrmann Max-Planck-Institut fiir Entwicklungsbiologie, 7400 Tfibingen, Germany

The mouse Brachyury (T) gene is required for normal development of axial structures. Embryos homozygous for the T mutation show severe deficiencies in mesoderm formation. They lack the notochord and allantois, have abnormal somites, and die at -10 days postcoitum probably as a result of the allantois defect. Mice heterozygous for the T mutation exhibit a variable short-tailed phenotype. The T gene has been cloned and shown to be expressed in the tissues most strongly affected by the mutation. In this paper, we show that a single-copy transgene representing the wild-type T allele is able to rescue the T-associated tail phenotype. In addition, we show that increasing dosage of the T gene in T~/+ mice causes an increased extension of the axis. These data show the correlation of the level of T product with the extension of the anteroposterior axis, directly demonstrating the involvement of the T product in this process. [Key Words: Brachyury; mouse development; phenotypic rescue; axis; mouse embryo; tail interaction factor] Received September 24, 1992; revised version accepted November 17, 1992.

Identification and cloning of genes encoding products re- about this axis. The inner layer of cells, referred to as the quired for essential developmental processes has proved primitive ectoderm or epiblast, is thought to give rise to to be a productive route toward understanding the mech- all structures of the embryo proper (Gardner and Papaio- anisms underlying cellular differentiation and pattern annou 1975; Gardner and Rossant 1979; Gardner et al. formation during animal development. In the case of the 1985; Beddington et al. 1989}, whereas the outer layer, mammalian embryo, long life cycles, intrauterine devel- the visceral endoderm, appears essentially not to con- opment, and genome size mitigate against genetic tribute to the embryo (Lawson et al. 1991). This cylinder screens to identify large numbers of loci encoding differ- is surrounded by the parietal yolk sac, composed of pa- ent functional components involved in particular events. rietal endoderm and trophoblast cells, which interacts An alternative approach is to work from the product of a directly with maternal tissues. The first indication of the single locus shown to be required for an event in an anteroposterior axis of the developing embryo is the ap- attempt to understand its role in development and, sub- pearance of the primitive streak, which forms initially sequently, identify interacting components. We have about halfway along the length of the cylinder and ex- chosen to study the action of the product of a gene, tends, in the space of -8 hr, to the distal tip. The streak Brachyury or T, which is known from the phenotype of is a region of the egg cylinder where cells leave the inner mutant strains of mice to be required for the processes of layer--referred to as the epiblast or primitive ectoderm--to mesoderm formation and anteroposterior axis elabora- migrate away between the two layers of the cylinder (Na- tion in the mammalian embryo (Chesley 1935; Glueck- katsuji et al. 1986) eventually forming paraxial meso- sohn-Schoenheimer 1944; Spiegelman 1976). This gene derm and other mesodermal cell types. The appearance has been cloned (Herrmann et al. 1990) and shown to be of the primitive streak defines the posterior end of the expressed in the embryonic tissues most strongly af- axis, which is initially U-shaped, running from the prim- fected by the mutation (Wilkinson et al. 1990; Herrmann itive streak around the distal tip to the future anterior of 1991). The availability of several mutant T alleles plus the embryo on the other side of the cylinder. After ex- the cloned gene sequences allow access to the study of tension of the primitive streak, a structure forms at the the function of this gene during axis formation. distal tip of the egg cylinder, referred to as the archen- Before the appearance of the primitive streak, the teron or node. At the node, cells also emerge from the mammalian embryo consists of a two-layered cylinder inner layer but, instead of migrating between the two possessing obvious proximal distal polarity with refer- pre-existing layers, remain at the midline and intercalate ence to maternal tissues, but apparent radial symmetry into the visceral endoderm layer to form axial mesoderm, the notochordal plate, and subsequently notochord (Jurand 1974; Lawson et al. 1991). ICorresponding author. 2present address: Animal Molecular Genetics Group,Department of Bi- In T mutant embryos, all mesodermal cell types are ological Sciences, University of Warwick, Coventry, CV4 7AL, U.K. defective. Whereas mice heterozygous for a deletion at

GENES & DEVELOPMENT7:197-203 91993 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/93 $3.00 197 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Stott et al. the Brachyury locus display a viable short-tailed pheno- and 5 kb of 3' nontranscribed flanking sequence (Fig. 1), type, embryos homozygous for the null allele, T, form was excised from cosmid c2.190 [isolated from a 129 insufficient axial and paraxial mesoderm resulting in the strain genomic library (Herrmann et al. 1990)] using ClaI failure of the extension of the axis during early organo- and injected into fertilized eggs derived from matings of genesis and subsequent embryonic mortality, probably CBA x C57B1/6 F: mice. This fragment can be detected owing to inability to form the allantois (Chesley 1935; either by polymerase chain reaction (PCR) using primers Gluecksohn-Schoenheimer 1938; Grueneberg 1958; that amplify 220 bp of a 352-bp region of vector se- Yanagisawa et al. 1981). Abnormalities of the neural quences present at the 5' end of the transgene fragment tube are probably the result of secondary effects resulting (Figs. 1 and 3) or by genomic Southern blotting using a from the notochord deficiency. Analysis of the severity probe (190R10RS) that detects a TaqI polymorphism of the phenotype resulting from different T alleles has present between strain 129 and both CBA and C57B1/6 led to the proposal that continuing axial elaboration re- mice (Fig. 2a; see Materials and methods). Of a total of 55 quires increasingly high doses of the T product (MacMur- live-born offspring produced in three experiments, only 1 ray and Shin 1988; Yanagisawa 1990). In addition, the (designated 118.9) carried the transgene fragment, which recent observation that expression of the Xenopus ho- was present as a single copy (Fig. 2a) and is referred to as molog of Brachyury is an immediate early response to a TG T. This animal was phenotypically normal. Careful signal that mimics mesoderm induction in vitro, sup- examination revealed no difference in tail phenotype ports the proposal that the Brachyury product plays a compared with nontransgenic littermates. As 1 in 55 rep- key role in the establishment and elaboration of the me- resents an unusually low rate of transgenesis (which is soderm and, hence, of the anteroposterior axis (Smith et usually between 15% and 35% of live-born animals in al. 1991). our hands), a further experiment was performed in which In this work we show that a single-copy transgene in- injected embryos were recovered after 9 days postreim- cluding all transcribed sequences of the Brachyury gene, plantation, at the four- to eight-somite stage. Of 21 em- is sufficient to completely rescue the short tailed pheno- bryos recovered, 7 tested positive for the presence of the type of mice heterozygous for the T mutation, establish- transgene using PCR. This result suggests that the pres- ing beyond doubt that the cloned gene responsible for the ence of extra copies of the T gene may be deleterious to observed phenotype. Furthermore, by manipulating the successful development to term, but as yet no obvious copy number of the T gene in transgenic mice, we show phenotype has been detected. a direct correlation between levels of T product and axial extension. Complementation of the tail phenotype of Brachyury mutants Results To test the ability of TG T to substitute for the wild-type Generation of transgenic mice carrying an extra copy of the mouse T gene Brachyury allele, founder mouse 118.9 was crossed to mice that carried either the T mutant version of chro- Previously, we have cloned a gene which, based on the mosome 17 or the T Curtailed (7~) allele. Like T, 7~ was alteration of its transcription unit in the T w~s allele and X-ray induced and exhibits an embryonic lethal homozy- its expression in tissues affected by the mutation, most gous phenotype; but, in contrast to the variable short- likely represents the mouse T gene (Herrmann et al. tailed phenotype of T/+ animals, heterozygous 7~ mice 1990; Wilkinson et al. 1990). To test whether the prod- invariably completely lack tails and exhibit relatively uct of this RNA is capable of rescuing the phenotype of high mortality between birth and weaning (Searle 1966). Brachyury mice, we first characterized the structure of Both alleles result in a lethal homozygous phenotype, in the genomic locus corresponding to the eDNA clone which posterior regions of the embryo fail to form (see pme75 using a combination of sequencing of genomic introductory section). Sequencing of the transcribed re- subclones to identify the number and positions of exons gions of Brachyury genomic clones isolated from a li- and RNase protection and primer extension analysis to brary produced from 7-~/+ DNA revealed a 19-bp dele- ascertain the transcriptional start site (data not shown). tion in the 3' end of the open reading frame (from base The eDNA lacks 50 bases of nontranslated 5' sequence, 1269 to 1287 in Fig. 5 of Herrmann et al. 1990), resulting which is contained within the same exon as the 5' end of in an altered predicted protein product in which the car- the cDNA. A 23-kb genomic fragment, including the en- boxy-terminal 50 amino acids are substituted for 32 un- tire transcribed sequences of the T gene plus 8.3 kb of 5' related residues. The presence of the 7-~ allele in offspring

Vec~r 5" 3"

I kb

Figure 1. DNA fragment used to generate transgenic mice. Solid boxes indicate untranslated and open boxes translated exon sequences. Vector sequences used for detection of the transgene fragment are indicated at the left end.

198 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Phenotypic rescue of Brachyury

were produced consisting of a total of 38 offspring; 12 of the 38 animals carried the T ~ allele in the absence of TG x and were tailless, whereas 10 animals that carried the T ~ allele in the presence of TG T all had short tails. The length of the tail varied from one-eighth to three-fourths of normal tail length. In crosses between 118.9 and a T/+ male, three litters were produced consisting of 21 offspring; 7 carried the T chromosome in the absence of TG t and possessed short tails, whereas 6 animals carried both the T chromosome and TG T and had normal tails (Table 1). In second-generation crosses, animals carrying TG T in the presence of the T ~ allele were mated to T~ + animals. The progeny were tested for T, T~, and TG T. Of 13 animals carrying the T ~ allele plus TG T 11 showed partial rescue of the tailless phenotype. Of 14 animals carrying the T chromosome in the presence of TG T 13 showed complete rescue of the short-tailed phenotype. A Figure 2. Genomic Southern blot detection of TG T and T (a) total of 15 animals, from both first- and second-genera- Autoradiograph of a Southern blot of Taq I-digested DNA hy- tion crosses, carried three normal copies of the bridized with probe 190R10RS, which detects a TaqI polymor- Brachyury gene ( + / + ; TGT/0; Table 1). The tail length phism between CBA/C57B1/6 and 129 strain mice within 1.2 of these animals was measured but did not differ signif- kb of the transcriptional start of the T gene. DNA was prepared from 129 (lane 1), CBA/C57B1/6 F 1 (lane 2), or from transgenic icantly from that of wild-type littermates. founder 118.9 (lane 3). (b) Southern blot of BamHI-digested DNA hybridized with probe 119AR, which detects a BamHI Correlation of the gene dosage of Brachyury polymorphism tightly linked to the T deletion. (Lane 1 ) Progeny with the extension of the anteroposterior axis of T~ + crossed to CBA/C57B1/6 F2; (lane 2) T/+ ; (lane 3) CBA; (lane 4) C57B1/6. Arrows indicate bands tightly linked to the T To examine the effect of two copies of TG T on the phe- deletion. notype of T~/+ mice, animals of the genotype T~/+; TGT/0 were intercrossed, and the genotype of the offspring was checked by PCR for the presence of the trans- was detected by PCR using primers that flank the 19-bp gene and the T ~ allele. Animals in which both were deletion (Fig. 3; data not shown), and the T chromosome present were tested for homozygosity by outcrossing and was demonstrated by Southern blotting using a probe testing the offspring for the two sequences. A total of (pll9AR; probe C in Herrmann et al. 1987), which de- nine mice of the genotype T~/+; TGT/TG T were pro- tects a BamHI polymorphism tightly linked to the T deletion (Fig. 2b). In crosses between 118.9 and a T~/+ male, four litters Table 1. Phenotypes and genotypes of first- and second-generation offspring from transgenic founder 118.9 ( q-/ +;TGT/O) crossed to T/ + or TC/+ males Tail phenotypes Genotype normal short absent total First-generation crosses (118.9 x T~/+) TV+ 0 0 12 12 TV + ;TGT/0 0 10 0 10 +/+ 6 0 0 6 +/+;TGT/O 10 0 0 10 First-generation crosses (118.9 x T~ + ) T/+ 0 7 0 7 T~ + ;TGT/0 6 0 0 6 +/+ 7 0 0 7 + / + ;TGT/0 1 0 0 1 Second-generation crosses (T~/+ ;TGT/0 x T~ + ) T~/+ 0 0 12 12 Figure 3. PCR detection of transgene and T ~ allele. Genomic TV + ;TGT/O 0 11 2 13 DNA (0.1-1 ~g) was amplified using primer pairs that flank the +/+ 19 0 0 19 19-bp deletion in the T ~ allele (lanes 1-4) or amplify a 220-bp + / + ;TGT/0 4 0 0 4 region of vector sequences present in the transgene fragment T/+ 0 4 0 4 (lanes 5-8). (Lanes 1, 5) + / + ; (lanes 2, 6) + / + ; TGT/O; (lanes T/+ ;TGT/0 13 1 0 14 3, 7) T~/+ ; (lanes 4, 8) T~/+ ; TGT/0; (lane 9) molecular weight markers {M). Amplification products from the normal T gene, Litters were examined and DNA samples taken at 4 weeks after T ~, and vector sequences linked to the transgene are indicated. birth.

GENES & DEVELOPMENT 199 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Stott et al.

duced, of which one possessed a short tail and eight pos- Table 3. Phenotypes and genotypes of offspring from sessed blunt tails (the description blunt is used for a tail thSl/t TM female mice crossed to T~ + ;TGT/o males phenotype in which the tail length is essentially normal Tail phenotypes but the tail tip is rounded rather than pointed as in wild- type animals). This represents a distinct increase of tail Genotype normal short absent length in comparison to mice of the genotype T~/+; + /t as1 3 0 0 TGT/0, for which 11 of the 13 animals typed had short +/th51;TGW/O 6 0 0 tails and the other 2 were tailless. No animals were re- T/ t hs l 0 0 7 covered that proved homozygous for the T ~ allele (Table T/taSl;TGT/O 0 6 1 2), suggesting that TG T, present in either one or two copies, is unable to rescue this genotype. Litters were examined and DNA samples taken at 4 weeks after birth.

Interaction of t chromosomes with TG w

The presence of t forms of chromosome 17 has been whereas seven littermates of the genotype T/t a51 were shown to enhance the tail phenotype of the T mutation; all tailless (Table 3). In no case did the T/th51; TGT/0 animals of the genotype T/t are tailless, whereas t~ + genotype result in a normal tail. heterozygotes have a normal tail. The locus on t chromosomes responsible for this effect has been designated Expression pattern of TG T tct and postulated to be an allele of T with less than normal activity (Justice and Bode 1988). To test this idea, One explanation for the inability of TG T to rescue the we crossed mice in which the short-tailed phenotype of effect of tct would be that TG T is not expressed in the T heterozygotes had been rescued completely by the ac- cells in which the interaction between tct and T occurs. tivity of TG T with mice carrying t forms of chromosome To assess the expression pattern of TG T, the distribution 17. If tct is a T allele with less than normal activity, then of T message in embryos from time-mated T/+ females T/t; TGT/0 mice should show a normal phenotype--the paired with T~ +; TGT/0 males was assessed by in situ T deficiency being compensated by the product of TG r hybridization. Embryos were isolated at 7.75 days of de- (t/+ animals have normal tails)--provided TG w has nor- velopment, before the lethal phenotype of T~ T embryos mal gene activity. Alternatively, if the tct effect is me- is apparent but after formation of the two major sites of diated by interaction with a different gene, then TG w expression of the T gene, the primitive streak mesoderm, will be unable to rescue the effect. The partial t haplo- and the notochord precursor (Wilkinson et al. 1990). Em- type t h51 (Lyon 1984) was chosen for these experiments. bryos were dissected free of maternal tissues and pro- Unlike complete t haplotypes, t h51 has the advantage cessed for whole-mount in situ hybridization, using an that homozygous animals are viable, simplifying the ge- antisense probe synthesized from coding sequences of notypic analysis of the offspring. The homozygous na- the T gene (Herrmann 1991). A total of 54 embryos de- ture of t h51 was verified by the presence of a t chromo- rived from T~ + x T~ + ;TG T crosses were hybridized, of some in all offspring, checked by Southern blot analysis which 49 embryos exhibited a normal distribution of (data not shown; see Materials and methods). A total of TRNA; the remaining 5 showing no specific hybridiza- seven animals of the genotype T/tas~; TGT/0 were pro- tion. In this cross, -25% of embryos are expected to be duced; six had short tails, the other being tailless, of the genotype T/T; half of these will carry the transgene and half will not. That <12.5% of the embryos showed no hybridization suggests that these embryos are Table 2. Phenotypes and genotypes of offspring from T/T and that embryos of the genotype T/T;TGT/O are Tr +;TGT/O female mice crossed to males of the same indistinguishable in their hybridization pattern from genotype embryos carrying a wild-type T gene. It remains possible that the level of product produced from TG T differs sig- Tail phenotypes nificantly from that of a normal allele. This point could Genotype normal blunt short absent not be addressed using the in situ approach described, which is unlikely to be quantitative. Although this pos- +/+ 7 0 0 0 + / + ;TGT/? a 10 0 0 0 sibility cannot be excluded, we consider it unlikely, T~/+ 0 0 0 4 based on the ability of TG T to completely complement T~/+ ;TGT/0 0 0 11 2 the tail phenotype of T/+ animals. T~/ + ;TGT/TG w 0 8 1 0 Animals were tested by PCR for T ~ and TG w. Where both were Discussion present, homozygosity was tested by outcrossing to wild-type mice and examining the progeny for the presence of T~ and TG w. The processes responsible for anteroposterior axis forma- Litters were examined and DNA samples taken at 4 weeks after tion in the mammalian embryo are as yet poorly under- birth. stood (Gurdon 1992). One of the reasons for this is the aAnimals that tested negative for T ~ and positive for the trans- difficulty of direct experimental manipulation of the em- gene were not tested for transgene homozygosity. bryo at the time immediately after implantation to ma-

200 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Phenotypic rescue of Brachy~ry ternal tissues when the first events of axis determination similar to that of the wild-type locus or that in the wild- probably occur (Smith 1985). To try to understand some type situation the T product is not limiting and other of the processes that are involved in the formation of the factors determine the maximum extent of the axis. In axis, we have begun to study the properties of a gene, T, either case, the complete restoration of the wild-type or Brachyury, the function of which is known from the phenotype demonstrates that the transcription unit in phenotype of mutants to be required during this event. the cosmid c2.190, corresponding to the cDNA pme75, As a first approach to this, we attempted to produce represents the T gene. transgenic mice carrying extra copies of the T gene. The The T ~ allele produces an altered protein product that success rate of this procedure was unusually low; <2% results in a more extreme phenotype than the null allele of live-born progeny were transgenic, suggesting a dele- in the heterozygous situation. As suggested previously terious effect of the transgene on embryo survival. Fur- (MacMurray and Shin 1988), this probably results from thermore, the one transgenic animal that survived to an antimorphic function of the T ~ product. Interestingly, birth had a single copy of the transgene fragment inte- at least two other T alleles with severe heterozygous grated into the genome. Single-copy transgenes are nor- phenotypes have mutations causing an altered carboxy- mally relatively rare, suggesting selection for low-copy- terminal peptide sequence, T wis (Herrmann et al. 1990} number insertions in this experiment. When embryos and T c-2H (A. Kispert and B.G. Herrmann, unpubl.), sug- were isolated early in development, the rate of integra- gesting a distinct function for the carboxy-terminal portion of the transgene fragment used was within the range tion of the protein. The murine T protein shows nuclear usually experienced in our laboratory (20--35%). How- localization in embryonic mesoderm (A. Kispert and ever, no phenotype was observable at the gross level in B.G. Herrmann, in prep.), suggesting a regulatory role for embryos at early somite stages. One effect of mutations the T product in transcription or RNA processing. A rea- at the T locus is a reduction of cells allocated to the sonable hypothesis to explain the activity of these vari- mesodermal component of embryos, whereas the ecto- ant T products is that the protein interacts with at least derm contains too many cells (Yanagisawa et al. 1981). It two other entities and that the modified carboxyl termi- may be that embryos expressing the T gene above a cer- nus is deficient in one of these interactions. The amino- tain level commit too many cells to the mesoderm, leav- terminal portion of the protein-coding sequence is very ing insufficient cells to form ectoderm-derived struc- highly conserved between mice (Herrmann et al. 1990), tures. An alternative possibility might be, as we have Xenopus (Smith et al. 1991), and zebra fish (Schulte- demonstrated here, that as the embryo needs increasing Merker et al. 1992}, suggesting a conserved function for amounts of T product at posterior positions along the this region, possibly DNA binding. It is possible that the anteroposterior axis, a high dosage of T product anteri- T protein interacts with one or more proteins as well as orly might alter the fate of the mesodermal derivatives, a nucleic acid sequence. The carboxy-terminal mutation resulting in an embryo with abnormal anterior struc- of the T~ product would allow one of these interactions tures. Either of these effects could lead to embryonic to take place while preventing the other, having the ef- lethality. We intend to address this point by constructing fect of blocking the function of the wild-type product, transgenes to over express the T product in the mesoder- causing a >50% reduction in effective T protein activity. mal tissues of the early embryo to look for an observable, Complementation of the T ~ phenotype with TG T re- associated phenotype. sulted in mice with short rather than normal tails. This Despite an apparent strong selection against the trans- incomplete restoration of the wild-type phenotype prob- gene during generation of transgenic founder animals, ably results from the continued presence of the T ~ prod- TG T is transmitted in a normal, Mendelian fashion in uct, which now competes with the wild-type product +/+ mice. This probably reflects an adjustment of the from both the transgene and endogenous wild-type lo- level of expression from all copies of the gene. In this cus. Apparently the effective T protein activity in this respect it is noteworthy that a chromosome containing a configuration is similar to that in T~ + heterozygotes, duplication of T, while initially thought to cause ho- which should be -50% of the normal level. On addition mozygous lethality, was eventually bred to homozygos- of a third wild-type copy of T, the phenotype is restored ity (Styrna and Klein 1981). The presence of loci in the further, resulting in blunt-tailed mice, but the axis still mouse genome, which can have a cumulative effect on fails to reach the normal extent. It has been postulated the level of the expression of the transgene (and presum- previously that extension of the axis requires an increas- ably the endogenous) loci over subsequent generations, ing dose of T activity at progressively posterior positions has been reported (Allen et al. 1990). (Yanagisawa 1990). These data support this idea and demonstrate directly the involvement of the T product in axial extension in the mammalian embryo. Complementation of the T-associated tail phenotype In our experiments no offspring were produced that The single-copy transgene insertion TG T results in com- were homozygous for T~, as would be anticipated if the plete rescue of the short-tailed phenotype of T~ + ani- activity of the transgene were as great as that of the mals in the majority (six of seven} of cases. The T mutant wild-type locus (T~/+ ; TGT/0 = TO/T=; TGT/TGT). Pre- is known to be a true null by virtue of being a deletion of sumably, the product from two copies of the transgene is all coding sequences of the T gene (Herrmann et al. insufficient to overcome the negative effect of two cop- 1990). This suggests that either the activity of TG T is ies of T ~, resulting in prenatal lethality. As has been

GENES & DEVELOPMENT 201 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Stott et al. shown previously, T~/+ heterozygotes also have re- ing material (Herrmann et al. 1990). Selected fragments were duced viability (Searle 1966) subcloned into pBluescript vectors (Stratagene), and double- stranded templates were sequenced using a Sequenase kit (U.S. Biochemical) according to the manufacturers' instructions. Identity of the tct locus of t haplotypes RNase protection and primer extension analyses to ascertain the transcriptional start of the T gene were performed according The locus was identified by the effect on the tail tct to published protocols (Ausubel et al. 1987) using probes com- phenotype observed in crosses of t haplotype carrying plimentary to the 5' region of pme75. mice with T~ + mice. In the presence of a t haplotype chromosome, the T short-tailed phenotype is enhanced Transgenic mice to a tailless phenotype similar to that of mice heterozygous for antimorphic T alleles. A mutation chemically Procedures were essentially the same as those described {Hogan et al. 19861. Briefly, a 23-kb fragment was excised from c2.190 induced on an inbred strain chromosome, tct k, interact- (Herrmann et al. 1990) with ClaI and purified on a 0.6% low- ing with T like tct, has been mapped genetically to the T melting-temperature agarose gel containing 1 ~g/ml of ethid- locus (Bode 1984). It has been suggested that tct k, as well ium bromide. The fragment was excised under longwave UV as tct, may represent a hypomorphic T allele with re- illumination, the agarose was removed by phenol extraction, duced activity (Justice and Bode 1988). Neither the in- and the DNA was precipitated with ethanol. The fragment was duced mutation nor the t chromosome in heterozygous subsequently purified on an Elutip-D column (Schleicher & (t/+ ) or homozygous (t/t) mice has a tail phentype. The Schuell), according to the manufacturers' instructions, and in- transgene TG T restores completely the tail phenotype of jected at 1 ~g/ml into the male pronucleus of fertilized eggs T/+ mice in the majority of cases (Table 1). If TG T had isolated from superovulated CBA x C57B1/6 female mice normal gene activity, it would be expected to comple- mated to males of the same genotype. Tail biopsies were taken at 4 weeks, and DNA was extracted by overnight digestion at ment the tail phenotype of T/t mice (T/t~ TGT/0 = +/ 55~ with proteinase K at 100 ~g/ml. t), which is not the case. Instead, the effect of TG T in Tit mice is similar to that in T~/+ mice. Either TG T has PCR analysis reduced activity or tct is a mutation in a different locus, which is not complemented by TG T and is closely linked Amplification of DNA fragments for detection of transgenes to T. If the latter were true, tct might also be missing and T alleles was performed using 0.1-1 ~g of genomic DNA in 20 ~1 of 10 mM Tris-HC1 (pH 8.8); 1.5 mMMgCI2; 50 mM KC1; from the T deletion, which extends over -200 kb and is 100 ~g/ml of BSA; 0.25 mM each of dATP, dCTP, dGTP, and likely to affect several genes. It would follow that in TTP; 1 unit of Taq polymerase (Amersham), and 100 ng of each T/t;TGT/O mice, the product of the tct locus would be primer. Amplification was achieved by using 30 cycles of 95~ limiting for axial development because the normal dos- for 0.5 min; hybridization temperature was optimized for spe- age of the T gene would be restored while there was only cific primer pair (49-60~ for 1 min; and 72~ for 1 min. The a single copy of the tct locus, probably with abnormal primers (5' --* 3'), hybridization temperatures, and product sizes activity. were as follows. For detection of TGT; primers 033 (TGGTCGC- CATGATCGCGTAGTCG) and 034 (GTAGGCATAGGCTTG- GTTATGGCC) were used with a hybridization temperature of Possible function of the T gene product 49~ giving a product of 220 bp. For detection of T~; primers We and others have observed that the node of homozy- 022 (CCAGTTGACACCGGTTGTTACA) and 040 (TATCCC- AGTCTCTGGTCTGT) were used with a hybridization temper- gous mutant T embryos is the first structure visibly af- ature of 55~ giving a product of 320 bp for the wild-type and fected by a lack of functional T product (Fujimoto and 301 bp for the T~ allele. The entire reaction product was elec- Yanagisawa 1983; Herrmann 1991). In addition, it has trophoresed on a 2.4% agarose gel containing 1 ~g/ml of ethid- been shown that the T product is required in a cell-au- ium bromide and photographed under shortwave UV illumina- tonomous fashion for the maintenance and differentiation. tion of notochord cells and some streak-derived cells (Rashbass et al. 1991) and that the T product is localized Genomic Southern blotting to the nucleus {Schulte-Merker et al. 1992; A. Kispert Twenty micrograms of genomic DNA was digested and blotted and B.G. Herrmann, in prep.). A simple proposal, based to Hybond N + filters (Amersham) as described previously (Herr- on these data, is that the T gene product is required for mann et al. 1990). Probes were synthesized by random priming the regulation of genes involved in establishing mesoder- of isolated DNA fragments (Feinberg and Vogelstein 1984) and real, in particular notochordal, cell fates. Our future ef- hybridized according to the procedure of Church and Gilbert forts will be directed at identifying genes regulated by (1984). Digests and probes were as follows. For detection of TG T the T product. This should enhance our understanding of digestion was performed with TaqI and probing with 190R10RS, differentiation processes, especially those involved in which detects a TaqI polymorphism between both CBA and the formation of the embryonic axis of vertebrates. C57B1/6 strain mice and those of the 129 strain, located within 1.2 kb of the transcriptional start of the T gene. This probe also detects a third, different fragment in t chromosomes, allowing Materials and methods verification of homozygosity of the t h51 animals used in this study. For detection of T chromosomes, digestion was per- DNA and RNA analyses formed with BamHI and probing with 119AR, which detects a DNA manipulations were performed according to standard pro- BamHI polymorphism; this is tightly linked to the T deletion cedures (Sambrook et al. 1989), using the cosmid c2.190 as start- (Herrmann et al. 1990).

202 GENES& DEVELOPMENT Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Phenotypic rescue of Brachyury

Whole-mount in situ hybridization mouse XXIII: The development of Brachyury and Anury. I. Embryo1. Exp. Morphol. 6: 424-443. Embryos were isolated from T~ + females mated to T~ +; Gurdon, J.B. 1992. The generation of diversity and pattern in TGT/0 males, at 7.75 days postcoitum, fixed in 4% paraformal- animal development. Cell 68: 185-199. dehyde overnight at 4~ and stored in ethanol at 4~ Embryos Herrmann, B.G. 1991. Expression pattern of the Brachyury gene of the desired genotype, plus appropriate littermates as controls, in whole-mount TW~S/Twis mutant embryos. Development were hybridized with a biotinylated antisense T probe as de- 113: 913-917. scribed previously (Herrmann 1991 ). Herrmann, B.G., D.P. Barlow, and H. Lehrach. 1987. A large inverted duplication allows homologous recombination be- Acknowledgments tween chromosomes heterozygous for the proximal t complex inversion. Cell 48:813-825. We thank Dorothee Weigel, Agathe Authaler, and Tatjana Sick Herrmann, B.G., S. Labeit, A. Poustka, T.R. King, and H. Le- for technical assistance; Mary Lyon and Karen Artzt for 7~/+ hrach. 1990. Cloning of the T gene required in mesoderm mice; H. Sinner for maintenance of stocks; Uli Schwarz for formation in the mouse. Nature 343: 617-622. support, and Jacques Paysan and Hubert Ortner for discussion. Hogan, B., F. Constantini, and E. Lacy. 1986. Manipulating the B.G.H. thanks Hans Lehrach for fruitful discussions and sup- mouse embryo. Cold Spring Harbor Laboratory, Cold Spring port. D.S. was supported by the Royal Society during the first Harbor, New York. part of this work, which was funded by the Deutche Forschun- Jurand, A. 1974. Some aspects of the development of the noto- gsgemeinschMt. chord in mouse embryos. L Embryol. Exp. Morphol. 32: 1-33. The publication costs of this article were defrayed in part by Justice, M.J. and V.C. Bode. 1988. New evidence supporting the payment of page charges. This article must therefore be hereby allelism of T and tct. Mouse Newslett. 80: 168-169. marked "advertisement" in accordance with 18 USC section Lawson, K.A., l.l. Meneses, and R.A. Pedersen. 1991. Clonal 1734 solely to indicate this fact. analysis of epiblast fate during germ layer formation in the mouse embryo. Development 113: 891-911. Lyon, M.F. 1984. Transmission ratio distortion in mouse t-hap- Rderences lotypes is due to multiple distorter genes acting on a re- Allen, N.D., M.L. Norris, and M.A. Surani. 1990. Epigenetic sponder locus. Cell 37: 621-628. control of transgene expression and imprinting by genotype- MacMurray, A. and H.-S. Shin. 1988. The antimorphic nature of specific modifiers. Cell 61: 853-861. the 7~ allele at the mouse T locus. Genetics 120: 545-550. Ausubel, F.M., R.M. Brent, R.E. Kingston, D.D. Moore, J.G. Nakatsuji, N., M.L.H. Snow, and C.C. Wylie. 1986. Cinemicro- Seidman, D. Smith, and K. Struhl. 1987. Current protocols in graphic study of the cell movement in the primitive-streak- molecular biology. John Wiley, New York. stage mouse embryo. ]. Embryol. Exp. Morphol. 96: 99-109. Beddington, R.S.P., J. Morgernstern, H. Land, and A. Hogan. Rashbass, P., L.A. Cooke, B.G. Herrmann, and R.S.P. Bedding- 1989. An in situ transgenic enzyme marker for the midges- ton. 1991. A cell autonomous function of Brachyury in T/T tation mouse embryo and the visualisation of inner cell mass embryonic stem cell chimaeras. Nature 353: 348-351. clones during early organogenesis. Development 106: 37-46. Sambrook, J., E.F. Fritsch, and T? Maniatis. 1989. Molecular Bode, V.C. 1984. Ethylnitrosourea mutagenesis and the isola- cloning: A laboratory manual. Cold Spring Harbor Labora- tion of mutant alleles for specific genes located in the T tory Press, Cold Spring Harbor, New York. region of mouse chromosome 17. Genetics 108: 457-470. Schulte-Merker, S., R.K. Ho, B.G. Herrmann, and C. Nfisslein- Chesley, P. 1935. Development of the short-tailed mutant in the Volhard. 1992. The protein product of the zebrafish homo- house mouse. J. Exp. Zool. 71: 429-459. logue of the mouse T gene is expressed in nuclei of the germ Church, G.M. and W. Gilbert. 1984. Genomic sequencing. Proc. ring and the notochord of the early embryo. Development Natl. Acad. Sci. 81: 1991-1995. 116: 1021-1032. Feinberg, A.P. and B. Vogelstein. 1984. A technique for radiola- Searle, A.G. 1966. Curtailed, a new dominant T-allele in the belling DNA restriction endonuclease fragments to high spe- house mouse. Genet. Res. Camb. 7: 86-95. cific activity. Anal. Biochem. 137: 266-267. Smith, J.C., B.M.J. Price, J.B.A. Green, D. Weigel, and B.G. Her- Fujimoto, H. and K.O. Yanagisawa. 1983. Defects in the arch- rmann. 1991. Expression of a Xenopus homologue of enteron of mouse embryos homozygous for the T-mutation. Brachyury (T) is an immediate-early response to mesoderm Differentiation 25: 44-47. induction. Cell 67: 79-87. Gardner, R.L. and V.E. Papaioannou. 1975. Differentiation in Smith, L.J. 1985. Embryonic axis orientation in the mouse and the trophectoderm and inner cell mass. In The early devel- its correlation with blastocyst relationships to the uterus. J. opment of mammals (ed. M. Balls and A.E. Wild), pp. 107- Embryol. Exp. Morphol. 89: 15-35. 132, Cambridge University Press, Cambridge, England. Spiegelman, M. 1976. Electron microscopy of cell associations Gardner, R.L. and J. Rossant. 1979. Investigation of the fate of in T-locus mutants. Embryogenesis in mammals. Ciba 4.5 day post coitum mouse inner cell mass cells by blasto- Found. Syrup. 40: 199-220. cyst injection. J. Embryol. Exp. Morphol. 52: 141-152. Styma, J. and J. Klein. 1981. Evidence for two regions in the Gardner, R.L., M.F. Lyon, E.P. Evans, and M.D. Burtenshaw. mouse t complex controlling transmission ratios. Genet. 1985. Clonal analysis of X-chromosome inactivation and the Res. Camb. 38: 315-325. origin of the germ line in the mouse embryo. J. Embryol. Wilkinson, D.G., S. Bhatt, and B.G. Herrmann. 1990. Expression Exp. Morphol. 88: 349-363. pattern of the mouse T gene and its role in mesoderm for- Gluecksohn-Schoenheimer, S. 1938. The development of two mation. Nature 343: 657-659. tailless mutants in the house mouse. Genetics 23: 573-584. Yanagisawa, K.O. 1990. Does the T gene determine the antero- 1944. The development of normal and homozygous posterior axis of a mouse embryo? ]pn. ]. Genet. 65: 287-297. Brachy (T/T) mouse embryos in the extraembryonic coelom Yanagisawa, K.O., H. Fujimoto, and H. Urushihara. 1981. Ef- of the chick. Proc. Natl. Acad. Sci. 30: 134-140. fects of the Brachyury (T) mutation on morphogenetic move- Grueneberg, H. 1958. Genetix:al studies on the skeleton of the ment in the mouse embryo. Dev. Biol. 87: 242-248.

GENES & DEVELOPMENT 203 Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press

Rescue of the tail defect of Brachyury mice.

D Stott, A Kispert and B G Herrmann

Genes Dev. 1993, 7: Access the most recent version at doi:10.1101/gad.7.2.197

References This article cites 32 articles, 9 of which can be accessed free at: http://genesdev.cshlp.org/content/7/2/197.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.