DOCSLIB.ORG

What Is a Rodent? About Rodents

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
What Is a Rodent? About Rodents ISBN 978-1-56145-454-9 $15.95 Children’s nonfiction / Nature Sill www.peachtree-online.com / Sill About AAbboouutt RodentsRodents Rodents Cathryn Sill, a A Guide for Children BOUT RODENTS is a thoughtful yet former elementary entertaining first glimpse into school teacher, is the world of nature for young A the author of the A A b acclaimed ABOUT… b children. In this easy-to-read, o series as well as o informative follow-up to the other u the ABOUT HABITATS u critically acclaimed books in her t series. With her husband John and her t R brother-in-law Ben Sill, she coauthored R ABOUT… series, author and teacher o three popular bird-guide parodies, o Cathryn Sill explains what rodents d including A FIELD GUIDE TO LITTLE-KNOWN d are, how they live, and what they do. e AND SELDOM-SEEN BIRDS OF NORTH AMERICA. e With the help of beautifully n n t t detailed paintings from noted wildlife s s illustrator John Sill, this book explains the basic characteristics that all rodents share, while offering a look A into the wide variety of rodents— Guide for Childr from the tiny Eurasian Harvest Mouse John Sill is a What do rodents look like? to the hefty Capybara of South prize-winning and America—that fall into this fascinating widely published wildlife artist who What do rodents eat? category. An afterword provides illustrated both of Where do rodents live? further detail to inspire young the ABOUT… series readers to learn more about rodents. and illustrated ABOUT RODENTS will accurately and coauthored the FIELD GUIDES. A native of North Carolina, he holds a B.S. What is a rodent? en answer the first questions of young in Wildlife Biology from North Carolina CathrCathrynyn SillSill naturalists and charm readers with State University. The Sills live in ISBN 13: 978-1-56145-454-9 the wonder and diversity of these Franklin, North Carolina. ISBN 10: 1-56145-454-0 Illustrated by JohnJohn SillSill animals. Jacket photos by Fred Eldredge, Creative Image Photography Printed in Singapore About Rodents For the One who created rodents. —Genesis 1:25 About Rodents Published by PEACHTREE PUBLISHERS A Guide for Children 1700 Chattahoochee Avenue Atlanta, Georgia 30318-2112 www.peachtree-online.com Text © 2008 by Cathryn P. Sill Illustrations © 2008 by John C. Sill All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means—electronic, mechanical, photocopy, recording, or any other—except for brief quotations in printed reviews, without the prior permission of the publisher. Illustrations created in watercolor on archival quality 100% rag watercolor paper Cathryn Sill Text and titles set in Novarese from Adobe Systems Illustrated by John Sill Printed in Singapore 10 9 8 7 6 5 4 3 2 1 First Edition Library of Congress Cataloging-in-Publication Data Sill, Cathryn P., 1953- About rodents : a guide for children / written by Cathryn Sill ; illustrated by John Sill. -- 1st ed. p. cm. ISBN-13: 978-1-56145-454-9 / ISBN-10: 1-56145-454-0 1. Rodents--Juvenile literature. I. Sill, John, ill. II. Title. QL737.R6S587 2008 599.35--dc22 2008004558 Rodents are mammals with special front teeth that never stop growing. PLATE 1 North American Porcupine Rodents keep their front teeth short and sharp by gnawing on hard things. PLATE 2 White-footed Deermouse Rodents live almost everywhere. PLATE 3 Harris’s Antelope Squirrel Northern Collared Lemming Black Agouti Common Muskrat Hispid Cotton Rat Their homes may be under the ground… PLATE 4 Black-tailed Prairie Dog on the ground… PLATE 5 White-throated Woodrat in trees... PLATE 6 Eurasian Red Squirrel in water... PLATE 7 North American Beaver or sometimes in the places where we live. PLATE 8 House Mouse Most rodents eat plants. PLATE 9 Woodchuck Some eat plants, insects, and other small animals. PLATE 10 Southern Flying Squirrel with Cecropia Moth Some rodents have stretchy cheek pouches, which they use to carry food to their dens. PLATE 11 Eastern Chipmunk Others hide food in different places, then come back for it later. PLATE 12 Gray Squirrel Some rodents that live in cold areas eat a lot in summer and fall. They get fat so they can hibernate in winter. PLATE 13 Common Dormouse Most rodents are small. PLATE 14 Eurasian Harvest Mouse A few are big. PLATE 15 Capybara Many rodents have short lives. They have large families that grow up quickly to take their places. PLATE 16 Syrian Hamster Rodents provide food for many predators. PLATE 17 Barn Owl with Brown Rat Rodents and the places where they live are important and should be protected. PLATE 18 Long-tailed Chinchilla Afterword PLATE 1 PLATE 4 There are around 2,000 species of rodents in the world. They make up more Rodents need shelter where they can sleep, store food, raise babies, and than 40 percent of the world’s mammals. Rodents use their large incisors to hide from predators. Black-tailed Prairie Dogs dig burrows with rooms linked chew tough foods, dig burrows, and gnaw through objects such as roots that together by tunnels. Some of the rooms are “living rooms” and others are for get in their way. In winter North American Porcupines chew through the storage or for toilets. The dirt removed from the burrows is piled around the rough outer bark of trees so they can eat the inner bark. The North American entrances to keep the tunnels from flooding during heavy rains. Prairie dogs Porcupine is North America’s second largest rodent. also use the mounds as lookouts where they can watch for predators. Black- tailed Prairie Dogs live in the great plains of North America. PLATE 2 The front surfaces of a rodent’s incisors are covered with hard enamel. The PLATE 5 backs of the incisors are soft and wear down faster. This keeps the teeth Rodents need ways to keep their nests on the ground safe. White-throated sharp. Many rodents gnaw on antlers shed by deer. The gnawing sharpens Woodrats build nests of sticks and cactus pieces under cholla and prickly their incisors, and at the same time the discarded antlers provide them pear cactuses. The cactus spines protect them from predators. Woodrats are with calcium and other minerals. White-footed Deermice are common in also called packrats or trade rats. They collect a variety of small objects to forests and brushy areas in the eastern United States. put in their nests. They will often drop what they are carrying and trade it for something else. White-throated Woodrats live in brushlands and deserts in the southwestern United States. PLATE 3 PLATE 6 Rodents are found in almost every habitat on Earth. Harris’s Antelope Holes in tree trunks and high branches provide safe places for some Squirrels are common in the Sonoran desert of North America. Northern rodents to build nests. Tree squirrels are able to move quickly along the Collared Lemmings live in the Arctic tundra, farther north than any other branches and trunks of trees. Good eyesight helps them judge distances North American rodent. Black Agoutis live in tropical forests in South as they leap from branch to branch. Eurasian Red Squirrels find shelter in America. Common Muskrats are found in marshes over most of the United holes in tree trunks or in round nests they build from twigs. They line the States and Canada. Hispid Cotton Rats live in grassy fields and overgrown nests with soft material such as moss, dried grass, or thistledown. Eurasian pastures in southeastern North America and Central America. Red Squirrels live in forests in Europe and Asia. PLATE 7 PLATE 10 Beavers are able to change their environment to make safe places for their Southern Flying Squirrels hunt for food at night. They eat many things, homes. North American Beavers use their sharp teeth to cut trees and including nuts, seeds, berries, tree sap, fungi, insects, smaller animals, bird branches for building dams across streams. The dams cause deep ponds to eggs, and carrion. Flying Squirrels have special folds of skin on their sides form, where the beavers can build stick and mud nests called lodges. The that help them glide from tree to tree. Southern Flying Squirrels live in the entrances to the lodges are underwater, which helps keep predators out. In eastern United States and in parts of Mexico and Central America. some areas where the water is deep enough, beavers dig burrows in the banks of rivers and lakes. Beavers are North America’s largest rodent. PLATE 8 PLATE 11 House Mice have lived close to people for thousands of years. They can Rodents have ways to survive times when food is scarce. In late summer live almost anywhere because they eat almost anything. House Mice can and fall Eastern Chipmunks gather and store enough food to last them be pests when they live in buildings because they get into food, gnaw on through the winter. They carry large amounts of seeds and nuts to their bur- furnishings, and carry disease. Outdoors, though, they can be helpful rows in cheek pouches. When full, the cheek pouches are nearly as big as because they eat weed seeds and insects that destroy crops. House Mice their skulls. Eastern Chipmunks live in eastern United States and south- spread all over the world when they were accidentally carried on the ships eastern Canada. or wagons used by explorers and settlers. They are found in all but the very coldest parts of the world. PLATE 9 PLATE 12 Different kinds of rodents eat different parts of plants.
Load more

Recommended publications
  • Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley
    Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh A Dissertation submitted To Sikkim University In Partial Fulfilment of the Requirements for the Degree of Master of Philosophy By MOHAN SHARMA Department of Geography School of Human Sciences February 2020 Date: 07/02/2020 DECLARATION I, Mohan Sharma, hereby declare that the research work embodied in the Dissertation titled “Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh” submitted to Sikkim University for the award of the Degree of Master of Philosophy, is my original work. The thesis has not been submitted for any other degree of this University or any other University. (Mohan Sharma) Roll Number: 18MPGP01 Regd. No.: 18MPhil/GOG/01 Name of the Department: Geography Name of the School: Human Sciences Date: 07/02/2020 CERTIFICATE This is to certify that the dissertation titled “Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh” submitted to Sikkim University for the partial fulfilment of the degree of Master of Philosophy in the Department of Geography, embodies the result of bonafide research work carried out by Mr. Mohan Sharma under our guidance and supervision. No part of the dissertation has been submitted for any other degree, diploma, associateship and fellowship. All the assistance and help received during the course of the investigation have been duly acknowledged by him. We recommend
    [Show full text]
  • Beaver Management in Pennsylvania 2010-2019
    Beaver Management in Pennsylvania (2010-2019) prepared by Tom Hardisky Wildlife Biologist Pennsylvania Game Commission April 2011 So important was the pursuit of the beaver as an influence in westward movement of the American frontier that it is sometimes suggested that this furbearer would be a more appropriate symbol of the United States than the bald eagle. -- Encyclopedia Americana 12:178, 1969. This plan was prepared and will be implemented at no cost to Pennsylvania taxpayers. The Pennsylvania Game Commission is an independently-funded agency, relying on license sales, State Game Land timber, mineral, and oil/gas revenues, and federal excise taxes on sporting arms and ammunition. The Game Commission does not receive any state general fund money collected through taxes. For more than 115 years, sportsmen and women have funded game, non-game, and endangered species programs involving birds and mammals in Pennsylvania. Hunters and trappers continue to financially support all of Pennsylvania’s wildlife programs including beaver management. EXECUTIVE SUMMARY Native Americans maintained a well-calculated balance between beaver populations and man for centuries. The importance of beavers to the livelihood and culture of native North Americans was paramount. When western civilization nearly wiped out beavers in Europe, then successfully proceeded to do the same in North America, the existence of beavers was seriously endangered across the continent. Native American respect for beavers was replaced by European greed over a 300-year period. Conservation-minded individuals and state agencies began beaver recovery efforts during the early 1900s. The return of beavers to most of North America was a miraculous wildlife management achievement.
    [Show full text]
  • Educator's Guide
    Educator’s Guide the jill and lewis bernard family Hall of north american mammals inside: • Suggestions to Help You come prepared • essential questions for Student Inquiry • Strategies for teaching in the exhibition • map of the Exhibition • online resources for the Classroom • Correlations to science framework • glossary amnh.org/namammals Essential QUESTIONS Who are — and who were — the North as tundra, winters are cold, long, and dark, the growing season American Mammals? is extremely short, and precipitation is low. In contrast, the abundant precipitation and year-round warmth of tropical All mammals on Earth share a common ancestor and and subtropical forests provide optimal growing conditions represent many millions of years of evolution. Most of those that support the greatest diversity of species worldwide. in this hall arose as distinct species in the relatively recent Florida and Mexico contain some subtropical forest. In the past. Their ancestors reached North America at different boreal forest that covers a huge expanse of the continent’s times. Some entered from the north along the Bering land northern latitudes, winters are dry and severe, summers moist bridge, which was intermittently exposed by low sea levels and short, and temperatures between the two range widely. during the Pleistocene (2,588,000 to 11,700 years ago). Desert and scrublands are dry and generally warm through- These migrants included relatives of New World cats (e.g. out the year, with temperatures that may exceed 100°F and dip sabertooth, jaguar), certain rodents, musk ox, at least two by 30 degrees at night. kinds of elephants (e.g.
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Mouse Models of Human Disease an Evolutionary Perspective Robert L
    170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms.
    [Show full text]
  • Controlled Animals
    Environment and Sustainable Resource Development Fish and Wildlife Policy Division Controlled Animals Wildlife Regulation, Schedule 5, Part 1-4: Controlled Animals Subject to the Wildlife Act, a person must not be in possession of a wildlife or controlled animal unless authorized by a permit to do so, the animal was lawfully acquired, was lawfully exported from a jurisdiction outside of Alberta and was lawfully imported into Alberta. NOTES: 1 Animals listed in this Schedule, as a general rule, are described in the left hand column by reference to common or descriptive names and in the right hand column by reference to scientific names. But, in the event of any conflict as to the kind of animals that are listed, a scientific name in the right hand column prevails over the corresponding common or descriptive name in the left hand column. 2 Also included in this Schedule is any animal that is the hybrid offspring resulting from the crossing, whether before or after the commencement of this Schedule, of 2 animals at least one of which is or was an animal of a kind that is a controlled animal by virtue of this Schedule. 3 This Schedule excludes all wildlife animals, and therefore if a wildlife animal would, but for this Note, be included in this Schedule, it is hereby excluded from being a controlled animal. Part 1 Mammals (Class Mammalia) 1. AMERICAN OPOSSUMS (Family Didelphidae) Virginia Opossum Didelphis virginiana 2. SHREWS (Family Soricidae) Long-tailed Shrews Genus Sorex Arboreal Brown-toothed Shrew Episoriculus macrurus North American Least Shrew Cryptotis parva Old World Water Shrews Genus Neomys Ussuri White-toothed Shrew Crocidura lasiura Greater White-toothed Shrew Crocidura russula Siberian Shrew Crocidura sibirica Piebald Shrew Diplomesodon pulchellum 3.
    [Show full text]
  • Micromys Minutus)
    Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area.
    [Show full text]
  • A Guide to Mites
    A GUIDE TO MITES concentrated in areas where clothes constrict the body, or MITES in areas like the armpits or under the breasts. These bites Mites are arachnids, belonging to the same group as can be extremely itchy and may cause emotional distress. ticks and spiders. Adult mites have eight legs and are Scratching the affected area may lead to secondary very small—sometimes microscopic—in size. They are bacterial infections. Rat and bird mites are very small, a very diverse group of arthropods that can be found in approximately the size of the period at the end of this just about any habitat. Mites are scavengers, predators, sentence. They are quite active and will enter the living or parasites of plants, insects and animals. Some mites areas of a home when their hosts (rats or birds) have left can transmit diseases, cause agricultural losses, affect or have died. Heavy infestations may cause some mites honeybee colonies, or cause dermatitis and allergies in to search for additional blood meals. Unfed females may humans. Although mites such as mold mites go unnoticed live ten days or more after rats have been eliminated. In and have no direct effect on humans, they can become a this area, tropical rat mites are normally associated with nuisance due to their large numbers. Other mites known the roof rat (Rattus rattus), but are also occasionally found to cause a red itchy rash (known as contact dermatitis) on the Norway rat, (R. norvegicus) and house mouse (Mus include a variety of grain and mold mites. Some species musculus).
    [Show full text]
  • About the Book the Format Acknowledgments
    About the Book For more than ten years I have been working on a book on bryophyte ecology and was joined by Heinjo During, who has been very helpful in critiquing multiple versions of the chapters. But as the book progressed, the field of bryophyte ecology progressed faster. No chapter ever seemed to stay finished, hence the decision to publish online. Furthermore, rather than being a textbook, it is evolving into an encyclopedia that would be at least three volumes. Having reached the age when I could retire whenever I wanted to, I no longer needed be so concerned with the publish or perish paradigm. In keeping with the sharing nature of bryologists, and the need to educate the non-bryologists about the nature and role of bryophytes in the ecosystem, it seemed my personal goals could best be accomplished by publishing online. This has several advantages for me. I can choose the format I want, I can include lots of color images, and I can post chapters or parts of chapters as I complete them and update later if I find it important. Throughout the book I have posed questions. I have even attempt to offer hypotheses for many of these. It is my hope that these questions and hypotheses will inspire students of all ages to attempt to answer these. Some are simple and could even be done by elementary school children. Others are suitable for undergraduate projects. And some will take lifelong work or a large team of researchers around the world. Have fun with them! The Format The decision to publish Bryophyte Ecology as an ebook occurred after I had a publisher, and I am sure I have not thought of all the complexities of publishing as I complete things, rather than in the order of the planned organization.
    [Show full text]
  • A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens
    A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens Pascale Chevret1*, Terence J. Robinson2, Julie Perez3, Fre´de´ric Veyrunes3, Janice Britton-Davidian3 1 Laboratoire de Biome´trie et Biologie Evolutive, UMR CNRS 5558, Universite´ Lyon 1, Villeurbanne, France, 2 Evolutionary Genomics Group, Department of Botany and Zoology, University of Stellenbosch, Stellenbosch, South Africa, 3 Institut des Sciences de l’Evolution de Montpellier, UMR CNRS 5554, Universite´ Montpellier 2, Montpellier, France Abstract The African pygmy mice (Mus, subgenus Nannomys) are a group of small-sized rodents that occur widely throughout sub- Saharan Africa. Chromosomal diversity within this group is extensive and numerous studies have shown the karyotype to be a useful taxonomic marker. This is pertinent to Mus minutoides populations in South Africa where two different cytotypes (2n = 34, 2n = 18) and a modification of the sex determination system (due to the presence of a Y chromosome in some females) have been recorded. This chromosomal diversity is mirrored by mitochondrial DNA sequences that unambiguously discriminate among the various pygmy mouse species and, importantly, the different M. minutoides cytotypes. However, the geographic delimitation and taxonomy of pygmy mice populations in South Africa is poorly understood. To address this, tissue samples of M. minutoides were taken and analysed from specimens housed in six South African museum collections. Partial cytochrome b sequences (400 pb) were successfully amplified from 44% of the 154 samples processed. Two species were identified: M. indutus and M. minutoides. The sequences of the M. indutus samples provided two unexpected features: i) nuclear copies of the cytochrome b gene were detected in many specimens, and ii) the range of this species was found to extend considerably further south than is presently understood.
    [Show full text]
  • Rats and Mice Have Always Posed a Threat to Human Health
    Rats and mice have always posed a threat to human health. Not only do they spread disease but they also cause serious damage to human food and animal feed as well as to buildings, insulation material and electricity cabling. Rats and mice - unwanted house guests! RATS AND MICE ARE AGILE MAMMALS. A mouse can get through a small, 6-7 mm hole (about the diameter of a normal-sized pen) and a rat can get through a 20 mm hole. They can also jump several decimetres at a time. They have no problem climbing up the inside of a vertical sewage pipe and can fall several metres without injuring themselves. Rats are also good swimmers and can be underwater for 5 minutes. IN SWEDEN THERE ARE BASICALLY four different types of rodent that affect us as humans and our housing: the brown rat, the house mouse and the small and large field mouse. THE BROWN RAT (RATTUS NORVEGICUS) THRIVES in all human environments, and especially in damp environments like cellars and sewers. The brown rat is between 20-30 cm in length not counting its tail, which is about 15-23 cm long. These rats normally have brown backs and grey underbellies, but there are also darker ones. They are primarily nocturnal, often keep together in large family groups and dig and gnaw out extensive tunnel systems. Inside these systems, they build large chambers where they store food and build their nests. A pair of rats can produce between 800 and 1000 offspring a year. Since their young are sexually mature and can have offspring of their own at just 2-4 months old, rats reproduce extraordinarily quickly.
    [Show full text]
  • The Audubon Observer
    The Audubon Observer Winter 2014-15 Edition A publication of Duval Audubon Society Serving Clay, Duval and Nassau counties since 1939 Winter Programs General Program Information Unless otherwise indicated, all programs are held at: Swaim Memorial United Methodist Church 1620 Naldo Avenue Jacksonville, FL 32207 BEST OF ALL OF US – 75th Anniversary Photos and Potluck Dinner December 15 @ 7:00PM Speaker: DAS Members Help us celebrate our chapter’s 75th anniversary. Bring a dish to the potluck dinner to share. This is also an opportunity to share your favorite birding images from your travels. Please store the photos on a jump drive. We’ll start at 7:00 p.m., a half-hour earlier than usual. BIRDING IN A CHANGING WORLD January 19 @ 7:30PM Speaker: Carolyn Antman, President of Duval Audubon Society How will the birds respond to shifting climate patterns? Will there be new migration routes? Will they be seeking food and rest in new areas? Will you have a different set of backyard birds? National change. Learn what their scientists anticipate in the years to come and see what they think we can do toAudubon facilitate Society our feathered released friends a major as scientific the environment paper on changes.September 9, 2014 regarding birds and climate Royal Terns and chicks (D. Kainauskas) Red Knots (C. Wainwright) UNLOCKING THE SECRETS OF THE MANGROVE CUCKOO February 16 @ 7:30PM Speaker: Rachel Mullin, Research Biologist, Ecostudies Institute Ecostudies has accepted the challenge of studying one of North America’s most poorly known species, the Mangrove Cuckoo, a species that is extremely rare and disappearing from parts of Florida.
    [Show full text]