What Is a Rodent? About Rodents
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley
Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh A Dissertation submitted To Sikkim University In Partial Fulfilment of the Requirements for the Degree of Master of Philosophy By MOHAN SHARMA Department of Geography School of Human Sciences February 2020 Date: 07/02/2020 DECLARATION I, Mohan Sharma, hereby declare that the research work embodied in the Dissertation titled “Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh” submitted to Sikkim University for the award of the Degree of Master of Philosophy, is my original work. The thesis has not been submitted for any other degree of this University or any other University. (Mohan Sharma) Roll Number: 18MPGP01 Regd. No.: 18MPhil/GOG/01 Name of the Department: Geography Name of the School: Human Sciences Date: 07/02/2020 CERTIFICATE This is to certify that the dissertation titled “Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh” submitted to Sikkim University for the partial fulfilment of the degree of Master of Philosophy in the Department of Geography, embodies the result of bonafide research work carried out by Mr. Mohan Sharma under our guidance and supervision. No part of the dissertation has been submitted for any other degree, diploma, associateship and fellowship. All the assistance and help received during the course of the investigation have been duly acknowledged by him. We recommend -
Beaver Management in Pennsylvania 2010-2019
Beaver Management in Pennsylvania (2010-2019) prepared by Tom Hardisky Wildlife Biologist Pennsylvania Game Commission April 2011 So important was the pursuit of the beaver as an influence in westward movement of the American frontier that it is sometimes suggested that this furbearer would be a more appropriate symbol of the United States than the bald eagle. -- Encyclopedia Americana 12:178, 1969. This plan was prepared and will be implemented at no cost to Pennsylvania taxpayers. The Pennsylvania Game Commission is an independently-funded agency, relying on license sales, State Game Land timber, mineral, and oil/gas revenues, and federal excise taxes on sporting arms and ammunition. The Game Commission does not receive any state general fund money collected through taxes. For more than 115 years, sportsmen and women have funded game, non-game, and endangered species programs involving birds and mammals in Pennsylvania. Hunters and trappers continue to financially support all of Pennsylvania’s wildlife programs including beaver management. EXECUTIVE SUMMARY Native Americans maintained a well-calculated balance between beaver populations and man for centuries. The importance of beavers to the livelihood and culture of native North Americans was paramount. When western civilization nearly wiped out beavers in Europe, then successfully proceeded to do the same in North America, the existence of beavers was seriously endangered across the continent. Native American respect for beavers was replaced by European greed over a 300-year period. Conservation-minded individuals and state agencies began beaver recovery efforts during the early 1900s. The return of beavers to most of North America was a miraculous wildlife management achievement. -
Educator's Guide
Educator’s Guide the jill and lewis bernard family Hall of north american mammals inside: • Suggestions to Help You come prepared • essential questions for Student Inquiry • Strategies for teaching in the exhibition • map of the Exhibition • online resources for the Classroom • Correlations to science framework • glossary amnh.org/namammals Essential QUESTIONS Who are — and who were — the North as tundra, winters are cold, long, and dark, the growing season American Mammals? is extremely short, and precipitation is low. In contrast, the abundant precipitation and year-round warmth of tropical All mammals on Earth share a common ancestor and and subtropical forests provide optimal growing conditions represent many millions of years of evolution. Most of those that support the greatest diversity of species worldwide. in this hall arose as distinct species in the relatively recent Florida and Mexico contain some subtropical forest. In the past. Their ancestors reached North America at different boreal forest that covers a huge expanse of the continent’s times. Some entered from the north along the Bering land northern latitudes, winters are dry and severe, summers moist bridge, which was intermittently exposed by low sea levels and short, and temperatures between the two range widely. during the Pleistocene (2,588,000 to 11,700 years ago). Desert and scrublands are dry and generally warm through- These migrants included relatives of New World cats (e.g. out the year, with temperatures that may exceed 100°F and dip sabertooth, jaguar), certain rodents, musk ox, at least two by 30 degrees at night. kinds of elephants (e.g. -
Table S1. Nakharuthai and Srisapoome (2020)
Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P. -
Mouse Models of Human Disease an Evolutionary Perspective Robert L
170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms. -
Controlled Animals
Environment and Sustainable Resource Development Fish and Wildlife Policy Division Controlled Animals Wildlife Regulation, Schedule 5, Part 1-4: Controlled Animals Subject to the Wildlife Act, a person must not be in possession of a wildlife or controlled animal unless authorized by a permit to do so, the animal was lawfully acquired, was lawfully exported from a jurisdiction outside of Alberta and was lawfully imported into Alberta. NOTES: 1 Animals listed in this Schedule, as a general rule, are described in the left hand column by reference to common or descriptive names and in the right hand column by reference to scientific names. But, in the event of any conflict as to the kind of animals that are listed, a scientific name in the right hand column prevails over the corresponding common or descriptive name in the left hand column. 2 Also included in this Schedule is any animal that is the hybrid offspring resulting from the crossing, whether before or after the commencement of this Schedule, of 2 animals at least one of which is or was an animal of a kind that is a controlled animal by virtue of this Schedule. 3 This Schedule excludes all wildlife animals, and therefore if a wildlife animal would, but for this Note, be included in this Schedule, it is hereby excluded from being a controlled animal. Part 1 Mammals (Class Mammalia) 1. AMERICAN OPOSSUMS (Family Didelphidae) Virginia Opossum Didelphis virginiana 2. SHREWS (Family Soricidae) Long-tailed Shrews Genus Sorex Arboreal Brown-toothed Shrew Episoriculus macrurus North American Least Shrew Cryptotis parva Old World Water Shrews Genus Neomys Ussuri White-toothed Shrew Crocidura lasiura Greater White-toothed Shrew Crocidura russula Siberian Shrew Crocidura sibirica Piebald Shrew Diplomesodon pulchellum 3. -
Micromys Minutus)
Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area. -
A Guide to Mites
A GUIDE TO MITES concentrated in areas where clothes constrict the body, or MITES in areas like the armpits or under the breasts. These bites Mites are arachnids, belonging to the same group as can be extremely itchy and may cause emotional distress. ticks and spiders. Adult mites have eight legs and are Scratching the affected area may lead to secondary very small—sometimes microscopic—in size. They are bacterial infections. Rat and bird mites are very small, a very diverse group of arthropods that can be found in approximately the size of the period at the end of this just about any habitat. Mites are scavengers, predators, sentence. They are quite active and will enter the living or parasites of plants, insects and animals. Some mites areas of a home when their hosts (rats or birds) have left can transmit diseases, cause agricultural losses, affect or have died. Heavy infestations may cause some mites honeybee colonies, or cause dermatitis and allergies in to search for additional blood meals. Unfed females may humans. Although mites such as mold mites go unnoticed live ten days or more after rats have been eliminated. In and have no direct effect on humans, they can become a this area, tropical rat mites are normally associated with nuisance due to their large numbers. Other mites known the roof rat (Rattus rattus), but are also occasionally found to cause a red itchy rash (known as contact dermatitis) on the Norway rat, (R. norvegicus) and house mouse (Mus include a variety of grain and mold mites. Some species musculus). -
About the Book the Format Acknowledgments
About the Book For more than ten years I have been working on a book on bryophyte ecology and was joined by Heinjo During, who has been very helpful in critiquing multiple versions of the chapters. But as the book progressed, the field of bryophyte ecology progressed faster. No chapter ever seemed to stay finished, hence the decision to publish online. Furthermore, rather than being a textbook, it is evolving into an encyclopedia that would be at least three volumes. Having reached the age when I could retire whenever I wanted to, I no longer needed be so concerned with the publish or perish paradigm. In keeping with the sharing nature of bryologists, and the need to educate the non-bryologists about the nature and role of bryophytes in the ecosystem, it seemed my personal goals could best be accomplished by publishing online. This has several advantages for me. I can choose the format I want, I can include lots of color images, and I can post chapters or parts of chapters as I complete them and update later if I find it important. Throughout the book I have posed questions. I have even attempt to offer hypotheses for many of these. It is my hope that these questions and hypotheses will inspire students of all ages to attempt to answer these. Some are simple and could even be done by elementary school children. Others are suitable for undergraduate projects. And some will take lifelong work or a large team of researchers around the world. Have fun with them! The Format The decision to publish Bryophyte Ecology as an ebook occurred after I had a publisher, and I am sure I have not thought of all the complexities of publishing as I complete things, rather than in the order of the planned organization. -
A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens
A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens Pascale Chevret1*, Terence J. Robinson2, Julie Perez3, Fre´de´ric Veyrunes3, Janice Britton-Davidian3 1 Laboratoire de Biome´trie et Biologie Evolutive, UMR CNRS 5558, Universite´ Lyon 1, Villeurbanne, France, 2 Evolutionary Genomics Group, Department of Botany and Zoology, University of Stellenbosch, Stellenbosch, South Africa, 3 Institut des Sciences de l’Evolution de Montpellier, UMR CNRS 5554, Universite´ Montpellier 2, Montpellier, France Abstract The African pygmy mice (Mus, subgenus Nannomys) are a group of small-sized rodents that occur widely throughout sub- Saharan Africa. Chromosomal diversity within this group is extensive and numerous studies have shown the karyotype to be a useful taxonomic marker. This is pertinent to Mus minutoides populations in South Africa where two different cytotypes (2n = 34, 2n = 18) and a modification of the sex determination system (due to the presence of a Y chromosome in some females) have been recorded. This chromosomal diversity is mirrored by mitochondrial DNA sequences that unambiguously discriminate among the various pygmy mouse species and, importantly, the different M. minutoides cytotypes. However, the geographic delimitation and taxonomy of pygmy mice populations in South Africa is poorly understood. To address this, tissue samples of M. minutoides were taken and analysed from specimens housed in six South African museum collections. Partial cytochrome b sequences (400 pb) were successfully amplified from 44% of the 154 samples processed. Two species were identified: M. indutus and M. minutoides. The sequences of the M. indutus samples provided two unexpected features: i) nuclear copies of the cytochrome b gene were detected in many specimens, and ii) the range of this species was found to extend considerably further south than is presently understood. -
Rats and Mice Have Always Posed a Threat to Human Health
Rats and mice have always posed a threat to human health. Not only do they spread disease but they also cause serious damage to human food and animal feed as well as to buildings, insulation material and electricity cabling. Rats and mice - unwanted house guests! RATS AND MICE ARE AGILE MAMMALS. A mouse can get through a small, 6-7 mm hole (about the diameter of a normal-sized pen) and a rat can get through a 20 mm hole. They can also jump several decimetres at a time. They have no problem climbing up the inside of a vertical sewage pipe and can fall several metres without injuring themselves. Rats are also good swimmers and can be underwater for 5 minutes. IN SWEDEN THERE ARE BASICALLY four different types of rodent that affect us as humans and our housing: the brown rat, the house mouse and the small and large field mouse. THE BROWN RAT (RATTUS NORVEGICUS) THRIVES in all human environments, and especially in damp environments like cellars and sewers. The brown rat is between 20-30 cm in length not counting its tail, which is about 15-23 cm long. These rats normally have brown backs and grey underbellies, but there are also darker ones. They are primarily nocturnal, often keep together in large family groups and dig and gnaw out extensive tunnel systems. Inside these systems, they build large chambers where they store food and build their nests. A pair of rats can produce between 800 and 1000 offspring a year. Since their young are sexually mature and can have offspring of their own at just 2-4 months old, rats reproduce extraordinarily quickly. -
The Audubon Observer
The Audubon Observer Winter 2014-15 Edition A publication of Duval Audubon Society Serving Clay, Duval and Nassau counties since 1939 Winter Programs General Program Information Unless otherwise indicated, all programs are held at: Swaim Memorial United Methodist Church 1620 Naldo Avenue Jacksonville, FL 32207 BEST OF ALL OF US – 75th Anniversary Photos and Potluck Dinner December 15 @ 7:00PM Speaker: DAS Members Help us celebrate our chapter’s 75th anniversary. Bring a dish to the potluck dinner to share. This is also an opportunity to share your favorite birding images from your travels. Please store the photos on a jump drive. We’ll start at 7:00 p.m., a half-hour earlier than usual. BIRDING IN A CHANGING WORLD January 19 @ 7:30PM Speaker: Carolyn Antman, President of Duval Audubon Society How will the birds respond to shifting climate patterns? Will there be new migration routes? Will they be seeking food and rest in new areas? Will you have a different set of backyard birds? National change. Learn what their scientists anticipate in the years to come and see what they think we can do toAudubon facilitate Society our feathered released friends a major as scientific the environment paper on changes.September 9, 2014 regarding birds and climate Royal Terns and chicks (D. Kainauskas) Red Knots (C. Wainwright) UNLOCKING THE SECRETS OF THE MANGROVE CUCKOO February 16 @ 7:30PM Speaker: Rachel Mullin, Research Biologist, Ecostudies Institute Ecostudies has accepted the challenge of studying one of North America’s most poorly known species, the Mangrove Cuckoo, a species that is extremely rare and disappearing from parts of Florida.