DOCSLIB.ORG

High Alkaline Activity of a Thermostable Α-Amylase (Cyclomaltodextrinase) from Thermoacidophilic Alicyclobacillus Isolate

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
High Alkaline Activity of a Thermostable Α-Amylase (Cyclomaltodextrinase) from Thermoacidophilic Alicyclobacillus Isolate Annals of Microbiology (2018) 68:881–888 https://doi.org/10.1007/s13213-018-1394-3 ORIGINAL ARTICLE High alkaline activity of a thermostable α-amylase (cyclomaltodextrinase) from thermoacidophilic Alicyclobacillus isolate Lina Zhang1 & Huijia Yin2 & Qi Zhao2 & Chunyu Yang2 & Yan Wang1 Received: 4 July 2018 /Accepted: 24 October 2018 /Published online: 1 November 2018 # Springer-Verlag GmbH Germany, part of Springer Nature and the University of Milan 2018 Abstract It is well demonstrated that glycosyl hydrolases from Alicyclobacillus strains are general thermoacidophilic enzymes and are ideal proteins for industrial applications. In this study, a thermophilic Alicyclobacillus α-amylase of glycoside hydrolases 13_20 subfamily, AMY1, was identified from an Alicyclobacillus strain and efficiently expressed in the host Escherichia coli BL21 CodonPlus. In agreement with other reported Alicyclobacillus hydrolases, the purified AmyY1 had an optimal pH of 6.0–6.5 in phosphate or citrate/Na2HPO4 buffers, and a remarkably decreased activity at pH 8.0. Differently, much higher activity was detected in the alkaline glycine/NaOH reaction mixtures. Compared to the highest amylolytic activity at pH 6.0, AmyY1 exhibited 230 and 116% activities at pH 8.0 and 9.0, respectively. This glycine-activation was further confirmed by a supple- mentation of glycine into the assay mixtures. During the digestions of various raw starches, AmyY1 also exhibited high hydrolysis efficiency under acidic or alkaline conditions. Findings in this study not only endow AMY1 with much broad applications, but also may provide a novel field for the application potentials of some other Alicyclobacillus hydrolases. Keywords Alicyclobacillus α-amylase AMY1 . Alkaline activity . Glycine/NaOH solution . Raw starch hydrolysis Introduction (CDs), pullulan, and starch (Stam et al. 2006; Kuchtová and Janeček 2016). Family 13 of the glycoside hydrolases (GH) is a present- Among these hydrolases, α-amylases constitute a class ly huge group within the Carbohydrate-Active Enzymes of important industrial enzymes that are widely used in database (CAZy, www.cazy.org) database (Martinovičová various industries like food, detergent, textiles, and phar- and Janeček 2018). It comprises of more than 40 maceuticals (Sivaramakrishnan et al. 2006;Souzaand subfamilies and diverse hydrolyses including α- Magalhães 2010). During conventional starch processing, amylases (EC 3.2.1.1), neopullulanases (EC 3.2.1.135), starch slurry is first gelatinized by heating and then sub- cyclomaltodextrinases (EC 3.2.1.54), etc. With more than jected to two enzymatic steps—liquefaction (by α- one substrate, the subfamily GH13_20 usually possess amylase) and saccharification (by glucamylase) (Mjec the N-terminal starch-binding domain (SBD) classified et al. 2002). Due to different pH requirements of these as the carbohydrate-binding module family CBM34 steps, complex pH adjustments are required. Therefore, (Machovic and Janeček 2006), and thus can hydrolyze amylases with high activity and stability at low pH values at least two of the three substrates cyclomaltodextrins are desirable for such industrial processes. In contrast, other applications such as textiles, detergents, and dishwashing machines require amylases that are active * Chunyu Yang and stable under alkaline pH values (Saxena et al. [email protected] 2007). Besides the varying pH requirements for amylolyt- * Yan Wang ic activities, thermostable α-amylases are another type of [email protected] attractive hydrolases for industry and research. As the 1 whole process for conventional enzymatic saccharification State Key Laboratory of Biobased Material and Green Papermaking, Qilu University of Technology, Shandong Academy of Sciences, requires high temperature (Prakash and Jaiswal 2010), Jinan 250353, People’s Republic of China thermostable amylases provide the advantages of decreas- 2 State Key Laboratory of Microbial Technology, Shandong ing the risk of contamination and cost of external cooling University, Qingdao 266237, People’sRepublicofChina as well as increasing the diffusion rate. 882 Ann Microbiol (2018) 68:881–888 Enzymatic degradation of raw starch granules is important adjusted to 4.0 with HCl. After incubated at 60 °C for 14 days, for industrial applications and consequently raw-starch- the culture was transferred into the same medium for next digesting amylases are ideal enzymes for these processes. enrichment. Culture from the third enrichment was diluted Therefore, there are considerable interests in the isolation of and spread onto M-5 agar plates. new strains, especially extremophiles, producing suitable am- ylases for raw-starch digestion (Dumorné 2018). Among Gene cloning and sequence analysis them, Aspergillus sp., Rhizopus sp., Bacillus sp., and Geobacillus sp. are apparently the most suitable producers Genomic DNA was isolated from strain Alicyclobacillus sp. with high hydrolysis efficiency (Sun et al. 2010; Mehta and HJ and used as template for 16S rDNA amplification and Satyanarayana 2014). genomic sequencing. 16S rDNA was amplified by PCR using Apart of these strains, members of genus Alicyclobacillus universal primers 27F and 1492R for bacteria (Lane 1991). are a recently attractive producer for thermophilic amylases. PCR product was purified with the Qiagen ІІ Extraction Kit, Being the gram-positive, thermoacidophilic, heterotrophic ligated into pEASY-blunt vector, and transformed into E. coli organisms that mostly inhabit acidic geothermal environ- DH5α competent cells. ments such as hot springs (Simbahan et al. 2004), these Genomic DNA of Alicyclobacillus sp. HJ was sequenced strains are known to be valuable sources for many thermo- by the Illumina Hiseq2000 platform and annotated by submit- stable and acidic hydrolyses such as xylanase, α-amylase, ting to the Rast server. The genome analysis revealed an and endoglucanase (Bai et al. 2010; Kumar et al. 2010; ORF0788 fragment encoding anα-amylase (AMY1). Boyce and Walsh 2015). To our knowledge, these Multiple alignments were conducted using the ClustalX pro- Alicyclobacillus hydrolases are general reported for their gram (Thompson et al. 1997) by using some homologue genes optimally acidic activities and no data was documented for retrieved from the National Center for Biotechnology high activities under alkaline conditions. Information (NCBI) database. Due to the special habitat of Alicyclobacillus strains, the For intracellular expression, amplification was con- growth of these strains is slowly and requires complex medi- ducted by using primers 0788-F (5′–CTAGCTA um. Therefore, heterologous expression of their hydrolases is GCATGGTTCTTGTGTTGCGC–3′) and 0788-R (5′– essential for large-scale applications. Previously, a CdaA pro- GCGTCGACCTGGTTGTGAAATCCGTC–3′)whichin- tein was isolated from the wild-type strain Alicyclobacillus corporate restriction sites NheIandSalI, respectively. acidocaldarius and its biochemical properties had been inves- The PCR product was digested and ligated into the ex- tigated (Matzke et al. 2000). However, the heterologous ex- pression vector pET-24a(+) and the recombinant plasmid pression protocol and its potentials for industrial applications was transformed into E. coli BL21 CodonPlus. remained to be addressed. In the present study, α-amylase AMY1 was cloned from an Alicyclobacillus strain and suc- Protein expression and purification cessfully expressed in a codon bias-adjusted Escherichia coli host of BL21 CodonPlus. Interestingly, AMY1 was much Luria-Bertani (LB) medium with the additions of 50 μgmL−1 active in the alkaline glycine-buffered mixtures and implied kanamycin and 40 μgmL−1 chloromycetin was used for cell good potentials as a thermostable and alkaline α-amylase. cultivation. When cells reached to an optical density of 0.6 Furthermore, abilities of this α-amylase in digesting various (OD600), isopropyl β-D-1-thiogalactopyranoside (IPTG) was raw starches were also investigated under both acidic (pH 6.0) added to a final concentration of 0.5 mM to induce the protein. and alkaline (pH 9.0) conditions. To avoid excessive formation of inclusion bodies, cells were incubated at 16, 22, 30, or 37 °C for various time and the expression levels were visualized by 11.25% (w/v) sodium Materials and methods dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE). In detail, cells were collected by centrifugation at Strain isolation and identification 4000×g for 10 min at 4 °C, washed twice with PBS (60 mM, Na2HPO4,KH2PO4, pH 7.4), and resuspended in Isolation was carried out with water samples collected from HisTrap buffer A (60 mM PBS, 10% glycerol (v/v), and acidic Tengchong hot springs. Enrichment was conducted in 0.1 mM PMSF, a protease inhibitor tablet, and 10 mM 2- M-5 medium which consists of 3.7 mM KH2PO4, 11.6 mM mercaptoethanol, pH 7.4). The bacterial suspension was then Na2HPO4·7H2O, 13.4 mM KCl, 3.8 mM (NH4)2SO4,9.3mM passed twice through a French press at 15,000 psi and 4 °C −1 NH4Cl, 0.2 mM MgCl2·6H2O, 0.3 mM CaCl2·H2O, 1 g L (Aminco). After centrifugation at 12,000×g for 15 min, the skim milk, 3 g L−1 yeast extract, 5 mL minor elements solu- debris was solubilized in a same volume of PBS as that of tion, and 0.5 mL vitamin solution (Engle et al. 1995). Due to the supernatant. Both supernatant and solubilized debris were the hot spring sample was pH 4.0, the pH of the medium was subjected to SDS-PAGE analysis. Ann Microbiol (2018) 68:881–888 883 After 12-h incubation at 16 °C, cells were harvested and starch granules from potato, corn, sweet potato, or wheat was disrupted as above described. The supernatant was collected incubated with 20 U of AMY1 at 65 °C. Samples were and applied to a Ni-NTA HisTrap affinity column (GE taken interval and centrifuged at 10,000×g for 10 min at Healthcare, Uppsala, Sweden) in an AKTA Prime System 4 °C, then the reducing sugars in the supernatant were (GE Healthcare). AMY1 was eluted by a stepwise gradient quantified by DNS method and used glucose as a stan- of imidazolein Tris/HCl buffers (50–500 mM) and the dard. The extent of hydrolysis of raw starch (Rh)was resulting protein fractions were analyzed by SDS-PAGE.
Load more

Recommended publications
  • Bacteria Belonging to Pseudomonas Typographi Sp. Nov. from the Bark Beetle Ips Typographus Have Genomic Potential to Aid in the Host Ecology
    insects Article Bacteria Belonging to Pseudomonas typographi sp. nov. from the Bark Beetle Ips typographus Have Genomic Potential to Aid in the Host Ecology Ezequiel Peral-Aranega 1,2 , Zaki Saati-Santamaría 1,2 , Miroslav Kolaˇrik 3,4, Raúl Rivas 1,2,5 and Paula García-Fraile 1,2,4,5,* 1 Microbiology and Genetics Department, University of Salamanca, 37007 Salamanca, Spain; [email protected] (E.P.-A.); [email protected] (Z.S.-S.); [email protected] (R.R.) 2 Spanish-Portuguese Institute for Agricultural Research (CIALE), 37185 Salamanca, Spain 3 Department of Botany, Faculty of Science, Charles University, Benátská 2, 128 01 Prague, Czech Republic; [email protected] 4 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the Academy of Sciences of the Czech Republic, 142 20 Prague, Czech Republic 5 Associated Research Unit of Plant-Microorganism Interaction, University of Salamanca-IRNASA-CSIC, 37008 Salamanca, Spain * Correspondence: [email protected] Received: 4 July 2020; Accepted: 1 September 2020; Published: 3 September 2020 Simple Summary: European Bark Beetle (Ips typographus) is a pest that affects dead and weakened spruce trees. Under certain environmental conditions, it has massive outbreaks, resulting in attacks of healthy trees, becoming a forest pest. It has been proposed that the bark beetle’s microbiome plays a key role in the insect’s ecology, providing nutrients, inhibiting pathogens, and degrading tree defense compounds, among other probable traits. During a study of bacterial associates from I. typographus, we isolated three strains identified as Pseudomonas from different beetle life stages. In this work, we aimed to reveal the taxonomic status of these bacterial strains and to sequence and annotate their genomes to mine possible traits related to a role within the bark beetle holobiont.
    [Show full text]
  • Cyclomaltodextrinase 13A, Paenibacillus Sp. Pcda13a (CBM34-GH13)
    Cyclomaltodextrinase 13A, Paenibacillus sp. PCda13A (CBM34-GH13) Catalogue number: CZ08721 , 0,25 mg CZ08722 , 3 × 0,25 mg Description Storage temperature PCda13A (CBM34-GH13), E.C. number 3.2.1.54, is a This enzyme should be stored at -20 °C. cyclomaltodextrinase from Paenibacillus sp. Recombinant PCda13A (CBM34-GH13), purified from Escherichia coli , is a modular family 13 Glycoside Hydrolase (GH13) with an N-terminal Substrate specificity family 34 Carbohydrate Binding Module (CBM34) (www.cazy.org). The enzyme is provided in 35 mM NaHepes buffer, pH 7.5, 750 PCda13A (CBM34-GH13) hydrolyses α-, β-, and γ-cyclodextrins (CDs). The enzyme hydrolyze CDs and linear maltooligosaccharides mM NaCl, 200 mM imidazol, 3.5 mM CaCl 2 and 25% (v/v) glycerol, at a 0,25 mg/mL concentration. Bulk quantities of this product are to yield maltose and glucose with less amounts of maltotriose and available on request. maltotetraose. Electrophoretic Purity Temperature and pH optima PCda13A (CBM34-GH13) purity was determined by sodium The pH optimum for enzymatic activity is 7 while temperature dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) optimum is 40 °C. followed by BlueSafe staining (MB15201) (Figure 1). Enzyme activity Substrate specificity and kinetic properties of PCda13A (CBM34- GH13) are described in the reference provided below. Follow the instructions described in the paper for the implementation of enzyme assays and to obtain values of specific activity. To measure catalytic activity of GHs, quantify reducing sugars released from polysaccharides through the method described by Miller (1959; Anal. Chem. 31, 426-428). Reference Kaulpiboon and Pongsawasdi. J Biochem Mol Biol.
    [Show full text]
  • Expression of Cyclomaltodextrinase Gene from Bacillus Halodurans C-125 and Characterization of Its Multisubstrate Specificity
    Food Sci. Biotechnol. Vol. 18, No. 3, pp. 776 ~ 781 (2009) ⓒ The Korean Society of Food Science and Technology Expression of Cyclomaltodextrinase Gene from Bacillus halodurans C-125 and Characterization of Its Multisubstrate Specificity Hye-Jeong Kang, Chang-Ku Jeong, Myoung-Uoon Jang, Seung-Ho Choi, Min-Hong Kim1, Jun-Bae Ahn2, Sang-Hwa Lee3, Sook-Ja Jo3, and Tae-Jip Kim* Department of Food Science and Technology, Chungbuk National University, Cheongju, Chungbuk 361-763, Korea 1MH2 Biochemical Co., Ltd., Eumseong, Chungbuk 369-841, Korea 2Department of Food Service Industry, Seowon University, Cheongju, Chungbuk 361-741, Korea 3Department of Food and Nutrition, Seowon University, Cheongju, Chungbuk 361-741, Korea Abstract A putative cyclomaltodextrinase (BHCD) gene was found from the genome of Bacillus halodurans C-125, which encodes 578 amino acids with a predicted molecular mass of 67,279 Da. It shares 42-59% of amino acid sequence identity with common cyclomaltodextrinase (CDase)-family enzymes. The corresponding gene was cloned by polymerase chain reaction (PCR) and the dimeric enzyme with C-terminal 6-histidines was successfully overproduced and purified from recombinant Escherichia coli. BHCD showed the highest activity against β-CD at pH 7.0 and 50oC. Due to its versatile hydrolysis and transglycosylation activities, BHCD has been confirmed as a member of CDases. However, BHCD can be distinguished from other typical CDases on the basis of its novel multisubstrate specificity. While typical CDases have over 10 times higher activity on β-CD than starch or pullulan, the CD-hydrolyzing activity of BHCD is only 2.3 times higher than pullulan.
    [Show full text]
  • Function and Structure Studies of GH Family 31 and 97 \Alpha
    110610 (RV-17) Biosci. Biotechnol. Biochem., 75 (12), 110610-1–9, 2011 Award Review Function and Structure Studies of GH Family 31 and 97 -Glycosidases Masayuki OKUYAMA Research Faculty of Agriculture, Hokkaido University, Kita-9, Nishi-9, Kita-ku, Sapporo 060-8589, Japan Online Publication, December 7, 2011 [doi:10.1271/bbb.110610] A huge number of glycoside hydrolases are classified an evolutionary relationship of proteins in the family, into the glycoside hydrolase family (GH family) based from which it is often possible to extract information on on their amino-acid sequence similarity. The glycoside function and structure.3) Classification in a GH family hydrolases acting on -glucosidic linkage are in GH has, accordingly, become indispensable for research on family 4, 13, 15, 31, 63, 97, and 122. This review deals glycoside hydrolases. Glycoside hydrolases are also mainly with findings on GH family 31 and 97 enzymes. divided into two mechanistic classes, inverting and Research on two GH family 31 enzymes is described: retaining enzymes: with inversion or net retention of clarification of the substrate recognition of Escherichia anomeric configuration during the catalytic reaction.4) coli -xylosidase, and glycosynthase derived from Schiz- The stereochemical outcome is generally conserved in a osaccharomyces pombe -glucosidase. GH family 97 is GH family. The inverting mechanism proceeds via a an aberrant GH family, containing inverting and simple single displacement. Two functional groups, retainingAdvance glycoside hydrolases. The inverting View enzyme usually carboxyl groups, act as general acid and general in GH family 97 displays significant similarity to base catalysts. The general acid catalyst donates a proton retaining -glycosidases, including GH family 97 retain- to the departure aglycon, and the general base catalyst ing -glycosidase, but the inverting enzyme has no simultaneously deprotonates the incoming water mole- catalytic nucleophile residue.
    [Show full text]
  • Characterization of Starch Debranching Enzymes of Maize Endosperm Afroza Rahman Iowa State University
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1998 Characterization of starch debranching enzymes of maize endosperm Afroza Rahman Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Biochemistry Commons, Molecular Biology Commons, and the Plant Sciences Commons Recommended Citation Rahman, Afroza, "Characterization of starch debranching enzymes of maize endosperm " (1998). Retrospective Theses and Dissertations. 12519. https://lib.dr.iastate.edu/rtd/12519 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer. The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion. Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9,689,046 B2 Mayall Et Al
    USOO9689046B2 (12) United States Patent (10) Patent No.: US 9,689,046 B2 Mayall et al. (45) Date of Patent: Jun. 27, 2017 (54) SYSTEM AND METHODS FOR THE FOREIGN PATENT DOCUMENTS DETECTION OF MULTIPLE CHEMICAL WO O125472 A1 4/2001 COMPOUNDS WO O169245 A2 9, 2001 (71) Applicants: Robert Matthew Mayall, Calgary (CA); Emily Candice Hicks, Calgary OTHER PUBLICATIONS (CA); Margaret Mary-Flora Bebeselea, A. et al., “Electrochemical Degradation and Determina Renaud-Young, Calgary (CA); David tion of 4-Nitrophenol Using Multiple Pulsed Amperometry at Christopher Lloyd, Calgary (CA); Lisa Graphite Based Electrodes', Chem. Bull. “Politehnica” Univ. Kara Oberding, Calgary (CA); Iain (Timisoara), vol. 53(67), 1-2, 2008. Fraser Scotney George, Calgary (CA) Ben-Yoav. H. et al., “A whole cell electrochemical biosensor for water genotoxicity bio-detection”. Electrochimica Acta, 2009, 54(25), 6113-6118. (72) Inventors: Robert Matthew Mayall, Calgary Biran, I. et al., “On-line monitoring of gene expression'. Microbi (CA); Emily Candice Hicks, Calgary ology (Reading, England), 1999, 145 (Pt 8), 2129-2133. (CA); Margaret Mary-Flora Da Silva, P.S. et al., “Electrochemical Behavior of Hydroquinone Renaud-Young, Calgary (CA); David and Catechol at a Silsesquioxane-Modified Carbon Paste Elec trode'. J. Braz. Chem. Soc., vol. 24, No. 4, 695-699, 2013. Christopher Lloyd, Calgary (CA); Lisa Enache, T. A. & Oliveira-Brett, A. M., "Phenol and Para-Substituted Kara Oberding, Calgary (CA); Iain Phenols Electrochemical Oxidation Pathways”, Journal of Fraser Scotney George, Calgary (CA) Electroanalytical Chemistry, 2011, 1-35. Etesami, M. et al., “Electrooxidation of hydroquinone on simply prepared Au-Pt bimetallic nanoparticles'. Science China, Chem (73) Assignee: FREDSENSE TECHNOLOGIES istry, vol.
    [Show full text]
  • Identification of the Sequence Motif of Glycoside Hydrolase 13 Family Members
    open access www.bioinformation.net Hypothesis Volume 6(2) Identification of the sequence motif of glycoside hydrolase 13 family members Vikash Kumar* Department of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Powai, Mumbai 400076, India; Vikash kumar - Email: [email protected]; *Corresponding author Received December 17, 2010; Accepted February 07, 2011; Published March 26, 2011 Abstract: A bioinformatics analysis of sequences of enzymes of the glycoside hydrolase (GH) 13 family members such as α-amylase, cyclodextrin glycosyltransferase (CGTase), branching enzyme and cyclomaltodextrinase has been carried out in order to find out the sequence motifs that govern the reactions specificities of these enzymes by using hidden Markov model (HMM) profile. This analysis suggests the existence of such sequence motifs and residues of these motifs constituting the –1 to +3 catalytic subsites of the enzyme. Hence, by introducing mutations in the residues of these four subsites, one can change the reaction specificities of the enzymes. In general it has been observed that α -amylase sequence motif have low sequence conservation than rest of the motifs of the GH13 family members. Keywords: α-Amylases; Glycoside hydrolase family 13; Sequence motif; Reaction specificity; Substrate specificity; HMM profile. Background: enzymes with mixed specificities of α-amylase, cyclomaltodextrinase and A large group of “Carbohydrate Active enzymes” that hydrolyse neopullulanase [12]. Currently, the catalytic triad residues Asp206, Glu230 and polysaccharides have been divided into the glycoside hydrolase (GH) families Asp297 seem to be the only residues that are absolutely invariant among all the of the CAZy database [1] based on their amino acid sequence similarity. GH-H clan members [11].
    [Show full text]
  • Analysis of Anoxybacillus Genomes from the Aspects of Lifestyle Adaptations, Prophage Diversity, and Carbohydrate Metabolism
    Analysis of Anoxybacillus Genomes from the Aspects of Lifestyle Adaptations, Prophage Diversity, and Carbohydrate Metabolism Kian Mau Goh1*, Han Ming Gan2, Kok-Gan Chan3, Giek Far Chan4, Saleha Shahar1, Chun Shiong Chong1, Ummirul Mukminin Kahar1, Kian Piaw Chai1 1 Faculty of Biosciences and Medical Engineering, Universiti Teknologi Malaysia, Skudai, Johor, Malaysia, 2 Monash School of Science, Monash University Sunway Campus, Petaling Jaya, Selangor, Malaysia, 3 Division of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia, 4 School of Applied Science, Temasek Polytechnic, Singapore Abstract Species of Anoxybacillus are widespread in geothermal springs, manure, and milk-processing plants. The genus is composed of 22 species and two subspecies, but the relationship between its lifestyle and genome is little understood. In this study, two high-quality draft genomes were generated from Anoxybacillus spp. SK3-4 and DT3-1, isolated from Malaysian hot springs. De novo assembly and annotation were performed, followed by comparative genome analysis with the complete genome of Anoxybacillus flavithermus WK1 and two additional draft genomes, of A. flavithermus TNO-09.006 and A. kamchatkensis G10. The genomes of Anoxybacillus spp. are among the smaller of the family Bacillaceae. Despite having smaller genomes, their essential genes related to lifestyle adaptations at elevated temperature, extreme pH, and protection against ultraviolet are complete. Due to the presence of various competence proteins, Anoxybacillus spp. SK3-4 and DT3-1 are able to take up foreign DNA fragments, and some of these transferred genes are important for the survival of the cells. The analysis of intact putative prophage genomes shows that they are highly diversified.
    [Show full text]
  • Cazymes Catalogue 2021
    cazymes 2021 Visit the Online Store www.nzytech.com Newsletter NZYWallet Instantaneous Quotes Subscribe our newsletter to receive NZYWallet is a prepaid account Do you need an urgent quote? Just awesome news and promotions. that oers the flexibility you need add your products to Cart, proceed to focus on your research. With to Checkout, select quote and it’s NZYWallet you can buy any done! product from our Online Store, check your up-to-date balance and track your latest orders. Contact our customer service at [email protected] or your local sales representative for more information. Follow us: 2021 NZYTech NZYTech 2 Visit the Online Store www.nzytech.com Newsletter NZYWallet Instantaneous Quotes Subscribe our newsletter to receive NZYWallet is a prepaid account Do you need an urgent quote? Just awesome news and promotions. that oers the flexibility you need add your products to Cart, proceed to focus on your research. With to Checkout, select quote and it’s NZYWallet you can buy any done! product from our Online Store, check your up-to-date balance and track your latest orders. Contact our customer service at [email protected] or your local sales representative for more information. Follow us: cazymes 3 4 2021 NZYTech NZYTech OVERVIEW 8 GLYCOSIDE HYDROLASES 10 Acetylgalactosaminidases Acetylglucosaminidases Agarases Amylases @ a glance Amylomaltases Arabinanases Arabinofuranosidases Arabinopyranosidases Arabinoxylanases Carrageenases Cellobiohydrolases Cellodextrinases Cellulases Chitinases Chitosanases Dextranases Fructanases Fructofuranosidases
    [Show full text]
  • Amylases and Related Glycoside Hydrolases with Transglycosylation
    Amylase 2018; 2: 17–29 Review Article Mary Casa-Villegas, Julia Marín-Navarro, Julio Polaina* Amylases and related glycoside hydrolases with transglycosylation activity used for the production of isomaltooligosaccharides https://doi.org/10.1515/amylase-2018-0003 Abbreviations: AIG, α-glucosidase from Acremonium Received March 26, 2018; accepted May 20, 2018 implicatum; ANG, α-glucosidase from Aspergillus niger; Abstract: Isomaltooligosaccharides (IMOS) are sugars AOG, α-glucosidase from Aspergillus oryzae; BcCITase, with health promoting properties that make them relevant CITase from Bacillus circulans T-3040; CBM, carbohydrate- for the pharmaceutical and food industries. IMOS have binding module; CI, cyclic isomaltooligosaccharide; ample chemical diversity achieved by different α-glucosidic CITase, cycloisomaltooligosaccharide glucanotransferase; linkages and polymerization degrees, forming linear, CMM, cyclic maltosylmaltose; CTS, cyclic tetrasaccharide; branched and cyclic structures. Enzymatic synthesis of DP, degree of polymerization; FOS, fructooligosaccharides; these compounds can be carried out by glycoside hydrolases GH, glycoside hydrolases; GOS, galactooligosaccharides; (GHs) with transglycosylating activity. Different substrates IMOS, isomaltooligosaccharides; OPMA-N, maltogenic are used for the synthesis: combinations of disaccharides amylase from Bacillus sp.; PsCITase, CITase from and monosaccharides, or polymeric carbohydrates such Paenibacillus sp. 598K; SI, sucrose isomerase; SmuA, as starch or dextran, which are converted
    [Show full text]
  • Amfep Guidance on REACH Pre-Registration of Enzymes
    Amfep/08/44 30 May 2008 Amfep guidance on REACH pre-registration of enzymes 1. Purpose and timing During the period 1 June to 1 December 2008, European enzyme manufacturers and importers can pre-register the enzyme substances currently manufactured in EU and imported into the EU for technical applications. Manufacturers and importers inside the EU may appoint Third Party Representatives to remain anonymous and if based outside the EU, they may appoint Only Representatives. The pre-registration provision of REACH enables substances to remain on the market subject to later registration in 2010, 2013 or 2018, depending on tonnage. Pre-registration is made to the European Chemicals Agency (ECHA) and result in the formation of a Substance Information Exchange Forum (SIEF) per enzyme. ECHA will publish a list of pre- registered substances by 1 January 2009. Amfep has formed a pre-consortium of members and associated manufacturing companies to prepare enzyme (pre-) registrations and SIEF discussions. The Amfep secretariat can be contacted for further information and on questions related to enzyme pre-registrations. This document is intended to facilitate pre-registration of enzymes. References are given to detailed guidance on enzyme identification, pre-registration and other REACH requirements. However, it must be considered as guidance only. Each potential registrant remains fully responsible for selecting its enzymes and making individual pre-registrations. 2. Scope Enzymes listed on the European chemicals inventory EINECS are considered phase-in (‘existing’) substances and can be pre-registered. Enzymes manufactured in the EU at least once after 31 May 1992, without being placed on the EU market by the manufacturer or importer, are regarded as phase-in substances.
    [Show full text]
  • In Silico Analysis of the Α-Amylase Family GH57: Eventual Subfamilies Reflecting Enzyme Specificities
    3 Biotech (2018) 8:307 https://doi.org/10.1007/s13205-018-1325-9 ORIGINAL ARTICLE In silico analysis of the α-amylase family GH57: eventual subfamilies reflecting enzyme specificities Mária Martinovičová1 · Štefan Janeček1,2 Received: 22 May 2018 / Accepted: 20 June 2018 / Published online: 9 July 2018 © The Author(s) 2018 Abstract Glycoside hydrolases (GHs) have been classified in the CAZy database into 153 GH families. Currently, there might be four α-amylase families: the main family GH13, the family GH57 with related GH119 and, eventually, also GH126. The family GH57 was established in 1996 as the second and smaller α-amylase family. In addition to α-amylase, it contains 4-α-glucanotransferase, α-glucan branching enzyme, amylopullulanase, dual-specificity amylopullulanase–cyclomaltodex- trinase, non-specified amylase, maltogenic amylase and α-galactosidase. The family GH57 enzymes employ the retaining reaction mechanism, share five typical conserved sequence regions and possess catalytic (β/α)7-barrel succeeded by a four- helix bundle with the catalytic machinery consisting of catalytic nucleophile and proton donor (glutamic acid and aspartic acid at strands β4 and β7, respectively). The present bioinformatics study delivers a detailed sequence comparison of 1602 family GH57 sequences with the aim to highlight the uniqueness of each enzyme’s specificity and all eventual protein groups. This was achieved by creating the evolutionary tree focused on both the enzyme specificities and taxonomical origin. The substantial increase of numbers of sequences from recent comparisons done more than 5 years ago has allowed to refine the details of the sequence logos for the individual enzyme specificities.
    [Show full text]