DOCSLIB.ORG

Suillus Himalayensis (Boletales: Basidiomycota: Fungi) and Its Symbiotic Association with Roots of Pinus Wallichiana, First Report from Coniferous Forests of Pakistan

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Suillus Himalayensis (Boletales: Basidiomycota: Fungi) and Its Symbiotic Association with Roots of Pinus Wallichiana, First Report from Coniferous Forests of Pakistan Sarwar et al., The Journal of Animal & Plant Sciences, 28(2): 2018, Page:The J.576 Anim.-583 Plant Sci. 28(2):2018 ISSN: 1018-7081 SUILLUS HIMALAYENSIS (BOLETALES: BASIDIOMYCOTA: FUNGI) AND ITS SYMBIOTIC ASSOCIATION WITH ROOTS OF PINUS WALLICHIANA, FIRST REPORT FROM CONIFEROUS FORESTS OF PAKISTAN. S. Sarwar1*, M. Saba2, A. N. Khalid3 and B. M. Dentinger4 1Department of Botany, Lahore College for Women University, Lahore, Pakistan; 2Department of Botany, University of Gujrat, Pakistan;3Department of Botany, University of the Punjab, Lahore, Pakistan; 4Natural History Museum of Utah, University of Utah, 301 Wakara Way, Salt Lake City, UT 84108, United States Corresponding Author*: [email protected] ABSTRACT Suillus himalayensis (Boletales, Suillaceae) was found associated with Pinus wallichiana during a survey of macrofungi from moist coniferous forests of Pakistan. Both, the fruiting body and ectomycorrhizae were characterized morphoanatomically as well as by molecular analysis. The identification of the fungal symbiont as Suillus himalayensis was confirmed by Internal Transcribed Spacer of ribosomal DNA (ITS rDNA) sequence comparison between mycorrhizas and sporocarps. Sporocarps were matched with published data available from India, where it was first time reported. Phylogenetic analyses and morphological descriptions are provided. This represents the first description of S. himalayensis as an ectomycorrhizal fungus; and, the first report of this species in Pakistan. Key words: BLAST; moist temperate; phylogeny; rhizosphere. INTRODUCTION practices such the selection of robust mycorrhizal fungi for inoculating tree seedlings in the nursery. The forests of Pakistan is a main source of Among ectomycorrhizal mushrooms, Suillus timber, paper, fuel wood, medicine, shelter as well as Gray (1821: 646) is a very important genus forming food and provide ecotourism and wildlife conservation symbiotic associations with many conifers and also with purposes. Less than 4% of land in Pakistan is covered some deciduous trees (Wu et al., 2000). The development with forests (Introduction to landscapes of Pakistan, of mycorrhizae result in better growth, survival, enhanced 2010). Himalayan moist temperate forests are a major mineral nutrition, and tolerance against pathogens and part of this percentage. These forests are located at an heavy metals (Krznaric et al., 2009). Due to their such elevation of 1373 to 3050 m a.s.l. and the main importance in forest trees, scientists have been vegetation of these forests are conifers such as Abies researching this genus for their role as ectomycorrhizae, pindrow Royle (1836), Cedrus deodara (Roxb. ex D. their diversity and phylogeny (Kretzer and Bruns, 1997; Don) G. Don (1830), Picea smithiana Boiss. (1884), Wu et al., 2000; Manian et al., 2001; Beatriz et al., 2006; Pinus roxburghii Sarg. (1897), P. wallichiana A.B. Jack. Feng et al., 2008; Sarwar et al., 2011, 2012a, b; Sarwar, (1938), and Taxus wallichiana Zucc. (1843). Among 2013; Sarwar and Khalid, 2014; Sarwar et al., 2015). these conifers, some deciduous trees and shrubs of About 53 different species of Suillus has been different species also occur (Hussain, 1995). High rainfall documented throughout the world so far (Kirk et al., occurs here during summer (July–September). High 2008; Bruns et al., 2010; Verma and Reddy, 2014a, b, c) rainfall and moderate temperature make an environment but from Pakistan only a little work has been published, suitable for the growth of mushrooms. Most of these mostly by the corresponding author (Ahmad et al., 1997; fungi form mutualistic symbiotic associations with forest Razaq, 2007; Niazi, 2008; Sarwar et al., 2011, 2012; trees in the form of ectomycorrhizae that facilitate tree Sarwar, 2013; Sarwar and Khalid, 2014; Sarwar et al., growth through enhanced nutrient absorption and 2015). protection of roots from root pathogens (Marx, 1991). During the present study, DNA sequences of the These forests are considered one of the biodiversity rich internal transcribed spacer (ITS) region of the collected hotspots. The Himalayan temperate forests are under specimens and ectomycorrhizae were analyzed because severe pressure from logging for timber and firewood, the ITS region has been used to identify a large number clearing for agriculture, and the increasing population of species in the genus Suillus. The aim of the present pressure; hence deforestation is occurring at an increasing work is to describe, for the first time, the symbiotic rate. There is need to increase forested area in this region. association of conifers with Suillus himalayensis Verma In this regard, it is important to know the ectomycorrhizal and Reddy (2014), a new report from Pakistan, as well as diversity, which can guide more intelligent sylvicultural to confirm its ectomycorrhizal association with local coniferous trees. 576 Sarwar et al., The J. Anim. Plant Sci. 28(2):2018 MATERIALS AND METHODS RESULTS The sampling was carried out in coniferous Molecular Phylogeny: Blast match of ITS-rDNA forests of Pakistan dominated by Pinus wallichiana, sequences both from fruiting bodies and ectomycorrhizae Abies pindrow, Pinus roxburghii and some deciduous showed maximum similarity with Suillus himalayensis trees (Fig. 1) during the rainy season (July–September, (Verma and Reddy, 2014) reported from India. From 2010-2012). Three taxa of S. himalayensis were collected GenBank, ITS sequences of closely related Suillus spp., after during visits to all selected sites. The sporocarps and and Rhizopogon subcaerulescens A.H. Sm. (1966) as an blocks of soil directly beneath the fruiting bodies were out-group were retrieved for phylogenetic analysis. For taken from the rhizosphere of Pinus wallichiana. The phylogenetic analysis, 670 genetic characters were used sporocarps were air dried while the soil blocks containing in aligned datasheet containing 443 conserved sites, 204 ectomycorrhizae (ECM) were wrapped in polythene bags variable sites, and 132 parsimony sites. The phylogram and brought to the lab for further analysis. Field data on based on maximum likelihood criterion is represented by basidiocarps (site, habitat, association, etc.) was noted. five clades (Fig. 1). Sequences of ectomycorrhizae and Specimens were studied macroscopically and fruiting body of S. himalayensis from Pakistan microscopically in the laboratory following the methods (KR056819, KR056820, KR056821, KR056822) of Bessette et al. (2000). For the spore dimensions, the clustered with same species from India (KF699850, first values present the range of lengths and widths, and KJ472765). the values in parentheses present mean spore lengths and Taxonomy: Suillus himalayensis B. Verma & M. S. widths ± standard deviations followed Qm ± standard Reddy, Nova Hedwigia, deviation, where Qm is the mean of Q (= length/width ratio of an individual spore). Other measurements are GenBank Accession no.: KR056819, KR056820, given as a range with exceptional values in parentheses. KR056821 ECM were carefully placed in water to clean off soil Basidioma 3.5–10 cm particles and characterized morphologically under the Morpho-anatomical Description: in height. Pileus 3–9cm wide, convex to hemispherical to stereomicroscope. The microscopic description of the flattened; margins straight and flaring to slightly ECM follows the terminology of Agerer (1991, 1999). deflexed, sometimes irregular; pileal veil white, cottony, Mantle views, emanating elements, and illustrations were documented with the help of a camera lucida. Voucher collapsing with age and finally evanescent; pileus surface specimens were deposited in the Herbarium, Department moist to viscid, yellowish white to pale yellow to yellowish brown, scales brown colored appressed of Botany, University of the Punjab, Lahore, Pakistan fibrillose throughout the surface, more prominent towards (LAH). the margin. Context light yellow, changing to brown Molecular Analysis: DNA was extracted from dried when bruising; odor and taste not distinctive. Stipe 3–9 basidiocarps as well as from ectomycorrhizae using cm long, 8–17 mm thick, central, rarely ecentric, Extract N. Amp.TM Plant kit (SIGMA), and the nrDNA cylindrical, equal in diameter, straight to curved to was amplified using fungal specific primers pair ITS1 irregular, solid, covered with whitish glandular dots when (5´–TCCGTAGGTGAACCTTGCGG–3´) and ITS4 (5´– immature which becomes brownish black with maturity, TCCTCCGCTTATTGATATGC–3´). Amplification color yellow at top, pale yellow to reddish yellow in parameters were denaturation at 94°C for 4 min., then 35 middle and white at base; annulus lacking, sometimes a cycles of 45 s at 94°C, 45 s at 54°C, and 1 min 30 s at whitish ring present above stipe centre, veil remnants 72°C, and a final extension at 72°C for 2 min. The attached to stipe in rare specimens; whitish mycelium at purified polymerase chain reaction (PCR) products were base; Stipe context yellow. Pore surface yellow when sequenced bidirectionally by Macrogen (South Korea). young, becomes slightly brown upon bruising; tubes 3-9 The sequence was basic local alignment search tool mm deep, decurrent to adnate and horizontal, frequent (BLAST) searched in GenBank for comparison with pores, pores angular, large, about 2–3 per mm; available sequences. Basidiospores 7.5–11.3 × 4–5 µm, ellipsoid or oblong, To calculate percent identity, similarity, and thin walled, guttulate, smooth, hyaline or pale brown in divergence, selected sequences were aligned using Potassium hydroxide (KOH), inamyloid.
Load more

Recommended publications
  • Covered in Phylloboletellus and Numerous Clamps in Boletellus Fibuliger
    PERSOONIA Published by the Rijksherbarium, Leiden Volume 11, Part 3, pp. 269-302 (1981) Notes on bolete taxonomy—III Rolf Singer Field Museum of Natural History, Chicago, U.S.A. have Contributions involving bolete taxonomy during the last ten years not only widened the knowledge and increased the number of species in the boletes and related lamellate and gastroid forms, but have also introduced a large number of of new data on characters useful for the generic and subgeneric taxonomy these is therefore timely to fungi,resulting, in part, in new taxonomical arrangements. It consider these new data with a view to integratingthem into an amended classifi- cation which, ifit pretends to be natural must take into account all observations of possible diagnostic value. It must also take into account all sufficiently described species from all phytogeographic regions. 1. Clamp connections Like any other character (including the spore print color), the presence or absence ofclamp connections in is neither in of the carpophores here nor other groups Basidiomycetes necessarily a generic or family character. This situation became very clear when occasional clamps were discovered in Phylloboletellus and numerous clamps in Boletellus fibuliger. Kiihner (1978-1980) rightly postulates that cytology and sexuality should be considered wherever at all possible. This, as he is well aware, is not feasible in most boletes, and we must be content to judgeclamp-occurrence per se, giving it importance wherever associated with other characters and within a well circumscribed and obviously homogeneous group such as Phlebopus, Paragyrodon, and Gyrodon. (Heinemann (1954) and Pegler & Young this is (1981) treat group on the family level.) Gyroporus, also clamp-bearing, considered close, but somewhat more removed than the other genera.
    [Show full text]
  • Unearthing the Role of Ectomycorrhizal Fungi in Pine Co-Invasions on Maui
    UNEARTHING THE ROLE OF ECTOMYCORRHIZAL FUNGI IN PINE CO-INVASIONS ON MAUI A THESIS SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAIʻI AT MĀNOA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN BOTANY (ECOLOGY, EVOLUTION, AND CONSERVATION BIOLOGY) MAY 2021 By Leah P. M. Thompson Thesis Committee: Nicole Hynson, Chairperson Anthony Amend Nhu Nguyen Keywords: pine, ectomycorrhizal, co-invasion, Suillus Acknowledgments I would like to first and foremost to thank all the members of the Hynson and Amend labs for their support and friendship during my time working on my degree. I also want to thank the National Park Service for facts and information, the State of Hawaiʻi Department of Fish and Wildlife for site access, and Center for MICROBIOME Analysis through Island Knowledge & Investigation for project funding. Thank you to Dr. Cameron Eagan, Dr. Nicole Hynson, Dr. Nhu Nguyen, Dr. Travis Idol, Sean Swift, and Patricia Sendao for help with field work. Thank you to Danyel Yogi, Kacie Kajihara, Terrance McDermott, Megan Isii, Mistiha Jayaraj, and Tanja Lantz Hirvonen for help setting up bioassays, counting root tips, measuring weights, and running extractions. I would like to thank Dr. Michael Kantar, Dr. Chris Wall, Dr. Jack Darcy, and Sean Swift for help with my data analyses. Thank you to Dr. Chris Wall and Thomas Chapin for editing my draft. Finally, thank you to my committee, Dr. Anthony Amend, Dr. Nhu Nguyen, and Dr. Nicole Hynson for all her support and helping guide me along the way. I would also like to thank my friends and family, who were there to support me in all the aspects of my life throughout this process.
    [Show full text]
  • Diversity and Phylogeny of Suillus (Suillaceae; Boletales; Basidiomycota) from Coniferous Forests of Pakistan
    INTERNATIONAL JOURNAL OF AGRICULTURE & BIOLOGY ISSN Print: 1560–8530; ISSN Online: 1814–9596 13–870/2014/16–3–489–497 http://www.fspublishers.org Full Length Article Diversity and Phylogeny of Suillus (Suillaceae; Boletales; Basidiomycota) from Coniferous Forests of Pakistan Samina Sarwar * and Abdul Nasir Khalid Department of Botany, University of the Punjab, Quaid-e-Azam Campus, Lahore, 54950, Pakistan *For correspondence: [email protected] Abstract Suillus (Boletales; Basidiomycota) is an ectomycorrhizal genus, generally associated with Pinaceae. Coniferous forests of Pakistan are rich in mycodiversity and Suillus species are found as early appearing fungi in the vicinity of conifers. This study reports the diversity of Suillus collected during a period of three (3) years (2008-2011). From 32 basidiomata of Suillus collected, 12 species of this genus were identified. These basidiomata were characterized morphologically, and phylogenetically by amplifying and sequencing the ITS region of rDNA. © 2014 Friends Science Publishers Keywords: Moist temperate forests; PCR; rDNA; Ectomycorrhizae Introduction adequate temperature make the environment suitable for the growth of mushrooms in these forests. Suillus (Suillaceae, Basidiomycota, Boletales ) forms This paper described the diversity of Suillus (Boletes, ectomycorrhizal associations mostly with members of the Fungi) with the help of the anatomical, morphological and Pinaceae and is characterized by having slimy caps, genetic analyses as little knowledge is available from forests glandular dots on the stipe, large pore openings that are in Pakistan. often arranged radially and a partial veil that leaves a ring or tissue hanging from the cap margin (Kuo, 2004). This genus Materials and Methods is mostly distributed in northern temperate locations, although some species have been reported in the southern Sporocarp Collection hemisphere as well (Kirk et al ., 2008).
    [Show full text]
  • Major Clades of Agaricales: a Multilocus Phylogenetic Overview
    Mycologia, 98(6), 2006, pp. 982–995. # 2006 by The Mycological Society of America, Lawrence, KS 66044-8897 Major clades of Agaricales: a multilocus phylogenetic overview P. Brandon Matheny1 Duur K. Aanen Judd M. Curtis Laboratory of Genetics, Arboretumlaan 4, 6703 BD, Biology Department, Clark University, 950 Main Street, Wageningen, The Netherlands Worcester, Massachusetts, 01610 Matthew DeNitis Vale´rie Hofstetter 127 Harrington Way, Worcester, Massachusetts 01604 Department of Biology, Box 90338, Duke University, Durham, North Carolina 27708 Graciela M. Daniele Instituto Multidisciplinario de Biologı´a Vegetal, M. Catherine Aime CONICET-Universidad Nacional de Co´rdoba, Casilla USDA-ARS, Systematic Botany and Mycology de Correo 495, 5000 Co´rdoba, Argentina Laboratory, Room 304, Building 011A, 10300 Baltimore Avenue, Beltsville, Maryland 20705-2350 Dennis E. Desjardin Department of Biology, San Francisco State University, Jean-Marc Moncalvo San Francisco, California 94132 Centre for Biodiversity and Conservation Biology, Royal Ontario Museum and Department of Botany, University Bradley R. Kropp of Toronto, Toronto, Ontario, M5S 2C6 Canada Department of Biology, Utah State University, Logan, Utah 84322 Zai-Wei Ge Zhu-Liang Yang Lorelei L. Norvell Kunming Institute of Botany, Chinese Academy of Pacific Northwest Mycology Service, 6720 NW Skyline Sciences, Kunming 650204, P.R. China Boulevard, Portland, Oregon 97229-1309 Jason C. Slot Andrew Parker Biology Department, Clark University, 950 Main Street, 127 Raven Way, Metaline Falls, Washington 99153- Worcester, Massachusetts, 01609 9720 Joseph F. Ammirati Else C. Vellinga University of Washington, Biology Department, Box Department of Plant and Microbial Biology, 111 355325, Seattle, Washington 98195 Koshland Hall, University of California, Berkeley, California 94720-3102 Timothy J.
    [Show full text]
  • Book on Specific Groups of Fungi Code General Ainsworth & Bisby’S Dictionary of the Fungi
    Book on Specific Groups of Fungi code General Ainsworth & Bisby’s Dictionary of the Fungi. Cab International dictfu Color Atlas of Basidiomycetes. Gustav Fischer farbat Ascomycetes Fungi of Switzerland. Volume 1: Ascomycetes. Verlag Mykologia, Luzern. asz Illustrated Genera of Ascomycetes. APS Press. illus1 Illustrated Genera of Ascomycetes. Volume II. APS Press. illus2 Combined Keys to Illustrated Genera of Ascomycetes I & II comill Mushrooms of Idaho and the Pacific Northwest. Vol 1. Discomycetes. University of Idaho Press. nwdisc Nordic Macromycetes. Vol. 1. Ascomycetes. Nordsvamp, Copenhagen. nord1 Boletes Fungi of Switzerland. Volume 3: Boletes and agarics, 1st part: Strobilomycetaceae, Boletaceae, Paxillaceae, bolsz Gomphidiaceae, Hygrophoraceae, Tricholomtaceae, Polyporaceae (lamellate). Verlag Mykologia, Nordic Macromycetes. Vol. 2. Poyporales, Boletales, Agaricales, Russulales. Nordsvamp, Copenhagen. normac North American Boletes. A Color Guide to the Fleshy Pored Mushrooms. Syracuse University Press, Syracuse. norbol Corticioid The Corticiaceae of North Europe Vol 1: Introduction and Keys. Fungiflora cort1 The Corticiaceae of North Europe Vol 3: Coronicium-Hyphoderma, . Fungiflora cort3 The Corticiaceae of North Europe Vol 8: Phlebiella,Thanatephorus-Ypsilonidlum, . Fungiflora cort8 The Lachnocladiaceae and Coniophoraceae of North Europe. Fungiflora lach Cantharellus, Cantharelloid, and Gomphoid fungi British Fungus Flora: Vol. 8: Cantharellaceae, Gomphaceae, and amyloid-spores and xeruloid members of cangom Tricholomataceae
    [Show full text]
  • CZECH MYCOLOGY Publication of the Czech Scientific Society for Mycology
    CZECH MYCOLOGY Publication of the Czech Scientific Society for Mycology Volume 57 August 2005 Number 1-2 Central European genera of the Boletaceae and Suillaceae, with notes on their anatomical characters Jo s e f Š u t a r a Prosetická 239, 415 01 Tbplice, Czech Republic Šutara J. (2005): Central European genera of the Boletaceae and Suillaceae, with notes on their anatomical characters. - Czech Mycol. 57: 1-50. A taxonomic survey of Central European genera of the families Boletaceae and Suillaceae with tubular hymenophores, including the lamellate Phylloporus, is presented. Questions concerning the delimitation of the bolete genera are discussed. Descriptions and keys to the families and genera are based predominantly on anatomical characters of the carpophores. Attention is also paid to peripheral layers of stipe tissue, whose anatomical structure has not been sufficiently studied. The study of these layers, above all of the caulohymenium and the lateral stipe stratum, can provide information important for a better understanding of relationships between taxonomic groups in these families. The presence (or absence) of the caulohymenium with spore-bearing caulobasidia on the stipe surface is here considered as a significant ge­ neric character of boletes. A new combination, Pseudoboletus astraeicola (Imazeki) Šutara, is proposed. Key words: Boletaceae, Suillaceae, generic taxonomy, anatomical characters. Šutara J. (2005): Středoevropské rody čeledí Boletaceae a Suillaceae, s poznámka­ mi k jejich anatomickým znakům. - Czech Mycol. 57: 1-50. Je předložen taxonomický přehled středoevropských rodů čeledí Boletaceae a. SuiUaceae s rourko- vitým hymenoforem, včetně rodu Phylloporus s lupeny. Jsou diskutovány otázky týkající se vymezení hřibovitých rodů. Popisy a klíče k čeledím a rodům jsou založeny převážně na anatomických znacích plodnic.
    [Show full text]
  • Project Cover Sheet
    Rocky Mountains Cooperative Ecosystem Studies Unit (RM-CESU) RM-CESU Cooperative Agreement Number: H1200040001 PROJECT COVER SHEET TITLE OF PROJECT: Investigation of Mycorrhizal fungi associated with whitebark pine in Waterton Lakes- Glacier National Parks Ecosystem. NAME OF PARK/NPS UNIT: Glacier NP NAME OF UNIVERSITY PARTNER: Montana State University NPS KEY OFFICIAL: Joyce Lapp Glacier National Park West Glacier, MT 59936 406-888-7817 [email protected] PRINCIPAL INVESTIGATOR: Cathy L. Cripps Department of Plant Sciences & Plant Pathology 119 Plant BioSciences Building Montana State University Bozeman, MT 59717 [email protected] 406-994-5226 COST OF PROJECT: Direct Cost: $ 1000.00 Indirect Cost (CESU overhead): $ 175.00 Total Cost: $ 1,175.00 NPS ACCOUNT NUMBER: 1430-7077-634 NAME OF FUND SOURCE: IMR-IMRICO PROJECT SCHEDULE, FINAL PRODUCTS, AND PAYMENTS Date of Project Initiation: May 1, 2007 List of Products: (1) Field collection of ectomycorrhizae from Whitebark pine and identification of this fungi, (2) final report due on March 31, 2008. Payment Schedule: Invoices as received from the University. End Date of Project: May 1, 2008 1 GLACIER NATIONAL PARK Investigation of Native Mycorrhizal Fungi with Whitebark Pine Final Report 2009 Cathy Cripps, Montana State University ([email protected]) INTRODUCTION Whitebark pine is a picturesque, long-lived tree of high mountain landscapes in much of the American West. It is a "keystone” species supplying food and shelter for wildlife and often holding the snow and rocky soils in places where other trees cannot grow. Now, however, in about half of its natural range, including Waterton-Glacier NP, whitebark pine is mostly dead or dying, due to an introduced blister rust disease and replacement by competing trees as a result of fire exclusion (Schwandt 2006, Tomback & Kendall 2001, Kendrick & Keane 2001).
    [Show full text]
  • Suillus Adhikarii, a New Species from the Subalpine Himalaya of India and Nepal Associated with Larix
    Phytotaxa 219 (3): 289–295 ISSN 1179-3155 (print edition) www.mapress.com/phytotaxa/ PHYTOTAXA Copyright © 2015 Magnolia Press Article ISSN 1179-3163 (online edition) http://dx.doi.org/10.11646/phytotaxa.219.3.9 Suillus adhikarii, a new species from the subalpine Himalaya of India and Nepal associated with Larix KANAD DAS1*, DYUTIPARNA CHAKRABORTY1 & HENRY VAN TUYL COTTER2 1Botanical Survey of India, Cryptogamic Unit, P.O. Botanic Garden, Howrah 711103, India 2Department of Biology, Duke University, Durham, North Carolina 27708, USA *Corresponding author: e-mail: [email protected] Abstract Suillus adhikarii is described and illustrated as a new species based on morphology and ecology from the subalpine regions of Nepal and India. It is presumably an ectomycorrhizal fungus in association with Larix griffithiana and L. himalaica. This species is compared with the other closely related taxa of Suillus which have been reported in association with Larix from the Himalaya. A key to the Suillus species associated with Larix known from the Himalaya is provided. Key words: Boletales, Cultural characteristics, Pinaceae, Suillaceae, Taxonomy Introduction In India and Nepal, fungi belonging to the genus Suillus Gray are found mostly in the temperate to subalpine Himalayan region and have great ecological importance. Suillus forms mycorrhizal associations with a number of trees in the Pinaceae, specifically in this region with the genera Pinus L. and Larix Mill. Suillus is represented by nearly 400 taxa across the globe and is well represented in the Himalaya (Kretzer et al. 1996; Kirk et al. 2008; Bruns et al. 2010; Verma & Reddy 2014a–c; Sarwar et al.
    [Show full text]
  • Bulletin SMP 2013
    LOGIQUE YCO DU M P Cotisations 2013 É 1 TÉ R IÉ IG C O Membre actif : 17 € O R S D Couple : 22 € Avril 2013 Avril Numéro 40 Numéro h t 4 tp p2 :/ m /p r/s age e.f sperso-orang Bulletin de la Société mycolog que du Périgord Savez-vous reconnaître ce champignon ? Il s'agit du Tricholome terreux, qui est un excellent comestible. Si vous souhaitez en savoir plus, rendez-vous page 15 ! Association loi 1901 — Siège social : Mairie, 24190 Chantérac — Site Internet : http://pagesperso-orange.fr/smp24/ Bulletin de la Société mycologique du Périgord, 40, avril 2013 3 Société mycologique du Périgord 24190 – Chantérac site internet : http://pagesperso-orange.fr/smp24 Éditorial Prière de ne pas envoyer de courrier au siège social mais directement aux personnes concernées. Les chèques doivent être libellés au nom de la SMP. Daniel Lacombe 28, rue Eugène Le Roy 24400 Mussidan [email protected] Cotisation annuelle 2012 Le temps du bilan qui, bien que comestible, doit être protégée dans notre département vu sa grande rareté ! Il serait Membre actif : 17 € L’année 2012 a été une bonne année pour les cham- Couple : 22 bien que nous fassions un séjour en montagne € pignons, comme en témoignent les douze sorties Membre bienfaiteur : 50 € afin d’y découvrir les espèces de ce type de milieu. Étudiants : 6 € — Moins de 16 ans : gratuit où plus de cent espèces ont été identifiées ; nous sommes même allés jusqu'à 206 à Léguillac-de- Nous avions envisagé de participer aux journées l’Auche ce qui constitue à priori le record absolu sur d’étude de haute Auvergne à Riom-ès-Montagne un seul site en Périgord.
    [Show full text]
  • AR TICLE Diversity of Chroogomphus (Gomphidiaceae, Boletales) In
    doi:10.5598/imafungus.2018.09.02.04 IMA FUNGUS · Diversity of ( , ) in Europe, and Chroogomphus Gomphidiaceae Boletales ARTICLE [C. rutilus Ross Scambler1,6, Tuula Niskanen1, Boris Assyov2, A. Martyn Ainsworth1, Jean-Michel Bellanger3, Michael Loizides4 , Pierre- Arthur Moreau5, Paul M. Kirk1, and Kare Liimatainen1 1Jodrell Laboratory, Royal Botanic Gardens, Kew, Surrey TW9 3AB, UK; corresponding author e-mail: [email protected] 2!"#$"%'*+'///<'" 3UMR5175, CNRS, Université de Montpellier, Université Paul-Valéry Montpellier, EPHE, INSERM, 1919, route de Mende, F-34293 Montpellier Cedex 5, France 4P.O. box 58499, 3734 Limassol, Cyprus 5Université de Lille, Fac. Pharma. Lille, EA 4483 IMPECS, F – 59000 Lille, France 6 Present address :Department of Applied Sciences, University of the West of England, Frenchay Campus, Coldharbour Lane, Bristol, BS16 1QY, UK In this study, eight species of Chroogomphus are recognized from Europe: C. britannicus, C. aff. [ 1, C. fulmineus, C. cf. helveticus, C. mediterraneus, C. cf. purpurascens, C. rutilus, and C. subfulmineus. DNA barcode Different candidates for the application of the name C. rutilus[ ITS =>Chroogomphus fulmineus and C. mediterraneus are molecular systematics [C. subfulmineus?[ new taxa a new subgenus Siccigomphus and three new sections, Confusi, Filiformes, and Fulminei are introduced. The taxonomy former sections Chroogomphus and Floccigomphus are elevated to subgeneric level. Comparison of the ITS X[%!?'/\]'!?'*[ of 1.5 %, with the exception of the two species belonging to sect. Fulminei which differ by a minimum of 0.9 %. Ecological specimen data indicate that species of Chroogomphus form basidiomes under members of Pinaceae, with a general preference for species of Pinus. Five European species have been recorded under Picea, while Abies and Larix have also been recorded as tree associates, although the detailed nutritional relationships of the Submitted: 27 November 2017; Accepted: 27 August 2018; Published: 5 September 2018.
    [Show full text]
  • Inoculation of Whitebark Pine Seedlings with Native Ectomycorrhizal Fungi
    Inoculation of Whitebark Pine Seedlings with Native Ectomycorrhizal Fungi Cathy Cripps and Marlee Jenkins Montana State University, Bozeman MT Most ecosystems are predicated on the existence of microscopic fungi on the roots of plants (that form mycorrhizae) E.O. Wilson What are Ectomycorrhizal fungi? • mutualistic with tree roots Suillus fruiting body • promote phosphorus & nitrogen uptake in trees • protect tree roots (heavy metals, grazers, etc) • improve drought tolerance •improve tree health & seedling establishment Trees: Birch, Oak, Willow, Aspen, Eucalyptus, Alder, Pine, Spruce, Fir, Larch, Douglas fir All pines depend on ectomycorrhizal fungi to survive in nature (Read 1998) Can these native mycorrhizal FUNGI be used ectomycorrhizae as a tool in WHITEBARK PINE restoration? Read photo 1989 There are many kinds of Ectomycorrhizal fungi: which ones could be useful? 5,000-8,000 species of fungi • Each tree species hosts a particular set of mycorrhizal fungi • Each tree hosts a ‘community” of mycorrhizal fungi (many different species) • Each fungus provides unique benefits • Some ECM fungi are host specific Cripps, CL 2002. Mycorrhiza. In: Pscheidt & Ocamb, Pacfic NW Plant Disease Management Handbook. Austria has been inoculating European Stone Pine (Pinus cembra) seedlings for restoration for 50 years To stabilize slopes from avalanches Inoculation with ectomycorrhizal fungi: after trees were cut down for grazing Increased seedling survival from 50% to 90 % at high elevations Visit to Federal Institute Nursery Weisleitner Austrian
    [Show full text]
  • A Preliminary Checklist of Arizona Macrofungi
    A PRELIMINARY CHECKLIST OF ARIZONA MACROFUNGI Scott T. Bates School of Life Sciences Arizona State University PO Box 874601 Tempe, AZ 85287-4601 ABSTRACT A checklist of 1290 species of nonlichenized ascomycetaceous, basidiomycetaceous, and zygomycetaceous macrofungi is presented for the state of Arizona. The checklist was compiled from records of Arizona fungi in scientific publications or herbarium databases. Additional records were obtained from a physical search of herbarium specimens in the University of Arizona’s Robert L. Gilbertson Mycological Herbarium and of the author’s personal herbarium. This publication represents the first comprehensive checklist of macrofungi for Arizona. In all probability, the checklist is far from complete as new species await discovery and some of the species listed are in need of taxonomic revision. The data presented here serve as a baseline for future studies related to fungal biodiversity in Arizona and can contribute to state or national inventories of biota. INTRODUCTION Arizona is a state noted for the diversity of its biotic communities (Brown 1994). Boreal forests found at high altitudes, the ‘Sky Islands’ prevalent in the southern parts of the state, and ponderosa pine (Pinus ponderosa P.& C. Lawson) forests that are widespread in Arizona, all provide rich habitats that sustain numerous species of macrofungi. Even xeric biomes, such as desertscrub and semidesert- grasslands, support a unique mycota, which include rare species such as Itajahya galericulata A. Møller (Long & Stouffer 1943b, Fig. 2c). Although checklists for some groups of fungi present in the state have been published previously (e.g., Gilbertson & Budington 1970, Gilbertson et al. 1974, Gilbertson & Bigelow 1998, Fogel & States 2002), this checklist represents the first comprehensive listing of all macrofungi in the kingdom Eumycota (Fungi) that are known from Arizona.
    [Show full text]