Sarwar et al., The Journal of Animal & Plant Sciences, 28(2): 2018, Page:The J.576 Anim.-583 Plant Sci. 28(2):2018 ISSN: 1018-7081 SUILLUS HIMALAYENSIS (BOLETALES: BASIDIOMYCOTA: FUNGI) AND ITS SYMBIOTIC ASSOCIATION WITH ROOTS OF PINUS WALLICHIANA, FIRST REPORT FROM CONIFEROUS FORESTS OF PAKISTAN. S. Sarwar1*, M. Saba2, A. N. Khalid3 and B. M. Dentinger4 1Department of Botany, Lahore College for Women University, Lahore, Pakistan; 2Department of Botany, University of Gujrat, Pakistan;3Department of Botany, University of the Punjab, Lahore, Pakistan; 4Natural History Museum of Utah, University of Utah, 301 Wakara Way, Salt Lake City, UT 84108, United States Corresponding Author*: [email protected] ABSTRACT Suillus himalayensis (Boletales, Suillaceae) was found associated with Pinus wallichiana during a survey of macrofungi from moist coniferous forests of Pakistan. Both, the fruiting body and ectomycorrhizae were characterized morphoanatomically as well as by molecular analysis. The identification of the fungal symbiont as Suillus himalayensis was confirmed by Internal Transcribed Spacer of ribosomal DNA (ITS rDNA) sequence comparison between mycorrhizas and sporocarps. Sporocarps were matched with published data available from India, where it was first time reported. Phylogenetic analyses and morphological descriptions are provided. This represents the first description of S. himalayensis as an ectomycorrhizal fungus; and, the first report of this species in Pakistan. Key words: BLAST; moist temperate; phylogeny; rhizosphere. INTRODUCTION practices such the selection of robust mycorrhizal fungi for inoculating tree seedlings in the nursery. The forests of Pakistan is a main source of Among ectomycorrhizal mushrooms, Suillus timber, paper, fuel wood, medicine, shelter as well as Gray (1821: 646) is a very important genus forming food and provide ecotourism and wildlife conservation symbiotic associations with many conifers and also with purposes. Less than 4% of land in Pakistan is covered some deciduous trees (Wu et al., 2000). The development with forests (Introduction to landscapes of Pakistan, of mycorrhizae result in better growth, survival, enhanced 2010). Himalayan moist temperate forests are a major mineral nutrition, and tolerance against pathogens and part of this percentage. These forests are located at an heavy metals (Krznaric et al., 2009). Due to their such elevation of 1373 to 3050 m a.s.l. and the main importance in forest trees, scientists have been vegetation of these forests are conifers such as Abies researching this genus for their role as ectomycorrhizae, pindrow Royle (1836), Cedrus deodara (Roxb. ex D. their diversity and phylogeny (Kretzer and Bruns, 1997; Don) G. Don (1830), Picea smithiana Boiss. (1884), Wu et al., 2000; Manian et al., 2001; Beatriz et al., 2006; Pinus roxburghii Sarg. (1897), P. wallichiana A.B. Jack. Feng et al., 2008; Sarwar et al., 2011, 2012a, b; Sarwar, (1938), and Taxus wallichiana Zucc. (1843). Among 2013; Sarwar and Khalid, 2014; Sarwar et al., 2015). these conifers, some deciduous trees and shrubs of About 53 different species of Suillus has been different species also occur (Hussain, 1995). High rainfall documented throughout the world so far (Kirk et al., occurs here during summer (July–September). High 2008; Bruns et al., 2010; Verma and Reddy, 2014a, b, c) rainfall and moderate temperature make an environment but from Pakistan only a little work has been published, suitable for the growth of mushrooms. Most of these mostly by the corresponding author (Ahmad et al., 1997; fungi form mutualistic symbiotic associations with forest Razaq, 2007; Niazi, 2008; Sarwar et al., 2011, 2012; trees in the form of ectomycorrhizae that facilitate tree Sarwar, 2013; Sarwar and Khalid, 2014; Sarwar et al., growth through enhanced nutrient absorption and 2015). protection of roots from root pathogens (Marx, 1991). During the present study, DNA sequences of the These forests are considered one of the biodiversity rich internal transcribed spacer (ITS) region of the collected hotspots. The Himalayan temperate forests are under specimens and ectomycorrhizae were analyzed because severe pressure from logging for timber and firewood, the ITS region has been used to identify a large number clearing for agriculture, and the increasing population of species in the genus Suillus. The aim of the present pressure; hence deforestation is occurring at an increasing work is to describe, for the first time, the symbiotic rate. There is need to increase forested area in this region. association of conifers with Suillus himalayensis Verma In this regard, it is important to know the ectomycorrhizal and Reddy (2014), a new report from Pakistan, as well as diversity, which can guide more intelligent sylvicultural to confirm its ectomycorrhizal association with local coniferous trees. 576 Sarwar et al., The J. Anim. Plant Sci. 28(2):2018 MATERIALS AND METHODS RESULTS The sampling was carried out in coniferous Molecular Phylogeny: Blast match of ITS-rDNA forests of Pakistan dominated by Pinus wallichiana, sequences both from fruiting bodies and ectomycorrhizae Abies pindrow, Pinus roxburghii and some deciduous showed maximum similarity with Suillus himalayensis trees (Fig. 1) during the rainy season (July–September, (Verma and Reddy, 2014) reported from India. From 2010-2012). Three taxa of S. himalayensis were collected GenBank, ITS sequences of closely related Suillus spp., after during visits to all selected sites. The sporocarps and and Rhizopogon subcaerulescens A.H. Sm. (1966) as an blocks of soil directly beneath the fruiting bodies were out-group were retrieved for phylogenetic analysis. For taken from the rhizosphere of Pinus wallichiana. The phylogenetic analysis, 670 genetic characters were used sporocarps were air dried while the soil blocks containing in aligned datasheet containing 443 conserved sites, 204 ectomycorrhizae (ECM) were wrapped in polythene bags variable sites, and 132 parsimony sites. The phylogram and brought to the lab for further analysis. Field data on based on maximum likelihood criterion is represented by basidiocarps (site, habitat, association, etc.) was noted. five clades (Fig. 1). Sequences of ectomycorrhizae and Specimens were studied macroscopically and fruiting body of S. himalayensis from Pakistan microscopically in the laboratory following the methods (KR056819, KR056820, KR056821, KR056822) of Bessette et al. (2000). For the spore dimensions, the clustered with same species from India (KF699850, first values present the range of lengths and widths, and KJ472765). the values in parentheses present mean spore lengths and Taxonomy: Suillus himalayensis B. Verma & M. S. widths ± standard deviations followed Qm ± standard Reddy, Nova Hedwigia, deviation, where Qm is the mean of Q (= length/width ratio of an individual spore). Other measurements are GenBank Accession no.: KR056819, KR056820, given as a range with exceptional values in parentheses. KR056821 ECM were carefully placed in water to clean off soil Basidioma 3.5–10 cm particles and characterized morphologically under the Morpho-anatomical Description: in height. Pileus 3–9cm wide, convex to hemispherical to stereomicroscope. The microscopic description of the flattened; margins straight and flaring to slightly ECM follows the terminology of Agerer (1991, 1999). deflexed, sometimes irregular; pileal veil white, cottony, Mantle views, emanating elements, and illustrations were documented with the help of a camera lucida. Voucher collapsing with age and finally evanescent; pileus surface specimens were deposited in the Herbarium, Department moist to viscid, yellowish white to pale yellow to yellowish brown, scales brown colored appressed of Botany, University of the Punjab, Lahore, Pakistan fibrillose throughout the surface, more prominent towards (LAH). the margin. Context light yellow, changing to brown Molecular Analysis: DNA was extracted from dried when bruising; odor and taste not distinctive. Stipe 3–9 basidiocarps as well as from ectomycorrhizae using cm long, 8–17 mm thick, central, rarely ecentric, Extract N. Amp.TM Plant kit (SIGMA), and the nrDNA cylindrical, equal in diameter, straight to curved to was amplified using fungal specific primers pair ITS1 irregular, solid, covered with whitish glandular dots when (5´–TCCGTAGGTGAACCTTGCGG–3´) and ITS4 (5´– immature which becomes brownish black with maturity, TCCTCCGCTTATTGATATGC–3´). Amplification color yellow at top, pale yellow to reddish yellow in parameters were denaturation at 94°C for 4 min., then 35 middle and white at base; annulus lacking, sometimes a cycles of 45 s at 94°C, 45 s at 54°C, and 1 min 30 s at whitish ring present above stipe centre, veil remnants 72°C, and a final extension at 72°C for 2 min. The attached to stipe in rare specimens; whitish mycelium at purified polymerase chain reaction (PCR) products were base; Stipe context yellow. Pore surface yellow when sequenced bidirectionally by Macrogen (South Korea). young, becomes slightly brown upon bruising; tubes 3-9 The sequence was basic local alignment search tool mm deep, decurrent to adnate and horizontal, frequent (BLAST) searched in GenBank for comparison with pores, pores angular, large, about 2–3 per mm; available sequences. Basidiospores 7.5–11.3 × 4–5 µm, ellipsoid or oblong, To calculate percent identity, similarity, and thin walled, guttulate, smooth, hyaline or pale brown in divergence, selected sequences were aligned using Potassium hydroxide (KOH), inamyloid.