The 1981 Significant Genes Associated with AD
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Endothelin System and Therapeutic Application of Endothelin Receptor
xperim ACCESS Freely available online & E en OPEN l ta a l ic P in h l a C r m f o a c l a o n l o r g u y o J Journal of ISSN: 2161-1459 Clinical & Experimental Pharmacology Research Article Endothelin System and Therapeutic Application of Endothelin Receptor Antagonists Abebe Basazn Mekuria, Zemene Demelash Kifle*, Mohammedbrhan Abdelwuhab Department of Pharmacology, School of Pharmacy, College of Medicine and Health Sciences, University of Gondar, Gondar, Ethiopia ABSTRACT Endothelin is a 21 amino acid molecule endogenous potent vasoconstrictor peptide. Endothelin is synthesized in vascular endothelial and smooth muscle cells, as well as in neural, renal, pulmonic, and inflammatory cells. It acts through a seven transmembrane endothelin receptor A (ETA) and endothelin receptor B (ETB) receptors belongs to G protein-coupled rhodopsin-type receptor superfamily. This peptide involved in pathogenesis of cardiovascular disorder like (heart failure, arterial hypertension, myocardial infraction and atherosclerosis), renal failure, pulmonary arterial hypertension and it also involved in pathogenesis of cancer. Potentially endothelin receptor antagonist helps the treatment of the above disorder. Currently, there are a lot of trails both per-clinical and clinical on endothelin antagonist for various cardiovascular, pulmonary and cancer disorder. Some are approved by FAD for the treatment. These agents are including both selective and non-selective endothelin receptor antagonist (ETA/B). Currently, Bosentan, Ambrisentan, and Macitentan approved -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Association Analyses of Known Genetic Variants with Gene
ASSOCIATION ANALYSES OF KNOWN GENETIC VARIANTS WITH GENE EXPRESSION IN BRAIN by Viktoriya Strumba A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Bioinformatics) in The University of Michigan 2009 Doctoral Committee: Professor Margit Burmeister, Chair Professor Huda Akil Professor Brian D. Athey Assistant Professor Zhaohui S. Qin Research Statistician Thomas Blackwell To Sam and Valentina Dmitriy and Elizabeth ii ACKNOWLEDGEMENTS I would like to thank my advisor Professor Margit Burmeister, who tirelessly guided me though seemingly impassable corridors of graduate work. Throughout my thesis writing period she provided sound advice, encouragement and inspiration. Leading by example, her enthusiasm and dedication have been instrumental in my path to becoming a better scientist. I also would like to thank my co-advisor Tom Blackwell. His careful prodding always kept me on my toes and looking for answers, which taught me the depth of careful statistical analysis. His diligence and dedication have been irreplaceable in most difficult of projects. I also would like to thank my other committee members: Huda Akil, Brian Athey and Steve Qin as well as David States. You did not make it easy for me, but I thank you for believing and not giving up. Huda’s eloquence in every subject matter she explained have been particularly inspiring, while both Huda’s and Brian’s valuable advice made the completion of this dissertation possible. I would also like to thank all the members of the Burmeister lab, both past and present: Sandra Villafuerte, Kristine Ito, Cindy Schoen, Karen Majczenko, Ellen Schmidt, Randi Burns, Gang Su, Nan Xiang and Ana Progovac. -
Impaired Cellular Immunity in the Murine Neural Crest Conditional Deletion of Endothelin Receptor-B Model of Hirschsprung’S Disease
RESEARCH ARTICLE Impaired Cellular Immunity in the Murine Neural Crest Conditional Deletion of Endothelin Receptor-B Model of Hirschsprung’s Disease Ankush Gosain1,2*, Amanda J. Barlow-Anacker1, Chris S. Erickson1, Joseph F. Pierre1, Aaron F. Heneghan1, Miles L. Epstein2, Kenneth A. Kudsk1,3 a11111 1 Department of Surgery, University of Wisconsin-Madison School of Medicine and Public Health, Madison, Wisconsin, United States of America, 2 Department of Neuroscience, University of Wisconsin-Madison School of Medicine and Public Health, Madison, Wisconsin, United States of America, 3 Veteran Administration Surgical Service, William S. Middleton Memorial Veterans Hospital, Madison, United States of America * [email protected] OPEN ACCESS Citation: Gosain A, Barlow-Anacker AJ, Erickson Abstract CS, Pierre JF, Heneghan AF, Epstein ML, et al. (2015) Impaired Cellular Immunity in the Murine Hirschsprung’s disease (HSCR) is characterized by aganglionosis from failure of neural crest Neural Crest Conditional Deletion of Endothelin cell (NCC) migration to the distal hindgut. Up to 40% of HSCR patients suffer Hirschsprung’s- Receptor-B ’ Model of Hirschsprung s Disease. PLoS associated enterocolitis (HAEC), with an incidence that is unchanged from the pre-operative ONE 10(6): e0128822. doi:10.1371/journal. pone.0128822 to the post-operative state. Recent reports indicate that signaling pathways involved in NCC migration may also be involved in the development of secondary lymphoid organs. We hy- Academic Editor: Anatoly V. Grishin, Childrens Hospital Los Angeles, UNITED STATES pothesize that gastrointestinal (GI) mucosal immune defects occur in HSCR that may contrib- ute to enterocolitis. EdnrB was deleted from the neural crest (EdnrBNCC-/-) resulting in mutants Received: November 12, 2014 with defective NCC migration, distal colonic aganglionosis and the development of enterocoli- Accepted: May 1, 2015 tis. -
HPSE2 Gene Heparanase 2 (Inactive)
HPSE2 gene heparanase 2 (inactive) Normal Function The HPSE2 gene provides instructions for making a protein called heparanase 2. Little is known about this protein, but its structure is similar to that of another protein called heparanase 1. Heparanase 1 is an enzyme that splits (cleaves) molecules called heparan sulfate proteoglycans (HSPGs) by removing the heparan sulfate portion (the side chain). HSPGs are important parts of the lattice of proteins and other molecules outside the cell (extracellular matrix) and of basement membranes, which are thin, sheet-like structures that separate and support cells in many tissues. Cleavage of HSPGs by heparanase 1 may lead to changes in the basement membrane or extracellular matrix that allow cell movement or release of substances from the cell. The specific function of the heparanase 2 enzyme is not well understood, but studies suggest that it may block the action of heparanase 1. Health Conditions Related to Genetic Changes Migraine MedlinePlus Genetics provides information about Migraine Ochoa syndrome At least nine HPSE2 gene mutations have been identified in people with Ochoa syndrome (also called urofacial syndrome), a disorder that causes urinary problems and unusual facial expressions. These mutations result in changes in the heparanase 2 protein that likely prevent it from functioning. The connection between HPSE2 gene mutations and the features of Ochoa syndrome are unclear. Because the areas of the brain that control facial expression and urination are in close proximity, some researchers have suggested that the genetic changes may lead to an abnormality in this brain region that may account for the symptoms of Ochoa syndrome. -
Recombinant Human Carbonic Anhydrase XIII Protein Catalog Number: ATGP3059
Recombinant human Carbonic Anhydrase XIII protein Catalog Number: ATGP3059 PRODUCT INPORMATION Expression system E.coli Domain 1-262aa UniProt No. Q8N1Q1 NCBI Accession No. NP_940986.1 Alternative Names Carbonic anhydrase 13, CAXIII PRODUCT SPECIFICATION Molecular Weight 31.8 kDa (285aa) confirmed by MALDI-TOF Concentration 0.5mg/ml (determined by Bradford assay) Formulation Liquid in. Phosphate-Buffered Saline (pH 7.4) containing 10% glycerol, 1mM DTT Purity > 90% by SDS-PAGE Biological Activity Specific activity is > 2,500pmol/min/ug, and is defined as the amount of enzyme that hydrolyze 1.0pmole of 4- nitrophenyl acetate to 4-nitrophenol per minute at pH 7.5 at 37C. Tag His-Tag Application SDS-PAGE, Enzyme Activity Storage Condition Can be stored at +2C to +8C for 1 week. For long term storage, aliquot and store at -20C to -80C. Avoid repeated freezing and thawing cycles. BACKGROUND Description CA13 also known as carbonic anhydrase 13 belongs to the alpha-carbonic anhydrase family. The carbonic anhydrase from a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that occurs relatively slowly in the absence of catalyst. The active 1 Recombinant human Carbonic Anhydrase XIII protein Catalog Number: ATGP3059 site of most carbonic anhydrases contains a zinc ion; they are claasified as metalloenzymes. There are at least five distinct CA families (alpha, beta, gamma, delta, and epsilon). These families have no significant amino acid sequence similarity and in most cases are thought to be an example of convergent evolution. The alpha-CAs are found in humans. -
Urinary Tract Effects of HPSE2 Mutations
BRIEF COMMUNICATION www.jasn.org Urinary Tract Effects of HPSE2 Mutations † Helen M. Stuart,* Neil A. Roberts,* Emma N. Hilton,* Edward A. McKenzie, Sarah B. Daly,* † ‡ Kristen D. Hadfield,* Jeffery S. Rahal,* Natalie J. Gardiner, Simon W. Tanley, | Malcolm A. Lewis,* Emily Sites,§ Brad Angle,§ Cláudia Alves, Teresa Lourenço,¶ Márcia Rodrigues,¶ Angelina Calado,** Marta Amado,** Nancy Guerreiro,** Inês Serras,** †† †† || Christian Beetz , Rita-Eva Varga , Mesrur Selcuk Silay,§§ John M. Darlow, ¶¶ || || ††† Mark G. Dobson , ¶¶ David E. Barton , *** Manuela Hunziker,¶¶ Prem Puri,¶¶*** ‡‡‡ Sally A. Feather, Judith A. Goodship ,§§§ Timothy H.J. Goodship ,§§§ Heather J. ||| BRIEF COMMUNICATION Lambert ,§§§ Heather J. Cordell ,§§§ the UK VUR Study Group, Anand Saggar, †††† Maria Kinali ,¶¶¶, the 4C Study Group, Christian Lorenz ,**** Kristina Moeller, |||| Franz Schaefer,§§§§ Aysun K. Bayazit , Stefanie Weber,¶¶¶¶ William G. Newman ,* and Adrian S. Woolf * Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Urofacial syndrome (UFS) is an autosomal recessive congenital disease featuring grimacing grimacing and dysmorphic bladders. and incomplete bladder emptying. Mutations of HPSE2, encoding heparanase 2, a Considering these and previously pub- heparanase 1 inhibitor, occur in UFS, but knowledge about the HPSE2 mutation spec- lished mutations4–7 (Figure 1A), it is clear trum is limited. Here, seven UFS kindreds with HPSE2 mutations are presented, that pathogenic HPSE2 mutations are including one with deleted asparagine 254, suggesting a role for this amino acid, found across the gene’s coding region. which is conserved in vertebrate orthologs. HPSE2 mutations were absent in 23 non- Most (i.e., nonsense or frameshift muta- neurogenic neurogenic bladder probands and, of 439 families with nonsyndromic tions) would cause loss of function, but a vesicoureteric reflux, only one carried a putative pathogenic HPSE2 variant. -
Enzymatic Encoding Methods for Efficient Synthesis Of
(19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN, -
Table 2. Significant
Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S. -
Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. -
P-Glycoprotein-Mediated Chemoresistance Is Reversed by Carbonic Anhydrase XII Inhibitors
www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2016 P-glycoprotein-mediated chemoresistance is reversed by carbonic anhydrase XII inhibitors Joanna Kopecka1, Gregory M. Rankin2, Iris C. Salaroglio1, Sally-Ann Poulsen2,*, Chiara Riganti1,* 1Department of Oncology, University of Torino, 10126 Torino, Italy 2Eskitis Institute for Drug Discovery, Griffith University, Brisbane, Nathan, Queensland, 4111, Australia *These authors contributed equally to this work Correspondence to: Sally-Ann Poulsen, email: [email protected] Chiara Riganti, email: [email protected] Keywords: carbonic anhydrase XII, P-glycoprotein, doxorubicin, chemoresistance, intracellular pH Received: August 26, 2016 Accepted: October 28, 2016 Published: November 03, 2016 ABSTRACT Carbonic anhydrase XII (CAXII) is a membrane enzyme that maintains pH homeostasis and sustains optimum P-glycoprotein (Pgp) efflux activity in cancer cells. Here, we investigated a panel of eight CAXII inhibitors (compounds 1–8), for their potential to reverse Pgp mediated tumor cell chemoresistance. Inhibitors (5 nM) were screened in human and murine cancer cells (colon, lung, breast, bone) with different expression levels of CAXII and Pgp. We identified three CAXII inhibitors (compounds 1, 2 and 4) that significantly (≥ 2 fold) increased the intracellular retention of the Pgp-substrate and chemotherapeutic doxorubicin, and restored its cytotoxic activity. The inhibitors lowered intracellular pH to indirectly impair Pgp activity. Ca12-knockout assays confirmed that the chemosensitizing property of the compounds was dependent on active CAXII. Furthermore, in a preclinical model of drug-resistant breast tumors compound 1 (1900 ng/kg) restored the efficacy of doxorubicin to the same extent as the direct Pgp inhibitor tariquidar. The expression of carbonic anhydrase IX had no effect on the intracellular doxorubicin accumulation. -
ANTICORPI BT-Policlonali
ANTICORPI BT-policlonali Cat# Item Applications Reactivity Source BT-AP00001 11β-HSD1 Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit BT-AP00002 11β-HSD1 Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit BT-AP00003 14-3-3 β Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00004 14-3-3 β/ζ Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit BT-AP00005 14-3-3 γ Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00006 14-3-3 ε Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00007 14-3-3 ε Polyclonal Antibody WB,IHC-p Mouse,Rat Rabbit BT-AP00008 14-3-3 ζ Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit WB,IHC- BT-AP00009 14-3-3 ζ Polyclonal Antibody p,IP,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00010 14-3-3 ζ/δ Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00011 14-3-3 η Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00012 14-3-3 θ Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00013 14-3-3 θ/τ Polyclonal Antibody WB,IHC-p,IF,ELISA Human,Mouse,Rat Rabbit BT-AP00014 14-3-3 σ Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse Rabbit BT-AP00015 14-3-3-pan (Acetyl Lys51/49) Polyclonal Antibody WB,ELISA Human,Mouse,Rat Rabbit BT-AP00016 17β-HSD11 Polyclonal Antibody WB,ELISA Human Rabbit BT-AP00017 17β-HSD4 Polyclonal Antibody WB,IHC-p,ELISA Human,Mouse,Rat Rabbit BT-AP00018 2A5B Polyclonal Antibody WB,ELISA Human Rabbit BT-AP00019 2A5E Polyclonal Antibody WB,ELISA Human,Mouse Rabbit BT-AP00020 2A5G Polyclonal Antibody