DOCSLIB.ORG

Ramanathan Et Al SI Biorxiv Format

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ramanathan Et Al SI Biorxiv Format Oligomerization of the antimalarial drug target PfATP4 is essential for parasite survival Aarti A. Ramanathan*, Joanne M. Morrisey*, Thomas M. Daly*, Lawrence W. Bergman*, Michael W. Mather*, Akhil B. Vaidya*† *Drexel University College of Medicine, Philadelphia, PA 19129 †To whom correspondence may be addressed Email: [email protected], Tel: +1-215.991.8557 Classification Biochemistry, Microbiology Keywords PfATP4, Antimalarial drug target, Plasmodium falciparum, P-Type ATPase Supplemental methods Plasmid vectors and generation of transgenic parasites NF54PfATP4:Myc parasite line was generated through single cross-over recombination with a modified pMG75 vector from which attP sequence was removed. For generating the wildtype merodiploid line, the full-length PfATP4 gene was amplified by PCR using genomic DNA from wildtype Dd2 parasite line and was cloned into pSC-B vector (Stratagene/Agilent Technologies). DNA sequences were confirmed and subcloned into pLN-based plasmid using AvrII and BsiWI, to be expressed under the calmodulin promoter, with a 3xHA tag at the C-terminal end. For PfATP4:TM8Mut vector, the pSC-B PfATP4 wildtype vector was modified. W1231A, and F1245V mutations were generated by amplifying PfATP4 using mutant oligos 5’ GCTAATAAATATTGTGCCCATAACAAACATGTTGTATTCAAAATAGAAG 3’ and 5’CTCTTTTAAATTTAGTATTAGATGAAATAGTACCAAAGGTTATATATAGAAG 3’ and assembled with oligo 5’TGTTATGGGCACAATATTTATTAGCTATAGTTTGGGCTCTTTTAAATTTAGTATTAG ATGAA 3’, carrying the F1238V mutation in a 2 piece DNA assembly reaction (New England Biolabs). The mutant clone was confirmed via sequencing and subcloned in a pLN-based plasmid as described above. Transfections for generating merodiploid P. falciparum parasites were carried out using Mycobacteriophage integrase system as described previously (1). Briefly, ring-stage parasites at 5% parasitemia were electroporated with 50 µg each of the vector and integrase plasmid. Electroporation was conducted using a Bio-Rad GenePulser set at 0.31 kV and 960 µF. Transfected parasites were selected under drug pressure depending on the selectable marker present in the vector. pMG75-PfATP4:Myc was selected with 2.5 µg ml−1 blasticidin for blasticidin deaminase, pLN-based PfATP4:wt and PfATP4:TM8Mut were selected with 1.5uM DSM1 for yDHODH (Yeast dihydroorotate dehydrogenase) and 125 µg ml−1 G418 was used for Integrase plasmid selection. PfATP4 antibody generation Forward primer containing a 5’BamHI site CAGTCGGATCCTCTGATAAAACCGGTACATTAACTGAAG and a reverse primer CTACACTCGAGTTAAGCTTCTTTTACTCCAGGTCTTGGGGGATC containing a 3’ stop codon and an XhoI Site were used to amplify a 911 bp fragment encoding amino acids 449-760 of PfATP4. The resulting fragment was cloned into pSC-B vector (Stratagene/Agilent Technologies), sequence- confirmed and subsequently subcloned into a pET28a for expression of a His- tagged protein. The plasmid was transformed into BL21Codonplus (DE3)RIL (Agilent Technologies) and the protein was isolated using a Ni-NTA column (Qiagen). 25 µg of isolated protein was used to immunize mice by subcutaneous injection with complete Freund’s adjuvant, and boosted 3 times with incomplete Freund’s adjuvant to generate PfATP4 antibody. Phylogenetic analysis Accession numbers of the sequences chosen for alignment are listed in SI Appendix Table 1. Sequences from stramenopile and chlorophyte groups were not previously considered in similar phylogenetic analyses. Sequences of PIIA ATPases, PIIA being among the closest sister clades to PIID (2, 3), were chosen as outgroup sequences. Alignments generated by TCoffee (4), MAFFT (L-INS-i) and MAFFT (G-INS-i) (5) with various parameter settings were examined, and all presented largely similar conserved regions; the final alignment was generated using MAFFT (G-INS-i+homologues). Unambiguously aligned columns were chosen with the assistance of Guidance II (6). The trimmed alignment was subjected to maximum likelihood phylogenetic analysis by PhyML (7) using the optimal substitution model, LG, chosen by SMS (8). Phylogenetic tree output was viewed and arranged for presentation using the Tree Explorer module in the MEGA 6 package (9) with labeling enhanced using Inkscape (http://www.inkscape.org). Table S1: Non abbreviated versions of PIID ATPases used for phylogenetic analysis with short identifier code and accession number Name Short identifier code NCBI/EMBL accession number Plasmodium falciparum PLAfa XP_024329152.1 P. gallinaceum PLAga XP_028528696.1 P. vivax PLAvi SGX79514.1 Babesia bovis, , BABbo XP_001610924.1 Theileria parva THEpa XP_766241.1 Toxoplasma gondii TOXgo XP_018635122.1 Besnoitia besnoiti BESbe PFH31327.1 Eimeria maxima EIMma XP_013334395.1 Cryptosporidium parvum CRYpa XP_625857.1 C. muris CRYmu XP_002140372.1 Vitrella brassicaformis VITbr1 CEM38216.1 Chromera velia CHRve CEM43005.1 (EMBL) Vitrella brassicaformis VITbr2 CEM23227.1 Symbiodinium SYMmi OLQ04979.1 microadriaticum Breviolum minutum# BREmi symbB1.v1.2.025174 Micromonas pusilla MICpu XP_003062064.1 Micromonas commoda MICco XP_002507786.1 Aureococcus AURan XP_009033039.1 anophagefferens Aphanomyces invadans APHin XP_008873575.1 Plasmopara halstedii PLAha XP_024574184.1 Phytophthora infestans PHYin XP_002899328.1 Arabidopsis thaliana (SERCA) ARAth_ECA1 NP_172259.1 Homo sapiens (SERCA) HOMsa_SERCA2 NP_733765.1 Plasmodium falciparum PLAfa_ATP6 XP_001350994.1 (SERCA) Physcomitrella patens PHYpa1 CAD91917.1 Physcomitrella patens PHYpa2 CAD91924.1 Marchantia polymorpha MARpo CAX27437.1 Riccia fluitans RICfl FN691478.1 Saccharomyces cerevisiae SACce NP_010325.1 Yarrowia lipolytica YARli XP_499639.1 Neurospora crassa NEUcr1 CAB65298.1 Coccidioides posadasii COCpo XP_003069007.1 Neurospora crassa NEUcr3 XP_962099.1 Fusarium graminearum FUSgr XP_011321377.1 Schizophyllum commune SCHco XP_003034044.1 Trichophyton rubrum TRIru XP_003238625.1 Allomyces macrogynus ALLma KNE72470.1 Trypanosoma cruzi TRYcr XP_817442.1 Trypanosoma brucei TRYbr XP_827683.1 Leishmania donovani LEIdo AAC19126.1 Leishmania major LEIma XP_003722601.1 Entamoeba invadens ENTin XP_004184491.1 #(formerly Symbiodinium minutum) Breviolum minutum sequence retrieved from the genome project: https://marinegenomics.oist.jp/symb/viewer/info?project_id=21 (10). Supplemental Figures Figure S1 Figure S1: Phylogenetic analysis of PIID ATPases. Phylogenetic tree of type PIID ATPases with bootstrap values indicated. Sequences included and used in the figure are identified using the short identifier (Uniprot style). Accession numbers and full versions of the genus and species are given in Table S1 with highlighted colors. Figure S2 Figure S2: General domain representation of PII ATPases based on SERCA. All PII ATPases are organized into three cytoplasmic domains: Actuator (A), Phosphorylation (P), Nucleotide-binding (N). In addition, 2 distinct domains are membrane embedded: Transport (T) and Support (S). The A domain acts as an intrinsic protein phosphatase which is connected to the transmembrane region by 3 long linker sequences to the transport domain of the transmembrane region (T1, T2, and T3) which are flexible and allow for the rotation of the A domain. The N domain is an insertion into the P domain, and is responsible for ATP-binding and phosphorylating the P domain. The T domain consists of 6 transmembrane helices and contains the ion binding site(s). The T domain is highly flexible during the catalytic cycle as ions associate and dissociate accompanied by phosphorylation/dephosphorylation cycles. The number of ion-binding sites vary in different PII ATPases. In PIIC ATPases, S domain harbors an additional ion- binding site. The S domain is an ancillary unit that provides structural support to the T domain during the catalytic cycle to support the massive structural changes that accompany ion-pumping. Figure S3 Figure S3. Generation of endogenous PfATP4:Myc conditional knockdown parasite lines. (a) Schematic representation of the single crossover recombination strategy that was used to generate NF54attBPfATP4:Myc parasite in which PfATP4 expression is regulated by the TetR:DOZi aptamer system at the endogenous locus. (b) Western blots of NF54attBPfATP4:Myc parasite lysate probed with anti-c-Myc and anti-PfATP4 antibody showing successful knockdown of endogenous PfATP4 upon removal of aTc within 48hpi. (c) Growth curves of NF54attBPfATP4:Myc parasites in the presence and absence of 250 nM aTc. Cultures were split 1:2 at 48 and 96 hpi, percent cumulative parasitemia was calculated by multiplying parasitemia and the split factor over time; representative of 3 biological replicates. Figure S4 Figure S4: Susceptibility of the PfATP4 complex to ionic detergents. (a) BN- PAGE and western blot analysis of digitonin solubilized lysate from NF54attBPfATP4:Myc in the presence of increasing concentration of ionic detergents SDS and deoxycholate below their CMC (upper panel), SDS-PAGE analysis of the digitonin solubilized sample showing the presence of monomeric PfATP4 (lower panel). Both blots were probed with anti-c-Myc antibody (b) SDS- PAGE analysis of sample that was originally used for BN-PAGE as shown in Figure 1d, panel 4. The sample treated with 8 M urea shows the presence of aggregated PfATP4, suggesting that the inability to detect monomeric PfATP4 in BN-PAGE is likely because of the highly hydrophobic nature of this protein which may prevent its entry into the native gel. The blot was probed with anti-c-Myc. Figure S5 Figure S5. Generation of merodiploid parasite line bearing wildtype PfATP4. Schematic representation of the integration
Load more

Recommended publications
  • Exploration of Laboratory Techniques Relating to Cryptosporidium Parvum Propagation, Life Cycle Observation, and Host Immune Responses to Infection
    EXPLORATION OF LABORATORY TECHNIQUES RELATING TO CRYPTOSPORIDIUM PARVUM PROPAGATION, LIFE CYCLE OBSERVATION, AND HOST IMMUNE RESPONSES TO INFECTION A Thesis Submitted to the Graduate Faculty of the North Dakota State University of Agriculture and Applied Science By Cheryl Marie Brown In Partial Fulfillment for the Degree of MASTER OF SCIENCE Major Department: Veterinary and Microbiological Sciences February 2014 Fargo, North Dakota North Dakota State University Graduate School Title EXPLORATION OF LABORATORY TECHNIQUES RELATING TO CRYPTOSPORIDIUM PARVUM PROPAGATION, LIFE CYCLE OBSERVATION, AND HOST IMMUNE RESPONSES TO INFECTION By Cheryl Marie Brown The Supervisory Committee certifies that this disquisition complies with North Dakota State University’s regulations and meets the accepted standards for the degree of MASTER OF SCIENCE SUPERVISORY COMMITTEE: Dr. Jane Schuh Chair Dr. John McEvoy Dr. Carrie Hammer Approved: 4-8-14 Dr. Charlene Wolf-Hall Date Department Chair ii ABSTRACT Cryptosporidium causes cryptosporidiosis, a self-limiting diarrheal disease in healthy people, but causes serious health issues for immunocompromised individuals. Cryptosporidiosis has been observed in humans since the early 1970s and continues to cause public health concerns. Cryptosporidium has a complicated life cycle making laboratory study challenging. This project explores several ways of studying Cryptosporidium parvum, with a goal of applying existing techniques to further understand this life cycle. Utilization of a neonatal mouse model demonstrated laser microdissection as a tool for studying host immune response to infeciton. A cell culture technique developed on FrameSlides™ enables laser microdissection of individual infected cells for further analysis. Finally, the hypothesis that the availability of cells to infect drives the switch from asexual to sexual parasite reproduction was tested by time-series infection.
    [Show full text]
  • The Transcriptome of the Avian Malaria Parasite Plasmodium
    bioRxiv preprint doi: https://doi.org/10.1101/072454; this version posted August 31, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 The Transcriptome of the Avian Malaria Parasite 2 Plasmodium ashfordi Displays Host-Specific Gene 3 Expression 4 5 6 7 8 Running title 9 The Transcriptome of Plasmodium ashfordi 10 11 Authors 12 Elin Videvall1, Charlie K. Cornwallis1, Dag Ahrén1,3, Vaidas Palinauskas2, Gediminas Valkiūnas2, 13 Olof Hellgren1 14 15 Affiliation 16 1Department of Biology, Lund University, Lund, Sweden 17 2Institute of Ecology, Nature Research Centre, Vilnius, Lithuania 18 3National Bioinformatics Infrastructure Sweden (NBIS), Lund University, Lund, Sweden 19 20 Corresponding authors 21 Elin Videvall ([email protected]) 22 Olof Hellgren ([email protected]) 23 24 1 bioRxiv preprint doi: https://doi.org/10.1101/072454; this version posted August 31, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 25 Abstract 26 27 Malaria parasites (Plasmodium spp.) include some of the world’s most widespread and virulent 28 pathogens, infecting a wide array of vertebrates. Our knowledge of the molecular mechanisms these 29 parasites use to invade and exploit hosts other than mice and primates is, however, extremely limited. 30 How do Plasmodium adapt to individual hosts and to the immune response of hosts throughout an 31 infection? To better understand parasite plasticity, and identify genes that are conserved across the 32 phylogeny, it is imperative that we characterize transcriptome-wide gene expression from non-model 33 malaria parasites in multiple host individuals.
    [Show full text]
  • Debugging Parasite Genomes: Using Metabolic Modeling to Accelerate Antiparasitic Drug Development
    Debugging parasite genomes: Using metabolic modeling to accelerate antiparasitic drug development Maureen A. Carey Charlottesville, Virginia Bachelors of Science, Lafayette College 2014 A Dissertation presented to the Graduate Faculty of the University of Virginia in Candidacy for the Degree of Doctor of Philosophy Department of Microbiology, Immunology, and Cancer Biology University of Virginia September, 2018 i M. A. Carey ii Abstract: Eukaryotic parasites, like the casual agent of malaria, kill over one million people around the world annually. Developing novel antiparasitic drugs is a pressing need because there are few available therapeutics and the parasites have developed drug resistance. However, novel drug targets are challenging to identify due to poor genome annotation and experimental challenges associated with growing these parasites. Here, we focus on computational and experimental approaches that generate high-confidence hypotheses to accelerate labor-intensive experimental work and leverage existing experimental data to generate new drug targets. We generate genome-scale metabolic models for over 100 species to develop a parasite knowledgebase and apply these models to contextualize experimental data and to generate candidate drug targets. M. A. Carey iii Figure 0.1: Image from blog.wellcome.ac.uk/2010/06/15/of-parasitology-and-comics/. Preamble: Eukaryotic single-celled parasites cause diseases, such as malaria, African sleeping sickness, diarrheal disease, and leishmaniasis, with diverse clinical presenta- tions and large global impacts. These infections result in over one million preventable deaths annually and contribute to a significant reduction in disability-adjusted life years. This global health burden makes parasitic diseases a top priority of many economic development and health advocacy groups.
    [Show full text]
  • (Haemosporida: Haemoproteidae), with Report of in Vitro Ookinetes of Haemoproteus Hirundi
    Chagas et al. Parasites Vectors (2019) 12:422 https://doi.org/10.1186/s13071-019-3679-1 Parasites & Vectors RESEARCH Open Access Sporogony of four Haemoproteus species (Haemosporida: Haemoproteidae), with report of in vitro ookinetes of Haemoproteus hirundinis: phylogenetic inference indicates patterns of haemosporidian parasite ookinete development Carolina Romeiro Fernandes Chagas* , Dovilė Bukauskaitė, Mikas Ilgūnas, Rasa Bernotienė, Tatjana Iezhova and Gediminas Valkiūnas Abstract Background: Haemoproteus (Parahaemoproteus) species (Haemoproteidae) are widespread blood parasites that can cause disease in birds, but information about their vector species, sporogonic development and transmission remain fragmentary. This study aimed to investigate the complete sporogonic development of four Haemoproteus species in Culicoides nubeculosus and to test if phylogenies based on the cytochrome b gene (cytb) refect patterns of ookinete development in haemosporidian parasites. Additionally, one cytb lineage of Haemoproteus was identifed to the spe- cies level and the in vitro gametogenesis and ookinete development of Haemoproteus hirundinis was characterised. Methods: Laboratory-reared C. nubeculosus were exposed by allowing them to take blood meals on naturally infected birds harbouring single infections of Haemoproteus belopolskyi (cytb lineage hHIICT1), Haemoproteus hirun- dinis (hDELURB2), Haemoproteus nucleocondensus (hGRW01) and Haemoproteus lanii (hRB1). Infected insects were dissected at intervals in order to detect sporogonic stages. In vitro exfagellation, gametogenesis and ookinete development of H. hirundinis were also investigated. Microscopic examination and PCR-based methods were used to confrm species identity. Bayesian phylogenetic inference was applied to study the relationships among Haemopro- teus lineages. Results: All studied parasites completed sporogony in C. nubeculosus. Ookinetes and sporozoites were found and described. Development of H. hirundinis ookinetes was similar both in vivo and in vitro.
    [Show full text]
  • Plasmodium Asexual Growth and Sexual Development in the Haematopoietic Niche of the Host
    REVIEWS Plasmodium asexual growth and sexual development in the haematopoietic niche of the host Kannan Venugopal 1, Franziska Hentzschel1, Gediminas Valkiūnas2 and Matthias Marti 1* Abstract | Plasmodium spp. parasites are the causative agents of malaria in humans and animals, and they are exceptionally diverse in their morphology and life cycles. They grow and develop in a wide range of host environments, both within blood- feeding mosquitoes, their definitive hosts, and in vertebrates, which are intermediate hosts. This diversity is testament to their exceptional adaptability and poses a major challenge for developing effective strategies to reduce the disease burden and transmission. Following one asexual amplification cycle in the liver, parasites reach high burdens by rounds of asexual replication within red blood cells. A few of these blood- stage parasites make a developmental switch into the sexual stage (or gametocyte), which is essential for transmission. The bone marrow, in particular the haematopoietic niche (in rodents, also the spleen), is a major site of parasite growth and sexual development. This Review focuses on our current understanding of blood-stage parasite development and vascular and tissue sequestration, which is responsible for disease symptoms and complications, and when involving the bone marrow, provides a niche for asexual replication and gametocyte development. Understanding these processes provides an opportunity for novel therapies and interventions. Gametogenesis Malaria is one of the major life- threatening infectious Malaria parasites have a complex life cycle marked Maturation of male and female diseases in humans and is particularly prevalent in trop- by successive rounds of asexual replication across gametes. ical and subtropical low- income regions of the world.
    [Show full text]
  • Malaria During the Last Decade1
    MALARIA DURING THE LAST DECADE1 MARTIN D. YOUNG National Institutes of Health, National Microbiological Institute, Laboratory of Tropical Diseases, Columbia, South Carolina The starting point of this paper is rather arbitrarily set at January, 1942, but the selection of this date also has some significance in the knowledge of malaria. Much of the world had just become involved in a great war and was being con fronted with problems in disease control relative to the military. Of these diseases by far the most important was malaria. The following is concerned mainly with human malaria and is not intended to be a comprehensive review of the field but rather of those developments which appear to me to be significant. Of the tremendous amount of work that has gone on in the malaria of lower animals, reference will be made only to such as is particularly relevant to human malaria or that which can serve for comparison to point up the particular dis cussion at hand. BIOLOGY During this period little attention was paid to the cytology of the parasite- However, MacDougall (1947), studying Plasmodium vivax and P. falciparum and working specifically with gamete formation definitely established that chro mosomes were present in plasmodial parasites. Such had been indicated before but this was the first definitive proof. Additional work by Wolcott (unpublished) indicates that the asexual stages of P. vivax have two chromosomes. There have been no new species of human malaria parasites accepted during this period. Surveys and studies of infected military personnel have delineated more clearly the distribution of the recognized four species of malaria on a world wide basis and have shown that many strains, particularly of P.
    [Show full text]
  • Highly Rearranged Mitochondrial Genome in Nycteria Parasites (Haemosporidia) from Bats
    Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats Gregory Karadjiana,1,2, Alexandre Hassaninb,1, Benjamin Saintpierrec, Guy-Crispin Gembu Tungalunad, Frederic Arieye, Francisco J. Ayalaf,3, Irene Landaua, and Linda Duvala,3 aUnité Molécules de Communication et Adaptation des Microorganismes (UMR 7245), Sorbonne Universités, Muséum National d’Histoire Naturelle, CNRS, CP52, 75005 Paris, France; bInstitut de Systématique, Evolution, Biodiversité (UMR 7205), Sorbonne Universités, Muséum National d’Histoire Naturelle, CNRS, Université Pierre et Marie Curie, CP51, 75005 Paris, France; cUnité de Génétique et Génomique des Insectes Vecteurs (CNRS URA3012), Département de Parasites et Insectes Vecteurs, Institut Pasteur, 75015 Paris, France; dFaculté des Sciences, Université de Kisangani, BP 2012 Kisangani, Democratic Republic of Congo; eLaboratoire de Biologie Cellulaire Comparative des Apicomplexes, Faculté de Médicine, Université Paris Descartes, Inserm U1016, CNRS UMR 8104, Cochin Institute, 75014 Paris, France; and fDepartment of Ecology and Evolutionary Biology, University of California, Irvine, CA 92697 Contributed by Francisco J. Ayala, July 6, 2016 (sent for review March 18, 2016; reviewed by Sargis Aghayan and Georges Snounou) Haemosporidia parasites have mostly and abundantly been de- and this lack of knowledge limits the understanding of the scribed using mitochondrial genes, and in particular cytochrome evolutionary history of Haemosporidia, in particular their b (cytb). Failure to amplify the mitochondrial cytb gene of Nycteria basal diversification. parasites isolated from Nycteridae bats has been recently reported. Nycteria parasites have been primarily described, based on Bats are hosts to a diverse and profuse array of Haemosporidia traditional taxonomy, in African insectivorous bats of two fami- parasites that remain largely unstudied.
    [Show full text]
  • Host Specificity in Avian Blood Parasites: a Study of Plasmodium and Haemoproteus Mitochondrial DNA Amplified from Birds
    Host specificity in avian blood parasites: a study of Plasmodium and Haemoproteus mitochondrial DNA amplified from birds Bensch, Staffan; Stjernman, Martin; Hasselquist, Dennis; Östman, Örjan; Hansson, Bengt; Westerdahl, Helena; Pinheiro, RT Published in: Royal Society of London. Proceedings B. Biological Sciences DOI: 10.1098/rspb.2000.1181 2000 Link to publication Citation for published version (APA): Bensch, S., Stjernman, M., Hasselquist, D., Östman, Ö., Hansson, B., Westerdahl, H., & Pinheiro, RT. (2000). Host specificity in avian blood parasites: a study of Plasmodium and Haemoproteus mitochondrial DNA amplified from birds. Royal Society of London. Proceedings B. Biological Sciences, 267(1452), 1583-1589. https://doi.org/10.1098/rspb.2000.1181 Total number of authors: 7 General rights Unless other specific re-use rights are stated the following general rights apply: Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Read more about Creative commons licenses: https://creativecommons.org/licenses/ Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • Chickens Treated with a Nitric Oxide Inhibitor
    Macchi et al. Veterinary Research 2013, 44:8 http://www.veterinaryresearch.org/content/44/1/8 VETERINARY RESEARCH RESEARCH Open Access Chickens treated with a nitric oxide inhibitor became more resistant to Plasmodium gallinaceum infection due to reduced anemia, thrombocytopenia and inflammation Barbarella Matos de Macchi1,2†, Farlen José Bebber Miranda1†, Fernanda Silva de Souza1, Eulógio Carlos Queiroz de Carvalho3, Antônio Peixoto Albernaz4, José Luiz Martins do Nascimento2† and Renato Augusto DaMatta1*† Abstract Malaria is a serious infectious disease caused by parasites of the Plasmodium genus that affect different vertebrate hosts. Severe malaria leads to host death and involves different pathophysiological phenomena such as anemia, thrombocytopenia and inflammation. Nitric oxide (NO) is an important effector molecule in this disease, but little is known about its role in avian malaria models. Plasmodium gallinaceum- infected chickens were treated with aminoguanidine (AG), an inhibitor of inducible nitric oxide synthase, to observe the role of NO in the pathogenesis of this avian model. AG increased the survival of chickens, but also induced higher parasitemia. Treated chickens demonstrated reduced anemia and thrombocytopenia. Moreover, erythrocytes at different stages of maturation, heterophils, monocytes and thrombocytes were infected by Plasmodium gallinaceum and animals presented a generalized leucopenia. Activated leukocytes and thrombocytes with elongated double nuclei were observed in chickens with higher parasitemia; however,
    [Show full text]
  • A Fragment of Malaria History W Lobato Paraense
    Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 99(4): 439-442, June 2004 439 HISTORICAL REVIEW A Fragment of Malaria History W Lobato Paraense Departamento de Malacologia, Instituto Oswaldo Cruz-Fiocruz, Av. Brasil 4365, 21045-900 Rio de Janeiro, RJ, Brasil My nomination for the Henrique Aragão Medal takes In 1900 Battista Grassi, having observed morphologi- me back to the distant past. About fifty years ago I was cal differences between the nuclei of the sporozoite and interested in the current polemic in the field of malariol- of the youngest red cell trophozoite, hypothesized that ogy – the exoerythrocytic cycle of the malaria parasite. an intermediate stage would occur between the two forms. I joined the Instituto Oswaldo Cruz in early 1939 as a Three years later, in a memorable paper on Plasmodium research assistant at the Sege (Serviço de Estudo das vivax, Fritz Schaudinn (1903) described in detail the pen- Grandes Endemias), directed by Evandro Chagas and in- etration of the red cell by the sporozoite. In that paper, volved in investigations on endemic diseases – chiefly which for three decades stood as a classic work in malari- malaria, Chagas disease, and visceral leishmaniasis (kala ology, he considered Grassi’s hypothesis to be improb- azar). My first task was to examine the organs of wild able. animals from endemic areas of kala azar – recently discov- It was not until 1940 that the controversy caused ered in Brazil – to verify the hypothesis that they could be by Schaudinn’s statement on the immediate fate of the primitive reservoirs of Leishmania chagasi.
    [Show full text]
  • The Role of Rhomboid Proteases and a Oocyst Capsule Protein
    THE ROLE OF RHOMBOID PROTEASES AND A OOCYST CAPSULE PROTEIN IN MALARIA PATHOGENESIS AND PARASITE DEVELOPMENT BY PRAKASH SRINIVASAN Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Thesis Advisor: Prof. Marcelo Jacobs-Lorena Department of Genetics CASE WESTERN RESERVE UNIVERSITY August, 2007 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of ______________________________________________________ candidate for the Ph.D. degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS Table of Contents 1 List of Tables 2 List of Figures 4 Acknowledgements 5 Abstract 7 CHAPTER 1: Introduction and Research Objectives 9 Introduction 10 Malaria: History and Facts 10 Discovery of Mosquitoes as vectors 10 Malaria: Life Cycle 12 Life cycle in the vertebrate host 12 Life cycle in the mosquito 15 Sporozoite invasion of the liver 29 Study of gene function in parasites 32 Research Objectives 34 CHAPTER 2: Analysis of Plasmodium and Anopheles Transcriptomes during Oocyst Differentiation 37 CHAPTER 3: PbCap380, a novel Plasmodium Oocyst Capsule Protein
    [Show full text]
  • ABSTRACT ULLAL, ANIRUDH JAIWANT. Extraerythrocytic
    ABSTRACT ULLAL, ANIRUDH JAIWANT. Extraerythrocytic expression of the β-subunit of hemoglobin is associated with a potent anti-parasitic defense in fish. (Under the direction of Dr. Edward J. Noga.) Innate immunity plays a crucial role in the defense against prokaryotic and eukaryotic pathogens. Major components of this defense are antimicrobial peptides (AMPs). Some AMPs are derived from larger proteins with other recognized functions (e.g., lactoferrin, histones). In this study, we demonstrate the expression of peptides homologous to the β-chain of hemoglobin (Hb-β), one of the two major subunits of this respiratory protein. These Hb-β peptides (HbβP-1, -2 and -3), isolated from gill of the economically important channel catfish (Ictalurus punctatus), had antibacterial activity and were upregulated in gill and skin epithelium in response to parasitic (Ichthyophthirius multifiliis, ich) infection. One peptide (HbβP-1), while having relatively weak antibacterial activity had antiparasitic activity comparable to that of other potently antiparasitic AMPs. Also, this cidal activity was specifically directed against the trophozoite (trophont) stage of ich at a low concentration (6.2 μg/ml, 1.7 μM) but had no apparent effect on the disseminative (theront) stage or the reproductive (tomont) stage at the highest concentration tested (400 μg/ml, 108 μM). In addition, HbβP-1 was not lytic to channel catfish erythrocytes at the highest concentration tested (400 μg/ml, 108 μM). Immunohistochemistry and in situ hybridization of skin and gill from fish experimentally challenged with ich indicated that the HbβP-1 sequence was both synthesized and expressed in epithelial tissues of skin and gill, which are the target tissues for ich.
    [Show full text]