![Ramanathan Et Al SI Biorxiv Format](https://data.docslib.org/img/3a60ab92a6e30910dab9bd827208bcff-1.webp)
Oligomerization of the antimalarial drug target PfATP4 is essential for parasite survival Aarti A. Ramanathan*, Joanne M. Morrisey*, Thomas M. Daly*, Lawrence W. Bergman*, Michael W. Mather*, Akhil B. Vaidya*† *Drexel University College of Medicine, Philadelphia, PA 19129 †To whom correspondence may be addressed Email: [email protected], Tel: +1-215.991.8557 Classification Biochemistry, Microbiology Keywords PfATP4, Antimalarial drug target, Plasmodium falciparum, P-Type ATPase Supplemental methods Plasmid vectors and generation of transgenic parasites NF54PfATP4:Myc parasite line was generated through single cross-over recombination with a modified pMG75 vector from which attP sequence was removed. For generating the wildtype merodiploid line, the full-length PfATP4 gene was amplified by PCR using genomic DNA from wildtype Dd2 parasite line and was cloned into pSC-B vector (Stratagene/Agilent Technologies). DNA sequences were confirmed and subcloned into pLN-based plasmid using AvrII and BsiWI, to be expressed under the calmodulin promoter, with a 3xHA tag at the C-terminal end. For PfATP4:TM8Mut vector, the pSC-B PfATP4 wildtype vector was modified. W1231A, and F1245V mutations were generated by amplifying PfATP4 using mutant oligos 5’ GCTAATAAATATTGTGCCCATAACAAACATGTTGTATTCAAAATAGAAG 3’ and 5’CTCTTTTAAATTTAGTATTAGATGAAATAGTACCAAAGGTTATATATAGAAG 3’ and assembled with oligo 5’TGTTATGGGCACAATATTTATTAGCTATAGTTTGGGCTCTTTTAAATTTAGTATTAG ATGAA 3’, carrying the F1238V mutation in a 2 piece DNA assembly reaction (New England Biolabs). The mutant clone was confirmed via sequencing and subcloned in a pLN-based plasmid as described above. Transfections for generating merodiploid P. falciparum parasites were carried out using Mycobacteriophage integrase system as described previously (1). Briefly, ring-stage parasites at 5% parasitemia were electroporated with 50 µg each of the vector and integrase plasmid. Electroporation was conducted using a Bio-Rad GenePulser set at 0.31 kV and 960 µF. Transfected parasites were selected under drug pressure depending on the selectable marker present in the vector. pMG75-PfATP4:Myc was selected with 2.5 µg ml−1 blasticidin for blasticidin deaminase, pLN-based PfATP4:wt and PfATP4:TM8Mut were selected with 1.5uM DSM1 for yDHODH (Yeast dihydroorotate dehydrogenase) and 125 µg ml−1 G418 was used for Integrase plasmid selection. PfATP4 antibody generation Forward primer containing a 5’BamHI site CAGTCGGATCCTCTGATAAAACCGGTACATTAACTGAAG and a reverse primer CTACACTCGAGTTAAGCTTCTTTTACTCCAGGTCTTGGGGGATC containing a 3’ stop codon and an XhoI Site were used to amplify a 911 bp fragment encoding amino acids 449-760 of PfATP4. The resulting fragment was cloned into pSC-B vector (Stratagene/Agilent Technologies), sequence- confirmed and subsequently subcloned into a pET28a for expression of a His- tagged protein. The plasmid was transformed into BL21Codonplus (DE3)RIL (Agilent Technologies) and the protein was isolated using a Ni-NTA column (Qiagen). 25 µg of isolated protein was used to immunize mice by subcutaneous injection with complete Freund’s adjuvant, and boosted 3 times with incomplete Freund’s adjuvant to generate PfATP4 antibody. Phylogenetic analysis Accession numbers of the sequences chosen for alignment are listed in SI Appendix Table 1. Sequences from stramenopile and chlorophyte groups were not previously considered in similar phylogenetic analyses. Sequences of PIIA ATPases, PIIA being among the closest sister clades to PIID (2, 3), were chosen as outgroup sequences. Alignments generated by TCoffee (4), MAFFT (L-INS-i) and MAFFT (G-INS-i) (5) with various parameter settings were examined, and all presented largely similar conserved regions; the final alignment was generated using MAFFT (G-INS-i+homologues). Unambiguously aligned columns were chosen with the assistance of Guidance II (6). The trimmed alignment was subjected to maximum likelihood phylogenetic analysis by PhyML (7) using the optimal substitution model, LG, chosen by SMS (8). Phylogenetic tree output was viewed and arranged for presentation using the Tree Explorer module in the MEGA 6 package (9) with labeling enhanced using Inkscape (http://www.inkscape.org). Table S1: Non abbreviated versions of PIID ATPases used for phylogenetic analysis with short identifier code and accession number Name Short identifier code NCBI/EMBL accession number Plasmodium falciparum PLAfa XP_024329152.1 P. gallinaceum PLAga XP_028528696.1 P. vivax PLAvi SGX79514.1 Babesia bovis, , BABbo XP_001610924.1 Theileria parva THEpa XP_766241.1 Toxoplasma gondii TOXgo XP_018635122.1 Besnoitia besnoiti BESbe PFH31327.1 Eimeria maxima EIMma XP_013334395.1 Cryptosporidium parvum CRYpa XP_625857.1 C. muris CRYmu XP_002140372.1 Vitrella brassicaformis VITbr1 CEM38216.1 Chromera velia CHRve CEM43005.1 (EMBL) Vitrella brassicaformis VITbr2 CEM23227.1 Symbiodinium SYMmi OLQ04979.1 microadriaticum Breviolum minutum# BREmi symbB1.v1.2.025174 Micromonas pusilla MICpu XP_003062064.1 Micromonas commoda MICco XP_002507786.1 Aureococcus AURan XP_009033039.1 anophagefferens Aphanomyces invadans APHin XP_008873575.1 Plasmopara halstedii PLAha XP_024574184.1 Phytophthora infestans PHYin XP_002899328.1 Arabidopsis thaliana (SERCA) ARAth_ECA1 NP_172259.1 Homo sapiens (SERCA) HOMsa_SERCA2 NP_733765.1 Plasmodium falciparum PLAfa_ATP6 XP_001350994.1 (SERCA) Physcomitrella patens PHYpa1 CAD91917.1 Physcomitrella patens PHYpa2 CAD91924.1 Marchantia polymorpha MARpo CAX27437.1 Riccia fluitans RICfl FN691478.1 Saccharomyces cerevisiae SACce NP_010325.1 Yarrowia lipolytica YARli XP_499639.1 Neurospora crassa NEUcr1 CAB65298.1 Coccidioides posadasii COCpo XP_003069007.1 Neurospora crassa NEUcr3 XP_962099.1 Fusarium graminearum FUSgr XP_011321377.1 Schizophyllum commune SCHco XP_003034044.1 Trichophyton rubrum TRIru XP_003238625.1 Allomyces macrogynus ALLma KNE72470.1 Trypanosoma cruzi TRYcr XP_817442.1 Trypanosoma brucei TRYbr XP_827683.1 Leishmania donovani LEIdo AAC19126.1 Leishmania major LEIma XP_003722601.1 Entamoeba invadens ENTin XP_004184491.1 #(formerly Symbiodinium minutum) Breviolum minutum sequence retrieved from the genome project: https://marinegenomics.oist.jp/symb/viewer/info?project_id=21 (10). Supplemental Figures Figure S1 Figure S1: Phylogenetic analysis of PIID ATPases. Phylogenetic tree of type PIID ATPases with bootstrap values indicated. Sequences included and used in the figure are identified using the short identifier (Uniprot style). Accession numbers and full versions of the genus and species are given in Table S1 with highlighted colors. Figure S2 Figure S2: General domain representation of PII ATPases based on SERCA. All PII ATPases are organized into three cytoplasmic domains: Actuator (A), Phosphorylation (P), Nucleotide-binding (N). In addition, 2 distinct domains are membrane embedded: Transport (T) and Support (S). The A domain acts as an intrinsic protein phosphatase which is connected to the transmembrane region by 3 long linker sequences to the transport domain of the transmembrane region (T1, T2, and T3) which are flexible and allow for the rotation of the A domain. The N domain is an insertion into the P domain, and is responsible for ATP-binding and phosphorylating the P domain. The T domain consists of 6 transmembrane helices and contains the ion binding site(s). The T domain is highly flexible during the catalytic cycle as ions associate and dissociate accompanied by phosphorylation/dephosphorylation cycles. The number of ion-binding sites vary in different PII ATPases. In PIIC ATPases, S domain harbors an additional ion- binding site. The S domain is an ancillary unit that provides structural support to the T domain during the catalytic cycle to support the massive structural changes that accompany ion-pumping. Figure S3 Figure S3. Generation of endogenous PfATP4:Myc conditional knockdown parasite lines. (a) Schematic representation of the single crossover recombination strategy that was used to generate NF54attBPfATP4:Myc parasite in which PfATP4 expression is regulated by the TetR:DOZi aptamer system at the endogenous locus. (b) Western blots of NF54attBPfATP4:Myc parasite lysate probed with anti-c-Myc and anti-PfATP4 antibody showing successful knockdown of endogenous PfATP4 upon removal of aTc within 48hpi. (c) Growth curves of NF54attBPfATP4:Myc parasites in the presence and absence of 250 nM aTc. Cultures were split 1:2 at 48 and 96 hpi, percent cumulative parasitemia was calculated by multiplying parasitemia and the split factor over time; representative of 3 biological replicates. Figure S4 Figure S4: Susceptibility of the PfATP4 complex to ionic detergents. (a) BN- PAGE and western blot analysis of digitonin solubilized lysate from NF54attBPfATP4:Myc in the presence of increasing concentration of ionic detergents SDS and deoxycholate below their CMC (upper panel), SDS-PAGE analysis of the digitonin solubilized sample showing the presence of monomeric PfATP4 (lower panel). Both blots were probed with anti-c-Myc antibody (b) SDS- PAGE analysis of sample that was originally used for BN-PAGE as shown in Figure 1d, panel 4. The sample treated with 8 M urea shows the presence of aggregated PfATP4, suggesting that the inability to detect monomeric PfATP4 in BN-PAGE is likely because of the highly hydrophobic nature of this protein which may prevent its entry into the native gel. The blot was probed with anti-c-Myc. Figure S5 Figure S5. Generation of merodiploid parasite line bearing wildtype PfATP4. Schematic representation of the integration
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages24 Page
-
File Size-