A Sorghum Propinquum BAC Library, Suitable for Cloning Genes Associated with Loss-Of-Function Mutations During Crop Domestication

A Sorghum propinquum BAC library, suitable for cloning genes associated with loss-of-function mutations during crop domestication

Yann-Rong Lin1, Linghua Zhu1, Shuxin Ren1, Jinshui Yang2, Keith F. Schertz3 & Andrew H. Paterson1,4,∗ 1Department of Soil and Crop Sciences, Texas A&M University, College Station, TX 77843-2474, USA; 2Institute of Genetics, Fudan University, Shanghai, 200433, P.R. China; 3USDA-ARS, College Station, TX 77843-2474, USA; 4Department of Crop and Soil Science, University of Georgia, Athens GA 30602, USA (∗author for correspondence, send correspondence to address #4; fax 002-1-706-583-0162; e-mail [email protected])

Received 23 July 1998; accepted in revised form 23 March 1999

Key words: BAC, positional cloning, Sorghum propinquum

Abstract AlargeinsertSorghum propinquum BAC library has been constructed to analyze the physical organization of the sorghum genome and to facilitate positional cloning of sorghum genes and QTLs associated with the early stages of grain crop domestication. This library was established from 12 different ligations using high-molecular-weight DNA generated from either one cycle or two cycles of size selection. This library consists of 38 016 BAC clones with an estimated average insert size of 126 kb and coverage of 6.6 genome equivalents. The 6.6 genome-equivalent BAC library of S. propinquum provides a 99.7% probability of ﬁnding one or more BACs that contain genes of interest. Twenty mapped DNA probes, ten homologous and ten heterologous, were used to screen the library, and 121 positive clones were identiﬁed, 6.05 per locus or 6.37 per probe.

Abbreviations: BAC, bacterial artiﬁcial chromosome; QTL, quantitative trait locus

Introduction Dominant and additive alleles have advantages over recessive alleles for positional cloning. Test- Genetic mapping of crosses between cultivated plants ing of candidate DNA sequences for mutant com- and their wild relatives has shown that at many loci, plementation requires that the candidate sequence be crop domestication has been associated with selec- genetically dominant or additive to the native se- tion for recessive mutant alleles in the cultivated type. quence. Further, some loss-of function mutations may For example, studies of fruit mass (size) and Brix be deletions that substantially truncate or eliminate (soluble solids concentration) of tomato (Lycopersi- transcripts. This would preclude the use of many meth- con esculentum,2n = 24) have shown that the ods for identifying candidate transcripts. Thus, BAC majority of QTLs with either dominant and/or ad- libraries of wild species that harbor dominant and ditive effects were contributed by wild species [55]. additive alleles for many traits offer unique advan- Six traits related to domestication were analyzed in tages for map-based cloning (positional cloning). This the F2 of Sorghum bicolor BTx623(a cultivar) × S. propinquum BAC library provides a valuable com- Sorghum propinquum (a wild relative of S. bicolor), plement to an established S. bicolor BAC library [52] and S. propinquum possessed most of the dominant for cloning of genes associated with domestication and alleles (Table 1) [39] at ﬁve traits (grain shattering, many other traits. plant height, ﬂowering time, tiller number, rhizoma- Sorghum is a suitable species for positional cloning tousness). because of its relatively small genome size and high- density RFLP map. The haploid genome size of 512

Table 1. Mode of gene action of S. propinquum alleles for six recombination (S. Choi and R. Wing, unpublished traits related to domestication. data); and linearized BAC DNA using the Cre-lox sys- Trait Number of Mode of gene actiona tem has been used successfully to generate transgenic genes/QTLs D A R O animals [35]. BAC clones are also suitable for FISH (fluorescence in situ hybridization) analysis which en- Shattering 1 1 0 0 0 ables direct gene localization on chromosomes [29, Plant height 6 4 1 1 1 45, 52]. Flowering 3 2 0 0 0 Tiller number 4 1 2 0 0 We describe the construction and characterization Rhizomatousness 8 2 4 1 1 of a BAC library of S. propinquum. S. propinquum Seed size 9 2 1 0 0 has been utilized in RFLP linkage mapping and QTL Sum 31 12 8 2 2 analysis of many important traits related to sorghum domestication and productivity [16, 31, 38, 40]. Fur- aD, dominant; A, additive; R, recessive; O, overdominant. ther, S. propinquum appears to have been the ancestor that conferred many ‘weediness’ traits to johnsongrass (S. halepense), so offers opportunities to pursue new = sorghum is ca. 760 Mb (1C 0.8 pg) [4], second dimensions in agricultural research [40]. A 2.7× BAC smallest only to rice among major crops in the Poaceae library has already been made for the S. bicolor family, and the chromosome number of both Sorghum mapping parent that was crossed to S. propinquum = bicolor and S. propinquum is 2n 20 [24]. At least for RFLP [16] and QTL mapping [31, 38, 40]. A six sorghum linkage maps have been established by S. propinquum library is a valuable complement. RFLP and other DNA markers [8, 9, 16, 28, 41, 42, 50, 53]. More than 2100 RFLP loci have been mapped × on the interspecific F2 population of S. bicolor Materials and methods S. propinquum [ 16, Paterson et al., unpublished data). This high density of DNA markers, about 0.7 cM or an S. propinquum BAC library construction average of 350 kb between DNA markers, is suitable for fine mapping of gene(s) and QTLs, and physical Megabase DNA isolation for ligation mapping. Vegetative clones of the S. propinquum mapping par- Positional cloning has been successfully used to ent (unnamed accession) were grown in the green- clone several important genes in plants [3, 13, 33, 46]. house. Young leaves were cut into small pieces, One essential factor for positional cloning is a large wrapped in foil, and stored at −80 ◦C. To isolate insert DNA library to expedite ‘chromosome walk- megabase DNA, the nuclei preparation methods of ing’. Although YAC vectors [10] can carry inserts over Zhao et al. [58] and Zhang et al. [57) were adopted 900 kb [18, 20, 26], they are associated with problems with modifications. Young leaf tissue was put in liq- such as chimerism, insert rearrangement, clonal in- uid nitrogen and ground into powder. The powder stability, and difficulty of manipulation. BAC vectors was homogenized with 1× HB buffer (10 mM Tris, [25, 45], which are Escherichia coli F factor-based 80 mM KCl, 10 mM EDTA, 1 mM spermine, 1 mM systems, are easier to manipulate and do not have spermidine; 0.5 M sucrose, pH 9.4–9.5), 0.15% 2- the chimerism problem because they have only one mercaptoethanol and 0.5% Triton. The isolated nuclei or two copies per cell. Xa21, a rice disease resistance were embedded in agarose plugs with SCE buffer gene, is the first example of positional cloning using a (1 M sorbitol, 0.1 M sodium citrate, 60 mM EDTA, BAC library [46]. By anchoring ‘BAC islands’ to high- pH 7.0) and lysed with lysis buffer (1% sodium lauryl density RFLP maps, and aligning BACs using high sarcosine, 0.5 M EDTA pH 9.3–9.4, 1 mg/ml Pro- throughput fingerprinting [32], sequence-ready contig teinase K), at 50 ◦C for 48 h. Lysis buffer was changed maps might be generated for the complex genomes of once during lysis. Before restriction enzyme digestion, many well-mapped crops. Modified BAC vectors are the agarose plugs were washed with 0.1 mM PMSF suitable for mutant complementation testing and gene (phenylmethylsulfonyl fluoridein, Sigma, USA) for expression. For example, binary-BAC (BIBAC) vec- 1 h on ice to inactivate Proteinase K. The PMSF so- tors can be used directly for plant transformation via lution was then replaced with fresh T10E10 (10 mM Agrobacterium tumefaciens [27]; pBACwich vectors Tris-HCl, 10 mM EDTA pH 8.0) by adding fresh can be used for plant transformation by site-specific T10E10 every 20 min for 1 h. DNA agarose plugs were 513 equilibrated with restriction enzyme buffer by adding Ligation and transformation fresh buffer every 30 min for 1 h. Size-selected HindIII DNA fragments were ligated About 60 mg of S. propinquum nuclei-containing into dephosphorylated pBeloBAC11 vector at a ratio agarose plugs, which contained about 1.2 µgofDNA of 15 ng vector to 60 ng insert, in a total volume of in each plug, were sliced into small pieces and equili- 60 µl. Ligations were performed in 1× ligase buffer brated with three different amounts of HindIII (18, 24, with 200 units of T4 DNA ligase (NEB, USA) and or 30 units) plus digestion buffer (New England Bio- incubated at 16 ◦C for at least 16 h. To remove salt labs, USA) on ice for 5 h, to ensure that HindIII could from ligation buffer, ligation mix was placed on a drop diffuse into sliced plugs to achieve an even digestion. dialysis filter (Catalog number VSWP 02500, Milli- ◦ Partial digestions were incubated at 37 Cfor5min. pore, USA) and floated on 0.5× TE for 30 min to 1 h. Partially digested DNA was separated by PFGE in a Ligation mix (3 µl) was used to transform 25 µlof 1% SeaPlaque agarose gel (FMC, USA) in 1× TAE E. coli ElectroMAX DH10B cells (Gibco-BRL, USA) ◦ buffer at 14 C using HEXCHEF 6000 and the MJ by electroporation using the Gene Pulser II (BioRad, Research Programmable Power Inverter (USA). Lig- USA) at the following optimized conditions: capaci- ations 1–9 were prepared from DNA subjected to one tance 25 µF, resistance 100 , and a voltage gradient cycle of size selection with either 5 s or 8 s pulse time. of 1.8 kV/cm. After electroporation, one ml of SOC Ligations 10–12 used DNA subjected to two cycles of medium (2% Bacto tryptone, 0.5% Bacto yeast ex- size selection with an 8 s pulse time followed by a tract,10mMNaCl,2.5mMKCl,10mMMgCl2, 5 s pulse time. Electrophoresis for each size selection 10 mM MgSO4, 20 mM glucose, pH 7.0) was immedi- was done for 16 h at 5.0 V/cm. The DNA compres- ately added into cuvettes to mix the cells. The mixture sion zone above 200 kb was excised from the gel. was incubated at 37 ◦C for 45 min with shaking. About 50 mg of the gel slice was digested with Gelase Blue-white color selection was applied twice to (Epicentre Technologies, USA) according to the man- verify white (recombinant) BAC clones. As the pri- ufacturer’s instructions. An aliquot of the DNA was mary library stock, white colonies were inoculated separated by PFGE in 1× TBE buffer with 20 s pulse into 96-well plates containing 150 µl of LB freezing time for 16 h at 6.0 V/cm to check DNA size before buffer (36 mM K2HPO4, 13.2 mM KH2PO4,1.7mM ligation. sodium citrate, 0.4 mM MgSO4, 6.8 mM (NH4)2SO4, 4.4% (v/v) glycerol, 12.5 µg/ml chloramphenicol) and Preparation of BAC vector incubated at 37 ◦C overnight before freezing. As a The pBeloBAC11 (7.4 kb) vector in E. coli strain working stock, four sets of BACs, from consecu- DH10B, kindly provided by Drs H. Shizuya and M. tive 96-well plates, were then replicated into 384-well Simon [45], was streaked on an LB plate containing plates with 75 µl of LB freezing buffer and grown at 12.5 µg/ml of chloramphenicol (CM), X-Gal (70 µl 37 ◦C overnight before freezing. of 3% w/v 5-bromo-4-chloro-3-indolyl-β-galactoside) and IPTG (7 µl of 20% w/v isopropylthio-β- Insert size estimation ◦ galactoside), and grown at 37 C overnight. A single BAC clones were randomly chosen from each trans- blue colony was inoculated into 10 ml of LB (+CM) formation for insert size estimation. Each BAC clone ◦ then grown at 37 C overnight for secondary inocu- was grown in 5 ml of LB with 12.5 µg/ml CM, and lation of 10 l LB (+CM). The 10 l overnight culture supercoiled plasmid DNA was isolated using the alka- was isolated using alkaline lysis followed by two cy- line lysis method [43]. DNA pellets were dissolved in cles of cesium chloride density gradient centrifugation 40 µl TE, then 15 µl of BAC DNA were digested with [43]. The plasmid DNA yield was about 1.5 µgper 10 units of NotI (NEB, USA) and separated by PFGE liter of culture. Titration of HindIIIwasusedtofind in a 1% agarose gel in 0.5% TBE buffer at 14 ◦Cat the minimum enzyme activity needed for complete di- 6.0 V/cm with 20 s pulse time for 20 h. The MidRange gestion of the BAC vector, which in our case was 6 Marker II (NEB, USA), a 24.5 kb DNA ladder marker, ◦ units of HindIII per µgofvectorDNAat37 Cfor was used to estimate insert size. 45 min. Self ligation was then applied to check for false-positive white colonies. The linear BAC vector DNA was dephosphorylated by Shrimp Alkaline Phos- phatase (USB, USA) following the manufacturer’s instructions. 514

Screening of the BAC library tion was overlaid with 25 µl of mineral oil. PCR was carried out using a Perkin-Elmer-Cetus Model 9600 Filter preparation with the following program: 97 ◦Cfor1min;52◦Cfor + A total of 99 Hybond N (8.0 cm × 11.5 cm) (Amer- 1min;72◦C for 45 s and increased 4 s per cycle for 30 sham, USA) filters containing the whole library were cycles; 72 ◦C for 7 min for 1 cycle. The PCR-amplified prepared manually. Each filter was inoculated with sequences were also used to screen the library. 384 BAC clones using a 384-well replica plating de- vice (NUNC, Denmark), and placed on LB agar plates ◦ with 12.5 µg/ml CM, and incubated at 37 C for 16 to Results 20 h until the diameters of colonies were about 3 mm. The filters, colony side up, were treated by placing on Construction of the S. propinquum BAC library Whatman 3 MM papers saturated with the following solutions and processed for the indicated times: (1) We constructed a S. propinquum BAC library suit- 10% SDS, 5 min; (2) 0.5 M NaOH, 1.5 M NaCl, 5 min; able for positional cloning and physical mapping. The (3) 0.5 M Tris-HCl pH 7.5, 1.5 M NaCl, 1 mM EDTA library was established from 12 different ligations pH 7.5, 5 min, twice; (4) 2× SSC,0.1%SDS,5min; and consists of 38 016 clones stored in 99 384-well (5) 2× SSC, 5 min; (6) 0.4 M NaOH, 20 min. To microtiter plates. The average frequencies of white remove the cell debris, the filters were then washed colonies without inserts (false-positive) varied from twice with a large volume of 5× SSC, 0.1% SDS with 0% to 29% in different ligations, with an average of vigorous shaking for 20 min, and twice more with a 7% (Table 2). We found the optimal condition for di- large volume of 2× SSC. gesting BAC vector DNA to be 6 units of HindIII per µg DNA incubated at 37 ◦C for 45 min. More units per ◦ DNA probes µg DNA and longer incubation time at 37 C resulted Ten homologous and ten heterologous probes were in a higher frequency of white colonies without inserts. randomly chosen from ten linkage groups [16] to The insert size of the BAC library was estimated test the completeness of the library. The homologous from randomly selected clones and ranged from 10 probes were S. bicolor genomic DNA clones. The to 275 kb, with an average of 126 kb (Figure 1; Ta- heterologous probes were maize genomic DNA and ble 2). A total of 352 BACs containing inserts were cDNA (provided by E. Coe and J. Gardiner, Univer- analyzed by NotI digestion and PFGE (pulsed-field sity of Missouri), and rice genomic DNA and cDNA gel electrophoresis). The number of NotI sites ranged (provided by S. R. McCouch, M. E. Sorrells, and from 0 to 8 with an average of 1.8 sites (Table 2). S. D. Tanksley, Cornell; and T. Sasaki, Rice Genome The average insert size of the 12 different ligations Research Program, Japan). ranged from 109 kb to 152 kb. As shown in Table 2, One 18S rDNA, one chloroplast gene, and 185 one cycle of size-selected DNA was used in the first homologous and heterologous mapped DNA probes nine ligations (ligation batch 1 to 9) while two cy- were used to assess chimerism of BAC clones based cles of size-selected DNA was used in the remaining on the frequency of co-occurrence of nuclear and 3 ligations. Woo et al. [52] noted that ligations us- chloroplast genes [44]. The cotton 18S rDNA, rep- ing two cycles of size-selected DNA suffer from lower resented by clone pXP 108 containing 265 bp of transformation efficiency but generate larger and more the conserved region from Gossypium barbadense uniform insert size. Our results agreed with their ob- [59], was used. Cloned inserts, putatively free of servation (Figure 1; Table 2). The insert size of the first vector DNA, were used to screen the BAC library. nine batches of ligation ranged from 10 kb to 275 kb The chloroplast-specific gene, rpoB [48], was am- with an average of 119 kb. Insert size of the last three plified by PCR using the following reaction con- batches of ligation ranged from 65 kb to 220 kb with ditions with a final volume of 25 µl: (1) 10 µM an average of 144 kb (Figure 1; Table 2). rpoB primers: CTAAGGGGTTGTTGTGTAAC and The majority of the insert sizes (70%) fall into the AATATGCAACGTCAAGCAGT; (2) 10 ng S. propin- range of 100 to 200 kb (Figure 1). Even though the size quum DNA isolated as described [16]; (3) 10 mM Tris- selection had been applied to filter out DNA smaller HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 100 µg/ml than 150 kb, occasional small BACs still appeared gelatin, 0.2 mM of each deoxynucleotide triphosphate, in the library. The percentage of trapped DNA was 0.5 units AmpliTaq, and 0.1% Triton X-100. The reac- affected by the nuclei concentration in the plugs for 515

Table 2. Composition of the S. propinquum BAC library estimated from randomly selected clones from each ligation.

Ligationa Total number Averageb Average Average Genome batch of clones frequency of insert size number of coverage clones with NotI sites no insert

1 934 0.00 138 1.43 0.18 2 3866 0.04 122 1.56 0.64 3 768 0.03 116 1.32 0.12 4 672 0.03 126 1.93 0.12 5 288 0.00 118 1.92 0.05 6 2208 0.24 126 1.35 0.30 7 4032 0.00 109 2.04 0.63 8 3168 0.29 115 1.58 0.37 9 5280 0.07 117 2.04 0.82 10 576 0.08 138 1.92 0.10 11 7392 0.00 152 3.00 1.61 12 8832 0.04 136 1.56 1.65 Sum 38016 0.07 126 1.80 6.60

aLigation batches 1–9 were constructed with one cycle of selection, and ligations 10–12 were constructed with two cycles of size selection. bWhite colonies without inserts were excluded from each calculation.

Estimation of genome coverage

The genome coverage of the BAC library was estimated based on the average insert size, the percentage of BAC clones with inserts but without chloroplast DNA, and the genome size. The fraction of chloroplast DNA in the BAC library was estimated by screening the whole BAC library using the rpoB gene (1.3 kb), a chloroplast gene amplified from total sorghum DNA by PCR [48]. Only 225 BAC clones, ca. 0.6% of the library, contained the rpoB gene. Since the chloroplast genome which is conserved among taxa is only 139 kb in maize [49], only a small number of chloroplast BACs (average size 126 kb) should escape detection Figure 1. Insert size distribution of 352 BAC clones randomly by the rpoB gene. Based on this result, plus the fact selected from one or two cycles of size selection. that the genome size is 760 Mb [4] and the average insert size is 126 kb (Table 2), the genome coverage partial digestion [25], and by the pulse time of PFGE was estimated to be 6.6×. for separating DNA. A lower concentration of nuclei To verify the genome coverage, ten homologous or shorter pulse time decrease the amount of trapped probes and ten heterologous probes were hybridized DNA fragments. In this experiment, a shorter pulse to the whole BAC library. From two to eleven clones time was employed to attempt to reduce the amount with an average of 7.1 hybridized to homologous of small DNA fragments. The first size selection was probes, and two to nine clones with an average of 5 executed with pulse time of either 5 s or 8 s instead of clones hybridized to heterologous probes (Table 3), 90 s. for an overall average of 6.05. The discrepancy is pre- sumed to be because heterologous probes hybridize with lower affinity to S. propinquum BACs and might result in a higher frequency of false-negatives. 516

Table 3. List of DNA probes used for testing genome coverage of (anonymous hypomethylated clones) may hybridize the S. propinquum BAC library. weakly to chloroplast DNA. Probe Source of probe Number of BACs

SHO59 sorghum genomic DNA 6 Discussion SHO74 sorghum genomic DNA 9 pSB097 sorghum genomic DNA 5 To facilitate positional cloning and physical map- pSB183 sorghum genomic DNA 3 pSB1106 sorghum genomic DNA 11 ping in sorghum, we constructed a high-redundancy pSB1113 sorghum genomic DNA 10 S. propinquum library containing 38 016 clones with pSB1159 sorghum genomic DNA 10 an average insert size of 126 kb. This library covers pSB1250 sorghum genomic DNA 2 about 6.0–6.6 genome equivalents, conferring 99.7% pSB1317 sorghum genomic DNA 5 confidence that this library contains any randomly pSB1513 sorghum genomic DNA 10 chosen sorghum DNA sequence. Only two clones Average 7.1 were found to cross-hybridize to both nuclear and C198a rice cDNA 7 chloroplast DNA, suggesting a low rate of chimerism. C198b rice cDNA 4 More than 2100 RFLP markers including sorghum C225 rice cDNA 3 homologous probes and many heterologous probes CDO36 OAT cDNA 5 have been mapped using the S. bicolor × S. propin- CSU33 maize cDNA 8 quum cross [16, Paterson et al. unpublished data]. CSU490 maize cDNA 2 This high-density RFLP map with an average inter- G55 rice cDNA 3 val between markers of 0.7 cM or 350 kb makes a RZ474 rice cDNA 9 good starting point for positional cloning of sorghum UMC76 maize genomic DNA 2 QTLs, and/or for assembly of a high-resolution physi- UMC84 maize genomic DNA 7 cal map. We constructed a S. propinquum BAC library Average 5.0 with coverage of 6.05–6.6 genome equivalents. Woo Overall average 6.05 et al. [52] have established a S. bicolor BAC library which was estimated to contain 2.7 genome equivalents with an average insert size of 157 kb. Because these two libraries were constructed using different The genome coverage estimation of the library us- sorghum germplasm, they complement each other ing calculation (6.6×) and hybridization of known and together provide 9-fold coverage of the sorghum genetic markers (6.05×) is very similar. A BAC li- genome. These two BAC libraries provide a good brary of 6.05–6.06× coverage has a 99.7% probability opportunity for the positional cloning of more than of isolating a gene from a specific genomic region 100 economically important QTLs/genes that have [19]. been mapped using a cross between the two source genotypes [31, 38, Paterson et al., unpublished]. Fur- Hybridization to nuclear, chloroplast, and ribosomal thermore, we can generate a high-resolution sorghum clones physical map and/or contig map using these two BAC libraries because the physical distance between To date, a total of 185 genetically-mapped probes have markers is about 350 kb based on the genome size been hybridized to the library, detecting a total of 807 of 760 Mb and 0.7 cM per marker [4]. The high- BACs, 2.1% of the library (Draye et al., in prepara- resolution sorghum physical map can be adopted as tion). The 18S rDNA clone hybridized to 57 BACs, a landmark to clone any interesting genes mapped 0.15% of the library. The chloroplast-specific DNA, along the chromosomes. It should be noted that due rpoB gene, hybridized to 225 BAC clones, 0.6% of the to the high level of DNA polymorphism that differ- library. Among the total of 1,088 BACs hybridized to entiate S. bicolor and S. propinquum, fingerprinting these clones, two clones (64C20, 96A23) hybridized data [cf. 32] from the two libraries will not be able both to chloroplast DNA and mapped sorghum ge- to be integrated directly, but will require supporting nomic DNA clones (pSB1513, pSB1742, pSB1818). data from landmarks such as mapped low-copy DNA These BACs may be chimeric, or the genomic clones probes. 517

A partial summary of the genes and QTLs found gest that each may be useful in helping to overcome in the cross (S. bicolor BTx623 × S. propinquum) obstacles to chromosome walking and contig assem- was presented in Table 1. Out of the six QTLs affect- bly in the other. Therefore, the S. propinquum BAC ing plant height, S. propinquum contains four domi- library is likely to be very important for cloning the nant, one over-dominant, and one additive allele [31]. grain shattering gene and photoperiodic gene. Among the three flowering QTLs, S. propinquum provides two dominant and one recessive allele [31]. Only Difficulties in BAC library construction one of the four QTLs influencing the tiller number and one of the eight QTLs affecting rhizomatousness are A common problem encountered in a BAC library is recessive in S. bicolor [40]. The S. propinquum allele the existence of false-positive clones (white colonies of the discrete shattering gene is completely dominant without inserts). The average frequency of false posi- [39]. Curiously, among the nine QTLs affecting seed tives in this library was 7% (varying from 0% to 29% size, only three of them are dominant and/or additive in different ligations), which was a little higher com- in S. propinquum [39]. The reason for this may be pared to that of the chicken BAC library (5%) and that seeds of larger size are often selected during do- the lettuce BAC library (5.3%) [25, 60]. Factors af- mestication. S. propinquum provides dominant and/or fecting the frequency of false positive clones include additive alleles for five out of the six traits studied, the the units of HindIII and digestion time applied to lin- exception being seed size. Therefore, a S. propinquum earize the BAC vector, the vector dephosphorylation BAC library is preferable for isolating genes encoding step [21], the DNA fragment sizes used for ligation these five traits, and presumably many others. [25], and electroporation conditions [54]. Our results Comparative mapping in plants of the Poaceae have suggested that longer storage time of the vectors ◦ family has established that the gene order and reper- dissolved in TE at −80 C would increase the level of toire are relatively conservative, especially within false positive clones, regardless of whether the vec- closely related species [1, 2, 28, 31, 34, 38]. The tor is in circular, linear, or dephosphorylated form similarity in genome composition, collinearity and (data not shown). This should be viewed as an exten- compatibility in grasses suggests the taxa of Poaceae sion to the results of Danesh et al., [21]. To reduce can be treated as a single genetic system [7]. Micro- the frequency of false-positive clones, we could store undigested vector DNA in dry pellet form at −20 ◦C, collinearity using ‘local genomic cross-referencing’ ◦ suggests that small genomes such as rice and sorghum, or we could keep the dephosphorylated vector at 4 C could be used as the basis for map based cloning to prevent the damage caused by repeated freezing and of larger and more complex genomes such as maize, thawing. wheat, and others [5, 14, 15]. Rice has been con- To increase the average insert size, two cycles of sidered a model crop in the grass family due to its size selection have been suggested since the second small genome size (430 Mb), about 0.6× those of size selection may eliminate small DNA fragments Sorghum bicolor (760 Mb; [4]) and S. propinquum trapped in larger DNA fragments during the first size (810 Mb; A.H. Paterson, and K. Arumuganathan, selection [52]. It has been reported that two cycles of unpublished data). Nevertheless, sorghum provides size selection tremendously decreased the transforma- advantages over rice for positional cloning of genes tion efficiency because small DNA fragments became such as grain shattering and photoperiodic flower- rare and the DNA quality became worse during the ing, two important genes involved with crop domes- second size selection [52]. However, we obtained a tication. The sorghum shattering gene (Shl) explains higher transformation efficiency for the twice-size- 100% of phenotypic variation in the cross S. bicolor × selected DNA than the one-size-selected DNA by S. propinquum, and corresponds to one of at least six using shorter pulse time for the CHEF (contour ho- shattering genes in rice and two putatively homoeol- mogeneous electrophoresis field) gel, such as 5 or ogous QTLs among at least ten known in maize [22, 8 s instead of 90 s, to improve the recovery of good 23, 30, 36, 38, W.C. Kennard, unpublished]. The quality DNA and achieve the target range of size photoperiodic gene of sorghum is homoeologous to (Table 2). photoperiodic genes of wheat and barley and paral- The transformation efficiency could be affected by ogous to a genomic region that contains two of five ligation conditions. Published molar ratios of insert known rice photoperiodic genes [30, 37, 38]. Further, to vector range from 1:5 (Arabidopsis thaliana: [17]; diversity of repetitive DNA in rice and sorghum sug- rice: [56]) to 1:15 (cotton: Choi and Wing, unpub- 518 lished data). Previous work, however, did not mention References how the molarity of insert DNA could be calculated in view of variation in DNA size. The best transformation 1. Ahn S, Anderson JA, Sorrells ME, Tanksley SD: Homoeol- efficiency we have achieved was 190 clones/µlusing ogous relationships of rice, wheat, and maize chromosomes. Mol Gen Genet 241: 483–490 (1993). ligations of 60 ng of insert and 15 ng of vector. The 2. Ahn S, Tanksley SD: Comparative linkage maps of rice and molar ratio of insert to vector was 1:5 based on the maize genomes. Proc Natl Acad Sci USA 90: 7980–7984 insert size of 150 kb and 1:10 based on the insert size (1993). 3. Arondel V, Lemieux B, Hwang I, Gibson S, Goodman HM, of 300 kb. Such calculations are not reliable since the Somerville CR: Map-based cloning of a gene controlling average insert sizes of most BAC libraries are smaller omega-3 fatty acid desaturation in Arabidopsis. Science 258: than 150 kb and DNA insert sizes in ligations vary in 1353–1355 (1992). different size selections. The optimal ligation condi- 4. Arumuganathan K, Earle ED: Nuclear DNA content of some important plant species. Plant Mol Bio Rep 9: 208–218 (1991). tions could only be found by trying different ratios of 5. Avramova Z, Tikhonov A, Sanmiguel P, Jin YK, Liu CN, insert to vector. Woo S-S, Wing RA, Bennetzen JL: Gene identification in a complex chromosomal continuum by local genomic cross- Gene isolation and identification referencing. Plant J 10: 1163–1168 (1996). 6. Battraw MJ, Hall TC: Stable transformation of Sorghum bicolor protoplasts with chimeric neomycin phosphotrans- Gene isolation and identification are the final steps of ferase II and β-glucuronidase genes. Theor Appl Genet 82: positional cloning [47, 51]. During the process, from 161–168 (1991). linked markers to genes, dominant alleles are prefer- 7. Bennetzen JL, Freeling M: Grasses as a single genetic system: able for identifying transcripts and evaluating com- genome composition, collinearity and compatibility. Trends Genet 9: 259–261 (1993). plementation. The recessive alleles that are common 8. Berhan AM, Hulbert SH, Butler LG, Bennetzen JL: Structure in S. bicolor could be symptomatic of several types and evolution of the genomes of Sorghum bicolor and Zea of mutations that would make gene isolation difficult mays. Theor Appl Genet: 598–604 (1993). using S. bicolor BAC clones. Deletion mutations, one 9. Binelli G, Ginafranceschi L, Pe ME, Taramino G, Busso C, Stenhouse J, Ottaviano E: Similarity of maize and sorghum mechanism causing loss-of function mutations, could genomes as revealed by maize RFLP probes. Theor Appl eliminate transcripts entirely and result in the failure Genet 84: 10–16 (1992). of gene isolation. In addition, dominant alleles are 10. Burke DT, Carle GF, Olson MV: Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome easier for mutant complementation by transformation vectors. Science 236: 806–812 (1987). since antisense mRNA may not block out all gene ex- 11. Cai L, Taylor JF, Wing RA, Gallagher DS, Woo S-S, Davis pression in transformants. Transformation techniques SK: Construction and characterization of a bovine bacterial are already optimized for selected cultivars of most artificial chromosome library. Genomics 29: 413–425 (1995). 12. Casas AM, Kononowicz AK, Zehr UB, Tomes DT, Axtell JD, crops, including sorghum [6, 12]. The S. propinquum Butler LG, Bressan RA, Hasegawa PM: Transgenic sorghum BAC library can be used for positional cloning of plants via microprojectile bombardment. Proc Natl Acad Sci genes associated with domestication. The genes might USA 90: 11212–11216 (1993). be identified by transforming candidate BAC clones 13. Chang C, Kwok SF, Bleecker AB, Meyerowitz EM: Arabidop- sis ethylene-response gene ETR1: Similarity of product to via the BIBAC vector, or by transforming candidate two-component regulators. Science 262: 539–544 (1993). cDNAs identified using candidate BAC clones, into 14. Chen M, Sanmiguel P, Bennetzen JL: Sequence organization cultivars for gene expression. and conservation in sh2/a1-homologous regions of sorghum and rice. Genetics 148: 435–443 (1998). 15. Chen M, Sanmiguel P, De Oliveira AC, Woo S S, Zhang H, Wing RA, Bennetzen JL: Microcollinearity in sh2- Acknowledgements homologous regions of the maize, rice, and sorghum genomes. Proc Natl Acad Sci USA 94: 3431–3435 (1997). This work was supported by funds from the USDA- 16. Chittenden LM, Schertz KF, Lin Y-R, Wing RA, Paterson AH: A detailed RFLP map of Sorghum bicolor × S. propinquum, NRICGP Plant Genome Research Program. We would suitable for high-density mapping, suggests ancestral dupli- like to thank Jennifer Lennington, Colette Abbey, Ter- cation of Sorghum chromosomes or chromosomal segments. rye DelMonte, Alison Hoppe, Xavier Draye, Xiaoyin Theor Appl Genet 87: 925–933 (1994). 17. Choi S, Creelman RA, Mullet JE, and Wing RA: Construction Qian, and Mark Burow for technical assistance. and characterization of a bacterial artificial chromosome library of Arabidopsis thaliana. Weeds World 2: 17–20 (1995). 18. Chumakov IM, Rigault P, Le Gall I, Bellanne Chantelot C, Bil- lault A, Guillou S, Soularue P, Guasconi G, Poullier E, Gros I, Belova M, Sambucy JL, Susini L, Gervy P, Gilbert F, Beau- fils S, Bui H, Massart C, De Tand MF, Dukasz F, Lecoulant S, 519

Ougen P, Perrot V, Saumier M, Soravito C, Bahouayila R, Co- 35. Mullins LJ, Kotelevtseva N, Boyd AC, Mullins JJ: Efficient hen Akenine A, Barillot E, Bertrand S, Codani JJ, Caterina D, Cre-lox linearisation of BACs: Applications to physical map- Georges I, Lacroix B, Lucotte G, Sahbatou M, Schmit C, San- ping and generation of transgenic animals. Nucl Acids Res 25: gouard M, Tubacher E, Dib C, Faure S, Fizames C, Gyapay G, 2539–2540 (1997). Millasseau P, Nguyen S, Muselet D, Vignal A, Morissette J, 36. Ogi Y, Kato H, Maruyama K, Saito A, Kikuchi F: Identifica- Menninger J, Lieman J, Desai T, Banks A, Bray Ward P, tion of RFLP markers closely linked to the semidwarfing gene Ward D, Hudson T, Gerety S, Foote S, Stein L, Page DC, Lan- at the sd-1 locus in rice. Japan Breed 43: 141–146 (1993). der ES, Weissenbach J, Le Paslier D, Cohen D: A YAC contig 37. Okumoto Y, Ichitani K, Inoue H, Tanisaka T: Photoperiod map of the human genome. Nature 377: 175–297 (1995). insensitivity gene essential to the varieties grown in the north- 19. Clarke L and Carbon J: A colony bank containing synthetic ern limit region of paddy rice (Oryza sativa L.) cultivation. ColE1 hybrid plasmids representative of the entire E. coli Euphytica 92: 63–66 (1996). genome. Cell 9: 91–100 (1976). 38. Paterson AH, Lin Y-R, Li Z, Schertz KF, Doebley JF, Pinson 20. Cohen D, Chumakov I, Weissenbach J: A first-generation SRM, Liu S-C, Stansel JW, Irvine JE: Convergent domestica- physical map of the human genome. Nature 366: 698–701 tion of cereal crops by independent mutations at corresponding (1993). genetic loci. Science 269: 1714–1718 (1995). 21. Danesh D, Penuela S, Mudge J, Denny RL, Nordstrom H, 39. Paterson AH; Schertz KF; Lin Y- R, Li Z: Case history in Martinez JP, Young ND: A bacterial artificial chromosome plant domestication; Sorghum, an example of cereal evolution. library for soybean and identification of clones near a major In: Paterson AH (ed) Molecular Dissection of Complex Traits, cyst nematode resistance gene. Theor Appl Genet 96: 196–202 pp. 187–196. CRC Press, Boca Raton, FL (1997). (1998). 40. Paterson AH, Schertz KF, Lin Y-R, Liu S-C, Chang Y-L: The 22. Doebley J, Stec A: Genetic analysis of the morphological dif- weediness of wild plants: molecular analysis of genes influ- ferences between maize and teosinte. Genetics 129: 285–295 encing dispersal and persistence of johnsongrass, Sorghum (1991). halepense (L.) Pers. ). Proc Natl Acad Sci USA 92: 6127–6131 23. Doebley J, Stec A: Inheritance of the morphological differ- (1995). ences between maize and teosinte: comparison of results for 41. Pereira MG, Lee M, Bramel-Cox P, Woodman W, Doebley two F2 populations. Genetics 134: 559–570 (1993). J, Whitkus R: Construction of an RFLP map in sorghum and 24. Doggett H: Sorghum, 2nd ed John Wiley, New York (1988). comparative mapping in maize. Genome 37: 236–243 (1994). 25. Frijters AC, Zhang Z, Damme MV, Wang GL, Ronald PC, 42. Ragab RA, Dronavalli S, Maroof MAS, Yu YG: Construction Michelmore RW: Construction of a bacterial artificial chro- of a sorghum RFLP linkage map using sorghum and maize mosome library containing large EcoRI and HindIII genomic DNA probes. Genome 37: 590–594 (1994). fragments of lettuce. Theor Appl Genet 94: 390–399 (1997). 43. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A 26. Haldi M, Perrot V, Saumier M, Desai T, Cohen D, Cherif Laboratory Manual, 2nd ed. Cold Spring Harbor, Laboratory, D, Ward D, Lander ES: Large human YACs constructed in a Cold Spring Harbor, NY (1989). rad52 strain show a reduced rate of chimerism. Genomics 24: 44. Schmidt R, Putterill J, West J, Cnops G, Robson F, Coup- 478–484 (1994). land G, Dean C: Analysis of clones carrying repeated DNA 27. Hamilton CM, Frary A, Lewis C, and Tanksley SD: Stable sequences in two YAC libraries of Arabidopsis thaliana DNA. transfer of intact high molecular weight DNA into plant chro- Plant J: 735–744 (1994). mosomes. Proc Natl Acad Sci USA 93: 9975–9979 (1996). 45. Shizuya H, Birren B, Kim U-J, Mancino V, Slepak T, Tachi- 28. Hulbert SH, Richter TE, Axtell JD, Bennetzen JL: Genetic iri Y, and Simon M : Cloning and stable maintenance of 300- mapping and characterization of sorghum and related crops kilobase-pair fragments of human DNA in Escherichia coli by means of maize DNA probes. Proc Natl Acad Sci USA 87: using an F-factor-based vector. Proc Natl Acad Sci USA 89: 4251–4255 (1990). 8794–8797 (1992). 29. Jiang J, Gill BS, Wang GL, Ronald PC, Ward DC: Metaphase 46. Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, and interphase fluorescence in situ hybridization mapping of Gardner J, Wang B, Zhai WX, Zhu LH, Fauquet C, Ronald the rice genome with bacterial artificial chromosomes. Proc P: A receptor kinase-like protein encoded by the rice disease Natl Acad Sci USA 92: 4487–4491 (1995). resistance gene, Xa21. Science 270: 1804–1806 (1995). 30. Kinoshita T, Takahashi M: The one hundredth report of ge- 47. Tanksley SD, Ganal MW, Martin GB: Chromosome landing: netical studies on the rice plant: linkage studies and future A paradigm for map-based gene cloning in plants with large prospects. J Fac Agric Hokkaido Univ 65 (Pt. 1): 1–61 (1991). genomes. Trends Genet 11: 63–68 (1995). 31. Lin Y-R, Schertz KF, Paterson AH: Comparative analysis of 48. Tsumura Y, Kawahara T, Wickneswari R, Yoshimura K: Mole- QTLs affecting plant height and maturity across the Poaceae, cular phylogeny of Dipterocarpaceae in Southeast Asia using in reference to an interspecific sorghum population. Genetics RFLP of PCR-amplified chloroplast genes. Theor Appl Genet 141: 391–411 (1995). 93: 22–29 (1996). 32. Marra MA, Kucaba TA, Dietrich NL, Green ED, Brown- 49. Wetzel CM, Rodermel SR: Gentic map of the Zea mays plastid stein B, Wilson RK, McDonald KM, Hillier LW, McPher- chromosome. Maize Genet Coop Newsl 68: 209 (1994). son JD, Waterston RH: High throughput fingerprint analysis 50. Whitkus R, Doebley J, and Lee M: Comparative genome map- of large-insert clones. Genome Res 7: 1072–1084 (1997). ping of sorghum and maize. Genetics 132: 119–130 (1992). 33. Martin GB, Brommonschenkel SH, Chunwongse J, Frary A, 51. Wicking C, Williamson B: From linked marker to gene. Trends Ganal MW, Spivey R, Wu T, Earle ED, Tanksley SD: Map- Genet 7: 288–293 (1991). based cloning of a protein kinase gene conferring disease 52. Woo S-S, Jiang J, Gill BS, Paterson AH, and Wing RA: resistance in tomato. Science 262: 1432–1436 (1993). Construction and characterization of a bacterial artificial chro- 34. Moore G, Gale MD, Kurata N, Flavell R: Molecular analysis mosome library of Sorghum bicolor. Nucl Acids Res 22: of small grain cereal genomes: Current status and prospects. 4922–4931 (1994). Bio/technology 11: 584–589 (1993). 520

53. Xu G-W; Magill CW; Schertz KF; Hart GE: A RFLP linkage some libraries from the parents of a permanent recombinant map of Sorghum bicolor (L.) Moench. Theor Appl Genet 89: inbred mapping population. Mol Breed 2: 11–24 (1996). 139–145 (1994). 57. Zhang H-B, Zhao X, Ding X, Paterson AH, and Wing RA: 54. Yang D, Parco A, Nandi S, Subudhi P, Zhu Y, Wang G, Huang Preparation of megabase-size DNA from plant nuclei. Plant J N: Construction of a bacterial artificial chromosome (BAC) 7: 175–184 (1995). library and identification of overlapping BAC clones with 58. Zhao X-P, Zhang H-B, Wing RA, and Paterson AH: A simple chromosome 4-specific RFLP markers in rice. Theor Appl method for isolation of megabase DNA from cotton. Plant Mol Genet 95: 1147–1154 (1997). Biol Rep 12: 126–131 (1994). 55. Zamir D, Eshed Y: Case history in germplasm introgression: 59. Zhao X-P, Si Y, Hanson RE, Crane CF, Price HJ, Stelly DM, Tomato genetics and breeding using nearly isogenic introgres- Wendel JF, Paterson AH: Dispersed repetitive DNA has spread sion lines derived from wild species. In: Paterson AH (eds) to new genomes since polyploid formation in cotton. Genome Molecular Dissection of Complex Traits, pp. 207–218. Press, Res 8: 479–492 (1998). Boca Raton, FL (1997). 60. Zimmer R, Gibbins AMV: Construction and characterization 56. Zhang H-B, Choi S, Woo S-S, Li Z, Wing RA: Construction of a large-fragment chicken bacterial artificial chromosome and characterization of two rice bacterial artificial chromo- library. Genomics 42: 217–226 (1997).