INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.
The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps. Each original is also photographed in one exposure and is included in reduced form at the back of the book.
Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6” x 9” black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order. UMI A Bell & Howell Infonnation CompaiQr 300 Noith Zed) Road, Ann Aibor MI 48106-1346 USA 313/761-4700 800/521-0600
INVESTIGATION OF TUBULINS IN ASPERGILLUS NIDUIANS AND CYANIDIUM CALDARIUM
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Yassmine M. Nazih Akkari, B. S.
*****
The Ohio State University
1997
Dissertation Committee:
Dr. Berl R. Oakley, Adviser Dr. Thomas J. Byers pproved^y Dr. George A. Marzluf Dr. Amanda A. Simcox Dr. Dale D. Vandre Adviser Department of Molecular Genetics UMI Number: 9721068
UMI Microform 9721068 Copyright 1997, by UMI Company. All rights reserved.
This microform edition Is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, MI 48103 ABSTRACT
Microtubules are essential for a variety of functions in eukaryotic cells. They are formed from molecules of tubulin, a heterodimer consisting of two globular proteins called a and P tubulin. A third member of the tubulin
superfamily, y tubulin, is located at the microtubule organizing centers and is
required for microtubule assembly in vivo.
Surprisingly, little is known about the details of microtubule structure and
assembly. The determination of the three-dimensional structure of tubulin, can greatly contribute to a better understanding of microtubule assembly at the molecular level. However, progress in the elucidation of the tubulin tertiary
structure has been hindered by the heterogeneity of tubulin and its intrinsic lability. To address these issues, I have puriried assembly-competent and homogeneous tubulin from Aspergillus nidulans and investigated the tubulin genes from the thermophilic alga Cyanidiwn caldarium as a potential source of thermostable tubulins. A. nidulans has two ^-tubulin genes {benA and tubC) and two a-tubulin genes (tubA and tubB). In order to isolate homogeneous tubulin, I have constructed a strain with only one functional a-tubulin gene, tub A, and in which six histidines have been inserted at the C-terminus of the benA gene. This allowed purifrcadon of tubulin using a nickel column. I have used electron microscopy and two-dimensional gel electrophoresis to show that
this purified tubulin is assembly-competent and isotypically pure. In addition, since thermophilic organisms are a potential source of heat stable proteins, and tubulins from A. nidulans may still prove to be labile, I have
investigated the tubulin genes from the thermophilic red alga, Cyanidium caldarium . I have sequenced internal fragments of genes encoding one a
tubulin, four p tubulins and one y tubulin from C. caldarium, generated by PCR.
Subsequently, I have constructed a C. caldarium genomic library, cloned the full-length copies of the four p-tubulin genes and the y-tubulin gene, and
sequenced the y-tubulin gene and P 1-tubulin gene. I have also investigated the total number of tubulin genes from this organism and the genomic arrangement of its p-tubulin genes.
m Dedicated to my father Nazih Akkari
and my mother Nada Zock
IV ACKNOWLEDGMENTS
I wish to thank my advisw. Dr. Berl R. Oakley, for his intellectual support and encouragement, his great scientific insight, and for giving me the opportunity to work on different projects and learn different techniques. He has taught me the value of a careful and rigorous scientific training and for this, I will always be grateful. I also wish to thank my committee members, Drs. Thomas J. Byers, George A. Marzluf, Amanda A. Simcox, and Dale D. Vandre for their time and helpful suggestions. I would especially like to thank Dr. Tom Byers for his encouragement, and Mandy Simcox for her friendship and continued interest in my career. I would like to thank Dr. Bill Birky for helpful discussions and Dr. Paul Fuerst, Sulayman Dib-Hajj and 2^eina Daoud for helping me to fulfill my dream of pursuing a graduate career in the United States.
In the Oakley lab, I would like to thank Kathy Jung for the generosi^ of her heart, and for being a great friend and mentor, and Liz Oakley and Dawnne
Wise for their support and friendship. I would also like to thank previous members of our lab: Mary Ann Martin, Yisang Yoon, Tetsuya Horio and Tomohiro Akashi for their friendship and helpful discussions. In addition, I would like to thank Gary Grumbling for his friendship, his expert computer assistance, and his help with the C. caldarium tubulin sequence analysis. I also wish to thank Don Ordaz for his help in growing A. nidulans cultures, and Jose Diaz and Kathy Wolken for their assistance in the use of the electron microscope.
Most importantly, I would like to express my deepest love and gratitude to all the members of my family in Lebanon. To my parents, I owe my most sincere thanks and appreciation for their love, emotional and intellectual support, and for teaching me the good value of education and integrity in a time and place where these words seemed to have lost their meaning. They have always provided me with positive energy to reach my goals. I would also like to thank my sisters, Nesrine and Nada, and the rest of my family, especially my uncles Nabil Akkari and Aref Zock, for their love and faith in me.
To my dearest Mend, Jeff Seiple, I express my sincere thanks for his love, for accepting my weaknesses and reinforcing my strengths, and for everything that he is. I am truly blessed to have found a person like him, and I will always be grateful for the happiness he brings to my life. I would also like to thank Jeffs family for their warmth and generosity and for considering me a part of their family.
To all my wonderful friends, both in Lebanon and in the United States, I express my thanks for their unconditional love and support. I would especially like to thank my best friends Zeina Daoud, Hanady Salman and Ghina Dabboussy for the goodness of their hearts, their love and wonderful companionship.
vi WA
January 22,1969 Bora - Tripoli, Lebanon
1989...... B. S. Biology, American Univerrity of Beirut, Beirut, Lebanon
1990-presenL ...... Graduate Teaching and Research Associate, Department of Molecular Genetics, The Ohio State University, Columbus, Ohio
PUBUCATIONS
1. Y. Akkari, R. G. Bums, C. E. Oakley, and B. R. Oakley. 1994. Cloning and sequencing of y- and P-tubulin genes from the thermophilic alga Cyanidium calc^rium. Molec. Biol. Cell 55:282a.
2. Y. Akkari, Y. Yoon, and B. R. Oakley. 1995. Expression and purifrcation of isotypically pure tubulin from Aspergillus nidulans. Molec. Biol. Cell 55:32a.
FIELDS OF STUDY
Major Field: Molecular Genetics
YU TABLE OF CONTENTS
EagÊ
Abstract ...... ii Dedication ...... iv Acknowledgments ...... v
Vita...... vii
List of Tables ...... xi
List of Figures ...... xii
Chapters:
1. INTRODUCTION...... 1
Overview ...... 1 General structure of microtubules ...... 2 Advances in the elucidation of microtubule structure 5 In vitro microtubule assembly and dynamics ...... 6 Microtubule organizing centers and microtubule polarity ...... 13 Microtubule associated proteins ...... 17 Tubulin biochemistry: domain structure and drug interactions ...... 18 Tubulin molecular biology and genetics ...... 22 Y tubulin ...... 25 Rationale for dissertation research ...... 26
2. EXPRESSION AND PURMCATION OF ISOTYPICALLY PURE TUBULIN FROM ASPERGILLUS NIDULANS ...... 29
vm Introduction ...... 29 Materials and Methods ...... 39 Strains and media ...... 39 Plasmid construction ...... 42 A. nidulans transformations ...... 42 Crossing YAYY2 to KK2.70.7 ...... 44 Minipreparation of A. nidulans genomic DNA 44 Southern Hybridizations ...... 46 Preparation of the chromatogr^hy columns ...... 47 Purification of A. nidulans 6-His tubulin ...... 48 Tenq>eTature-dependent in vitro assembly and disassembly of 6^His tubulin ...... 50 Electron microscopy ...... 51 SDS-polyacrylamide gel electrophoresis and Western blots ...... 52 Two-dimensional gel electrophoresis of tubulin samples ...... 53 Results...... 54 Construction of an A. nidulans strain expressing a 6-His tagged p tubulin ...... 54 Construction of an A. nidulans strain expressing a 6-His tagged p tubulin and one functional a-tubulm isotype ...... 66 Genetic studies of the 6-His tubulin A. nidulans strains ...... 68 Purification of 6-His tubulin from strain A Y l ...... 71 6-His tubulin assembles into normal microtubules ...... 74 Isotypical purity of the purified 6-His tubulin ...... 86 Discussion ...... 90
3. INVESTIGATION OF THE TUBULIN GENES OF THE THERMOPHILIC ALGA CFAV/D/UAfCALDAR/î/Af 94
Introduction ...... 94 Materials and Methods ...... 99 Isolation of C. caldarium genomic D N A ...... 99 Cloning of the C. caldarium internal tubulin fiagments ...... 99 Construction of a C. caldarium genomic library ...... 100 Preparation of probes for hybridizations ...... 102 Library screening ...... 103 Sequence analysis ...... 104
IX Southern Hybridizations ...... 105 Screening for C caldarium p-tubulin clustering ...... 105 Results...... 107 Identification of one a-tubulin, four P-tubulin, and one y-tubulin genes from C. caldarium by PCR ...... 107 Construction of the C. caldarium genomic library ...... 109 Screening, cloning and sequencing the C. caldarium P- and y-tubulin genes ...... 109 Determination of the total number of tubulin genes in C. caldarium...... 115 Genomic arrangement of the p-tubulin genes of C caldarium...... 130 Discussion ...... 132
Bibliography ...... 143 UST OF TABLES
laids Bags
1. Primer combinations used to an^>lify the C. caldarium tubulin genes ...... 106 2. Primers used in probe preparation for low stringency Southern hybridizations ...... 108
XI USTOFHGURES
Bgurn EâgÊ
1. Microtubule subunit arrangement ______4
2. Temperature-dependent in vitro polymerization and depolymeiization of microtubules ...... 8 3. Aspergillus nidulans life cycle...... 34
4. The construction of plasmid pYA4 ...... 57
5. Integration of plasmid pYA4 in the A nidulans strain G191 ...... 60
6. Southern hybridization analysis of the pYA4 in G191 transformants in comparison with G191 ...... 62 7. Western analysis of the gradient purification of wild-type and 6-His tubulin from FGSC4, YAYYl and YAYY2 ...... 65 8. Southern analysis of genomic DNA from the segregants of the cross between strains YAYY2 and KK2.70.7 ...... 70 9. Growth of strains AY1-AY5 compared to the parental strains YAYY2 and KK2.70.2 and wild-type strains at different temperatures ...... 73
10. Coomassie blue stained gel of the partial purification of A. nidulans 6-His tubulin on a DEAE-cellulose column ...... 76 11. Coomassie blue stained gel of the purification of A. nidulans 6-His tubulin on a nickel-chelated agarose column followed by a desalting step on a sephadex G-25 column ...... 78
XU 12. Coomassie blue stained gel of sangles firom the first cycle of assembly and disassembly in the presence of taxol following ^H is tubulin purification ...... 80
13. Electron micrograph of A, nidulans microtubules assembled in the presence of taxol ...... 83 14. Further purification of A. nidulans 6-His tubulin by cyclic assembly and disassembly in the presence of taxol ...... 85 15. Isoelectric focusing of wild-Qpe and 6-His tubulin...... 89 16. Schematic diagram for the construction of the Cyanidium caldarium genomic library ...... I ll
17. Restriction maps of the C. caldarium P- and y-tubulin XGEM-11 clones ...... 114
18. The nucleotide sequence of the C. caldarium pi-tubulin gene and its predicted amino acid sequence ...... 117 19. The nucleotide sequence of the C. caldarium y-tubulin gene and its predicted amino acid sequence ...... 120 20. Low stringency Southern analysis of the C. caldarium P-tubulin genes ...... 125
21. Low stringency Southern analysis of the C. caldarium a-tubulin genes ...... 127
22. Low stringency Southern analysis of the C. caldarium y-tubulin genes ...... 129 23. Dendrogram of the P-tubulin sequences ...... 136
24. Dendrogram of the y-tubulin sequences ...... 138
xm CHAPTER 1
INTRODUCTION
Overview Our understanding of the diverse functions of the microtubule protein,
tubulin, has been greatly advanced by the use of various biochemical, genetic and molecular biology techniques. The knowledge of the tertiary structure of tubulin, however, has lagged behind as this protein’s high molecular weight and
tendency to self-aggregate has prohibited the use of NMR (nuclear magnetic
resonance) while x-ray crystallography is currently precluded by the inability to
grow suitable tubulin crystals.
In my dissertation research, I have attempted to address this issue through the development of protocols for tubulin preparations that would be
better suited for structural studies. A detailed rationale for these studies as well
as the necessary material needed for the understanding of the methodology and
the results will be presented in Chapters 2 and 3.
In this chapter, I will first give a review of the general structure of microtubules as well as a description of their dynamic nature and their interactions with various cellular components. I will then present a summary of
what is known about the biochemistry and molecular biology of tubulin which
1 is the main focus of my research. Finally, I will include a section that will describe the rationale for my dissertation research, and set the stage for the experiments described in Chapters 2 and 3.
General structure of microtubules Microtubules are a major component of the cytoskeleton and are involved in a variety of functions including chromosome movement in mitosis and meiosis, ciliary and flagellar motility, cell movement and some forms of cytoplasmic streaming, intracellular and axoplasmic transport, anchorage of cell surface receptors, and generation and maintenance of cellular morphology
(Brinkley, 1985). They are hollow, cylindrical organelles built from heterodimers of a tubulin and P tubulin. The a-P heterodimers are arranged in a polar fashion along longitudinal rows called protofilaments with a 4 nm repeat corresponding to the monomers, and an 8 nm repeat corresponding to the dimers (Erickson,
1974; Amos & Klug, 1974). Measurements of the axial shift per protofilament in
13 and 14 protofrlament microtubules and observation of jet frozen and fractured microtubules demonstrated that adjacent protofrlaments are staggered by 0.9 nm generating a 3-start left-handed helix (Mandelkow et nZ., 1986).
Determining the arrangement of the a- and P-tubulin subunits along the microtubule wall has been difficult because a and P tubulin are very similar subunits and they are difficult to distinguish. Amos & Klug (1974) obtained evidence that the A- and B-tubules of flagella have different lattices and that the A-tubules of flagella have an “A”-lattice (Figure la) whereas the B-tubules Figure 1: Microtubule subunit arrangement
In an ‘*A’*-lattice, the two tubulin subunits alternate along the three-start helix, and in neighboring protofilaments. The **B”-lattice, on the other hand, has the same arrangement of the two tubulin subunits when viewed from the three- start helix, but this lattice entails the presence of a seam or discontinuity in 13- protofilament microtubules. Seam
a. "A"-Lattice b. "B"-Lattice
(Courtesy of Dr. Tetsuya Horio)
Figure 1: Microtubule subunit arrangement of flagella have a “B**-lattice (Figure lb). A **B”-lattice 13-protofilament microtubule necessarily has a seam (along which lateral a-P interactions occur) (figure lb). The **A”-lattice model was favored in the past because it allows helical symmetry on 13-protofilament microtubules. Recent high resolution electron microscopy observations and image analysis of kinesin-decorated microtubules, however, demonstrate that all microtubules examined have a "B"- lattice (Song & Mandelkow, 1993,1995; Hoenger et al., 1995; Kikkawa et al.,
1995; Hirose et al., 1995), even A-tubules of flagella (Song & Mandelkow, 1995).
Advances in the elucidation of microtubule structure
In addition to microtubules, tubulin can also assemble into two- dimensional sheets in the presence of zinc ions (Larsson et al., 1976). In zinc sheets, tubulin assembles into protofilaments similar to those in microtubules but in contrast to microtubules, the protofilaments are aligned in an antiparallel fashion. The two-dimentional nature of these sheets has allowed the use of high resolution electron microscopy techniques and has advanced our knowledge of microtubule structure. For example, Amos & Baker (1979) used electron microscopy of negatively stained zinc sheets to construct a 20 angstrom resolution map of a microtubule. This map suggested a general shape for the tubulin monomers and showed that a and P tubulins are different in detail.
More recently, major advances in electron microscopy techniques have allowed
Nogales et al. (1995) to increase the resolution to 6.5 angstroms. The images created were not simple micrographs of zinc sheets, but are three-dimensional
density distribution derived from a multitude of micrographs (Makowski, 1995).
From this study (Nogales et al., 1995), the a and P subunits appear topologically similar, in agreement with their sequence homology. The external surface of tubulin appears quite smooth, in contrast to the interior from which strands of ^
sheets appear to form projections. Several secondary features were also defined: an a-helix, proximal to the inter-dimer and inter-protofilament contacts
was attributed to a segment near the carboxy-terminus of both tubulin subunits.
The assignment of the a and P subunits was made on the basis of the projection studies of the binding of taxol which was known, from photoaffinity labelling
studies (Rao etal., 1994), to bind P tubulin.
In vitro microtubule assembly and dynamics
Much of what is known about microtubule biochemistry stems from the pioneering work of Weisenberg who, in the early 1970s, demonstrated that microtubules could be reversibly assembled from a pool of tubulin subunits, in the presence of GTP, magnesium ions, and a good calcium chelator such as
EOT A [ethylene glycol bis(P-aminoethyl ether)-N, N, N’, N’-tetraacetic acid]
(Weisenberg, 1972). Based on the conditions worked out by Weisenberg and the knowledge that brain tubulin assembles into microtubules in the warm (eg. 37°C) and microtubules disassemble into tubulin dimers in the cold, Shelanski et al. (1973) developed a procedure for purifying microtubule proteins from brain
(Figure 2). This procedure involves successive rounds of temperature- Figure 2: Temperature-dependent in vitro polymerization and depolymerization of microtubules.
Tubulin can be purified from mammalian brain through several cycles of assembly and disassembly. A brain homogenate is chilled at 4"C to disassemble the existing microtubules. This is followed by centrifugation whereby the tubulin subunits are recovered in the supernatant The subunits are then polymerized into microtubules by incubation at 37**C. The resulting microtubules are centrifuged and the microtubule-containing pellet is resuspended in a cold buffer. Following centrigation at 4°C, tubulin subunits are recovered in the supernatant This cycle of assembly and disassembly can be repeated several times to enrich the sample with native tubulin proteins. Brain homogenate chilled at 4**C for microtubule disassembly X Centrifugation of extracts
Supernatant with microtubule proteins Pellet with insoluble material
Polymerization of tubulin subunits into microtubules by incubating at 37*’C
^ ^ Centrifugation at 37“C Supernatant PeUet (Microtubules)
Discard^ i " Resuspend in cold buffer and incubate at 0-4"C to depolymerize the microtubules ^ Centrifugation at 4®C
Supernatant (tubulin subunits) Pellet -► Discard
Second polymerization of tubulin into microtubules at 3TC
Supernatant Pellet (Microtubules)
. ^ 1 Resuspend in cold buffer and incubate at 0-4‘*C to depolymerize the microtubules ^ Centrifugation at 4®C
/ \ Supernatant (tubulin subunits) Pellet Discard
Figure 2.
8 dependent assembly and disassembly of microtubules coupled with centrifugation.
In vitro, microtubule assembly only occurs above a certain tubulin concentration called the critical concentration (Q ) for assembly. Gaskin et al.
(1974) discovered this property by monitoring microtubule assembly using turbidometric analysis, and determined that, below a given concentration (CcX turbidity remained the same as that of unpolymerized material. Above the critical concentration, however, turbidiQr was shown to increase proportionally to the mass of polymerized material and had a linear correlation with tubulin concentration.
Microtubules have also been shown to be highly dynamic structures, with a fast-growing or “plus” end [distal to microtubule organizing centers (MTOCs)] and a slow-growing or “minus” end (proximal to MTOCs). Our understanding of microtubule dynamics has progressed through several schools of thought over the past twenty five years. At steady-state, the dynamics were first thought to be limited to a simple equilibrium exchange of subunits between the tubulin pool and both microtubule ends. Then, in the early 1980’s, the concept of “treadmilling” was introduced (Margolis & Wilson, 1981). Treadmilling postulated a net loss of subunits at one end, and a net gain at the other. This would keep the microtubule length constant, but eventually, all subunits in a microtubule would exchange with the soluble tubulin pool.
Finally, in 1984, observations of the behavior of microtubule populations in vitro led Mitchison & Kirschner (1984a and b) to propose the concept of “dynamic instability’* whereby the ends of microtubules are never in equilibrium; the microtubule is mostly in a state of constant growth, interrupted by periods of rapid shortening. The transition from elongation to rapid shortening is called “catastrophe”, whereas the reverse reaction is called
“rescue” (reviewed by Erickson & O’ Brien, 1992). This concept was tested by direct observations of individual microtubules in vitro using dark-Aeld microscopy (Horio & Hotani, 1986), and video-enhanced, differential interference contrast microscopy (Walker et al., 1988). These observations showed that individual microtubule ends alternate between growth and shrinkage and that the rates of assembly and disassembly differ between the plus and the minus ends.
Dynamic instability was also found to occur in vivo where cytoplasmic and mitotic microtubules are constantly growing and shrinking (Salmon et al.. 1984; Saxton et al., 1984; Cassimeris et al., 1988). Dynamic instability has implications for the function of microtubules in eukaryotic cells, especially in relation to the disassembly of cytoplasmic microtubules to form the mitotic spindle or the formation of pole to kinetochore attachments (Brinkley, 1990). It also provides a mechanism for total redistribution of the cytoskeleton, and for recycling the microtubules that have missed their targets, both in the mitotic apparatus and during interphase. The microtubules of the mitotic spindle are the most dynamic in the cell (Salmon et aL, 1984; Saxton et al., 1984). A fraction
(10-20%) of cytoplasmic microtubules are much less dynamic than the majority
10 and are generally called stable microtubules (Schulze & Kirschner, 1986,1987; Lieuvin et al., 1994).
Despite efforts to learn more about the factors that drive and regulate microtubule dynamic instabili^ (Belmont & Mitchison, 1996), the mechanisms for maintaining these states of growth and shrinking, and for switching between them, are not known at the molecular level. The energy source, however, that seems to drive these dynamics, is collectively agreed to be the hydrolysis of
GXP. Biochemical studies have revealed in the past that tubulin is a GTP binding protein (Weisenberg et aL, 1968). Both a and P tubulin bind GTP. The
GTP bound to a tubulin (at the ‘‘N^’-site) is not exchangeable (Spiegelman et aL, 1977), is not hydrolyzed during assembly, and its dissociation usually correlates with protein dénaturation suggesting a structural role. It was also suggested that the GTP site on a tubulin is hidden in the intradimer interface, hence the non-exchangeable nature of this site (Bums & Surridge, 1994). On the other hand, P tubulin can bind either GTP or GDP exchangeably (at the "E"- site) (Nath et al., 1986), and the E-site nucleotide of the tubulin dimers is in equilibrium with free nucleotide in solution (Brylawski & Caplow, 1983); but when dimers assemble to form microtubules, the **E” site becomes non exchangeable. In addition, at or shortly after assembly the GTP in the “E” site becomes hydrolyzed to GDP (reviewed by Erickson & O’Brien, 1992). Studies using the slowly hydrolyzable GTP analogue, GMPCPP (guanylyl-[alpha, beta]- methylene-diphosphonate) showed that GTP hydrolysis is essential for depolymerization and hence for dynamic instability (Hyman et al., 1992). This is
11 consistent with the notion that a stable GTP “cap” at the plus end of a microtubule would promote assembly, and prevent disassembly, and that the body of the microtubule would consist mainly of GDP-tubulin (Carlier & Pantaloni, 1981; Mitchison & Kirschner, 1984a and b; Erickson & O’Brien,
1992). This model postulates that catastrophy is caused by the loss of the GTP cap, whereas rescue occurs when a GTP-tubulin subunit binds and recaps the end of a shortening microtubule. One mechanism that could explain why a GTP cap is more stable than the GDP core is a conformational difference in the tubulin subunit when bound to these two forms of the nucleotide. In fact, it has been shown that, in the presence of GDP, a protofilament can assume a curved shape when freed from its lateral bonds (Mandelkow et al., 1991). This implies that the GDP core is inherently strained and is maintained as such by the lateral interprotofilament bonds. GTP tubulin, on the other hand, seems to assume a straight conformation, and hence could stabilize the lattice at the end of a microtubule (Melki et at., 1989). In addition. Vale et al. (1994) recently correlated GTP binding to the microtubule’s structural and mechanical properties and showed that microtubules are stiffer when they contain
GMPCPP.
Unfortunately, the GTP cap model for dynamic instability does not explain the whole range of data available for the dynamic behavior of microtubules. It is not known, for example, why the frequency of catastrophy seems to be similar at the plus and the minus ends, while the dynamics of these two ends are seemingly very different In addition, studies from cutting or
12 diluting microtubules revealed that the newly exposed minus end is rapidly rescued from the expected shortening by an unknown mechanism, and that this rescue is dependent on the magnesium ion concentration (O’Brien et a l , 1990;
Walker et n/., 1989). Although the data seem conflicting, it must ultimately be possible to develop a simple molecular mechanism that would fit all the experimental data, and the knowledge of the three-dimensional structure of tubulin will surely help elucidate the conformational changes that occur during dynamic instability.
Microtubule organizing centers and microtubule polarity Microtubules are not arranged randomly in cells, but are organized around one or several discrete foci. These foci, from which most microtubules are nucleated, are called microtubule organizing centers (MTOCs) (Pickett-
Heaps, 1969). The centrosomes of mammalian cells, the spindle pole bodies
(SPBs) of fungi, and the basal bodies of cilia and flagella are examples of MTOCs, although their structures are widely different The best studied MTOC of eukaryotic cells is the centrosome (McIntosh, 1983), which is composed of a pair of centrioles surrounded by electron-dense, amorphous pericentriolar material (PCM). In some cell types, the centrioles are barrel-shaped specialized microtubule structures arranged perpendicular to one another, and usually found at the center of centrosomes. Their function is unclear, since plant cells and fungi lack these structures completely (Brinkley, 1985). Moreover, close examination of the centrosome by electron microscopy showed that
13 microtubules originate from the PCM, rather than from the centrioles (Gould &
Borisy, 1977), and irradation of the centrioles with a laser microbeam had no effect on the centrosome’s ability to function as an MTOC (Bems &
Richardson, 1977). Since centrioles are an integral part of centrosomes in many cells, however, they might provide a template, or an '^address” for the centrosomes (Mazia, 1984). Generally, the MTOCs reproduction cycle maintains the continuity of these organelles from one generation to the next
During interphase, they are duplicated, hence providing the coming mitosis with two spindle poles, which are then divided between the daughter cells.
Microtubules rarely polymerize randomly in the cytoplasm. Instead, microtubule assembly has been shown to be preferred around MTOCs, where the critical concentration for assembly is lower than in other regions of the cytoplasm (Mitchison & Kirschner, 1984a; reviewed in Brinkley, 1985), favoring initiation and assembly.
Centrosomes have also been shown to establish the protofilament number of nucleated microtubules. Experiments have shown that microtubules nucleated from isolated centrosomes consistently have 13 protofilaments (Evans et al., 1985). Microtubules assembled in the absence of centrosomes, on the other hand, have protofrlament numbers ranging from 9 to 16 (Pierson et al.,
1978; McEwen & Edelstein, 1980; Linck & Langevin, 1981; Scheele et al., 1982; Evans et al., 1985), and it has been shown that a skew of the protofilaments with respect to the microtubule axis allows for the accomodation of the extra number of protofilaments (Wade et al., 1990).
14 Microtubules are polar structures with their plus ends distal from the
MTOC and their minus ends proximal to the MTOC (Haimo et al.^ 1979; Heidemann & McIntosh, 1980). Moreover, the dynamics at each microtubule end are remarkably different; The plus end grows at a higher rate than the minus end, and undergoes more frequent transitions between growing and shrinking. These differences in assembly and disassembly between the two ends are probably essential for the regulation of microtubule dynamics, especially in the mitotic spindle. In addition, the establishment of polarity by
MTOCs is important for the directional movement of motor proteins.
Conventional kinesin, for example, moves toward the plus end of microtubules, while dynein moves in the opposite direction, and this directional movement is important for cytoplasmic transport and chromosome movement during mitosis and meiosis (reviewed in Barton & Goldstein, 1996).
Several methods have been used to determine the uniform polarity of cytoplasmic microtubules. These techniques revealed that microtubules have a uniform polarity. In addition, Euteneuer & McIntosh (1981) and Telzer &
Haimo (1981) have shown that in mitotic and meiotic spindles, microtubules have the same polarity with the plus ends distal from the microtubule organizing centers.
Several studies have also aimed to determine which subunit type, a or ^ tubulin, is exposed at each microtubule end, and have yielded seemingly different results. The first genetic clue about microtubule polarity came from the discovery of y tubulin (Oakley & Oakley, 1989) as an intergenic suppressor of a
15 ^-tubulin mutation in Aspergillus nidulans, with no detectable interaction with a-tubulin (MaryAnn Martin & Berl R. Oakley, unpublished observations), y tubulin was also found to be localized at the microtubule organizing centers in several evolutionarily divergent organisms. These data suggested a physical interaction between y and P tubulin at the minus end, leaving an a-tubulin residue exposed at the plus end, which would establish polarity in a simple fashion (Oakley 1992). A few years later, however, biochemical work done by Mitchison (1993) identified an exchangeable GTP binding site on P tubulin at the plus ends of microtubules, implying that P tubulin is the plus-end residue. In view of the “B”-lattice structure of the microtubule, however, an exchangeable
GTP binding site could still be located at the plus end without P tubulin being necessarily the plus-end residue (see Figure 1). This work was then followed by recent results published by Song & Mandelkow (1995) which showed, from their earlier findings that the microtubule-based motor, kinesin, preferentially binds P tubulin (Song & Mandelkow, 1993), that there is a lower projected density of kinesin binding at the plus ends of microtubules, which was attributed to the presence of an a-tubulin residue. Conflicting results have now been reported by Hirose at al. (1995), which show, using various methods for microtubule assembly from axonemes, that the main mass of the kinesin head is associated with the tubulin subunit closer to the plus end of the microtubule. In addition. Walker (1995) demonstrated that kinesin can be cross-linked to both a and P tubulins. Therefore, it is, at present, difficult to draw conclusions about the polarity of the tubulin residues along microtubules.
16 Microtubule associated proteins A variety of proteins known as microtubule associated proteins or MAPs
interact with microtubules and modulate their dynamics. They are often called
“structural” MAPs, because they bind to, stabilize, and promote the assembly of microtubules. In vitro, they affect the behavior of microtubules by enhancing
those parameters such as growth rates and rescue frequency, leading to more stable microtubules (Drechsel et al., 1992; Pryer et al., 1992; Kowalski & Williams, 1993).
MAPs were identified as proteins that co-purify with tubulin through rounds of assembly and disassembly. Two high molecular weight MAPs, MAPI and MAP2 and their subspecies, were isolated from mammalian brains (Sloboda et a l , 1975), and were seen as projections on the surface of the microtubules under electron microscopy. Another smaller MAP, tau, was identified by Weingarten et al. (1975) and was localized mainly to the dentritic and axonal compartments of neurons. Another class of MAPs, the MAP4 class, was identified by the method of Vallee (1982) in which these MAPs were released from taxol-stabilized microtubules using 0.35 M NaCl. Recently a MAP- homologous protein (MHPl) was identified in a lower organism, the budding yeast Saccharomyces cerevisiae, and was found to be essential for the formation and/or stabilization of microtubules (Irminger-Finger et al., 1996).
The sequences of the genes encoding MAP2 from mouse brain (Lewis et
û/.,1988), tau (Lee et al., 1988), and MAP4 (Chapin & Bulinski, 1991), reveal
17 three imperfect repeats of 18 amino acids, separated by 13 or 14 amino acids, at the C-terminus. These sequences are thought to be the microtubule-binding domain of MAPs. Indeed, peptides encoding these repeats were found to copurify with microtubules through cycles of assembly and disassembly (Lewis etal., 1988; Himmler^ro/., 1989).
Due to their positive charge, MAPs are thought to bind to the highly negative C-terminus of the tubulin subunit. This was inferred from the observation that their binding does not inhibit microtubule assembly, and is thus not near any of the presumed intra- or inter-dimer interfaces, nor is it near the sites responsible for the lateral interactions between protofilaments. It is not known, however, whether MAPs bind to the a- or ^-tubulin subunit
Another class of proteins that interact specifically with microtubules are the motor proteins such as dynein, kinesin and their many relatives. These motors, as their name implies, generate motion along microtubules using the chemical energy of ATP hydrolysis.
Tubulin biochemistry: domain structure and drug interactions
The sequences of a and |3 tubulins show that these proteins are highly conserved {all a tubulins share ^ 62.3% amino acid identity and all P tubulins share ^ 63.3% amino acid identity, (Bums 1991)}. Each of these monomers has a molecular weight of - 50 kDa and consists of about 450 amino acid residues.
Their amino acid sequences are known from a variety of organisms. These a- tubulin and P-tubuUn sequences are highly homologous except for the variable.
18 highly acidic C-tenninal region and a small stretch near the N-terminus
(reviewed by Cleveland & Sullivan, 1985).
In an effort to define the tubulin functional domains required for the formation of the dimer and of the microtubule polymer, Kirchner & Mandelkow
(1985) used chemical cross-linking and limited proteolysis to show that the N- terminal half of a tubulin binds to the C-terminal half of P tubulin to form the intra-dimer bond, and that the inter-dimer bond is formed by the binding of the
N-terminal half of P tubulin, presumably bearing the exchangeable GTP site, to the C-terminal half of a tubulin. Furthermore, x-ray diffraction data from calf brain microtubules at 18 Angstrom resolution allowed Beese et al. (1987) to divide the tubulin subunits into three distinct domains which allow flexibility at the connections between these domains. In addition, the observed sensitivity of certain regions to various proteases also suggested the presence of domain structure in tubulin (Kirchner & Mandelkow, 1985). Recent resolution of tubulin structure at 6.5 Angstroms did not, however, show any clear domain separation (Nogales et al., 1995).
In addition to its binding GTP and other proteins, tubulin has been shown to be the site of action of many medically and agriculturally important drugs, such as vinblastine, colchicine, benomyl, nocodazole, and taxol (reviewed by Wilson & Jordan, 1994). These various drugs not only differ in their binding sites on and stoichiometry with the tubulin dimer, but they also differ in the way they modulate microtubule dynamics. First, vinblastine, isolated from the plant
Catharanthus roseus, inhibits mitosis by an action on the spindle microtubules.
19 It binds to the tubulin dimers at two sites, and induces the formation of tubulin aggregates which have an even greater affini^ to vinblastine (Na & Timasheff,
1986). At low concentrations (3-64 nM), vinblastine supresses dynamic instability without causing a net microtubule depolymerization. It also increases the average duration spent by microtubules in pause which is a state of decreased dynamics where microtubules are neither growing nor shrinking.
This supports the theory that vinblastine acts as an antitumor drug by supressing the dynamics of the mitotic spindle (Dhamodharan et al., 1995). In addition, vinblastine was shown to act on microtubules by peeling off their constituent protofilaments (Jordan et at., 1986). Second, colchicine, isolated from the autumn crocus Colchicum autumnale, has historically played an important role in the discovery of the microtubule “subunits”, and was used as a marker for biochemical purification of tubulin from bovine brain (Weisenbeig et ai, 1968). The binding reaction of colchicine to tubulin is a two-step process: following the reversible formation of a pre-equilibrium complex, a conformational change occurs which leads to the formation of a reversible tubulin-colchicine (TC) complex (reviewed by Hastie, 1991). In addition, colchicine increases the GTPase activity of tubulin (David-Pfeuty et a l , 1979;
Andreu & Timashefr, 1981) and the formation of these TC complexes induces the formation of non-microtubule polymers. Other drugs, such as the structurally related compounds benomyl and nocodazole, bind at the same site as colchicine (reviewed by Wilson & Jordan, 1994). Finally, taxol, isolated from the bark of the western yew, Taxus brevifolia, is a promising antitumor drug
2 0 (reviewed by Rowinsky et al.^ 1990). Unlike the above drugs that seem to destabilize microtubules in various manners, taxol arrests cells in mitosis by hyperstabilizing microtubules, increasing their mass in the cells, and inducing microtubule “bundling” (Schiff & Horwitz, 1980; Turner & Margolis, 1984;
Rowinsky et al. , 1988; Roberts et a l, 1989). In vitro, taxol was shown to decrease the lag time for microtubule assembly and shift the equilibrium toward the formation of microtubules, thereby decreasing the critical concentration for assembly (Schiff et at., 1979). In addition, taxol modulates microtubule disassembly through a slow rate-limiting dissociation of this drug from the microtubule ends followed by a very rapid loss of underlying taxol-free tubulin subunits (Caplow et al., 1994). Structurally, taxol seems to preferentially bind the microtubule polymer, or binds to the tubulin dimer but at a much lower affinity (Carlier & Pantaloni, 1983). In addition, the density for taxol appears away from the monomer-monomer or dimer-dimer interfaces, and near the interprotofilament contact which is in agreement with the preferrential binding of taxol to polymerized tubulin (Nogales et al., 1995). Interestingly, most, if not all, of the drugs investigated were shown, by biochemical or genetic means, to bind exclusively to ^-tubulin. For example, UV- crosslinking followed by proteolysis identified the first 36 amino acids and amino acids 214-241 of the ^-tubulin monomer to be the site of binding for colchicine (Uppuluri etal., 1993). Using similar techniques, Rao etal. (1994) demonstrated that taxol binds to the first 31 amino acids of P tubulin. In addition, genetic analysis of benomyl resistant mutants in fungi showed that all
21 the mutations mapped to ^-tubulin genes. The fact that P tubulin, and not a tubulin, is the binding site for both drugs and exchangeable GTP is intriguing.
Tubulin molecular biology and genetics
In most cell types, tubulins exist as a heterogeneous population, and this heterogeneity is manifested at both the genetic and the post-translational levels. Extensive tubulin heterogeneity was first observed, using isoelectric focusing, in
flagella and mammalian brains where several a - and p-tubulin species were
detected (reviewed by Cleveland & Sullivan, 1985). This phenomenon was not
the result of different brain cell types expressing different tubulins, but rather individual nerve cells bearing complex tubulin pools (Oozes & Sweadner, 1981). Multiple tubulins have been detected in a variety of organisms including animals, flies, fungi, algae, and parasites and much information has since come firom the cloning and sequencing of the genes encoding these different tubulin isotypes. These studies showed that tubulin is encoded by multigene families that are, in most cases, dispersed in the genome. Tubulin gene clustering has been reported, however, in some organisms such as sea urchin, antarctic fish, some unicellular parasites, and possibly red algae (Alexandraki & Ruderman,
1983; Thomashow et al., 1983; Parker & Detrich, 1996; Akkari & Oakley, see
Chapter 3). This phenomenon will be discussed in more detail in Chapter 3.
Interestingly, in mammalian genomes, in addition to the functional tubulin genes, there are a large number of pseudogenes and processed pseudogenes, the significance of which is not known (reviewed by Cleveland & Sullivan, 1985).
2 2 Analysis of the tubulin sequences from different organisms has shown that the encoded polypeptides can be classified into is o ^ ic classes (reviewed
in Little & Seehaus, 1988). The conservation of certain variable sequences in functionally related tubulins from different organisms suggests that these
sequences have been maintained through evolution by positive selection (Sullivan & Cleveland, 1984),
Uncertainty remains about the functional significance of this complexity of isoforms (Sullivan, 1988). In 1976, Fulton & Simpson proposed the “multi
tubulin hypothesis” which stated that different tubulin isotypes could be
differentially incorporated into the various types of microtubules found in a cell
and impart different characteristics to the different ^fpes of microtubules (Fulton
& Simpson, 1976). Except for the expression of the testis-specific ^2-tubulin gene in Drosophila (Hoyle & Raff, 1990), this hypothesis has not been fully
substantiated. This led Raff (1994) to propose that several tubulin genes exist to fulfill regulatory requirements to coordinate tubulin synthesis through multiple programs and ensure that a sufficient pool of tubulin is expressed to meet the requirements for the variety of functions that microtubules undergo. Another level of tubulin heterogeneity also exists through posttranslational modifications. It has been shown that a tubulin can be reversibly tyrosinated and acetylated (Barra et at., 1973; L’Hemault &
Rosenbaum, 1983). Reversible Qrosination occurs via the addition or removal of the C-terminal tyrosine residue and early biochemical work identified the enzymes responsible for this modification, tubulinityrosine ligase (TTLase) and
23 tyrosyltubulin carboxypeptidase. The development of antibodies specific for tyrosinated (Tyr) and untyrosinated (Glu) a tubulin demonstrated that the major population of microtubules in cells are composed of Tyr-tubulin, and a minor population is enriched with Glu-tubulin (Gunderson et al., 1984; Geuens et al.,
1986). This phenomenon was later correlated with microtubule stability. High
Glu-tubulin content was present in stable inteiphase microtubules and in stable specialized microtubule systems such as in cilia and flagella (Wehland & Weber, 1987; Kreis 1987; Schulze et al., 1987; Gundersen & Bulinski, 1986), but high Glu-tubulin does not, by itself, cause stable microtubules (Khawaja et at., 1988; Webster et al., 1990).
Acétylation of a tubulin has been observed originally in
Chlamydomonas reinhardtii (L’Hemault & Rosenbaum, 1983), but has now been also seen in mammalian cells. As for tyrosination, acétylation occurs preferrentially on polymeric tubulin and is correlated with stable microtubules that are resistant to depolymerization induced by drugs but not by cold
(Pipemo et al., 1987). Additionally, glutamylation and polyglycylation of both a and P tubulins was also recently reported (Redecker et al., 1994).
P tubulin has also been reported to be modified by phosphorylation (Gard & Kirschner, 1985), but this reaction has not been extensively studied.
The detection, however, of at least 12 p-tubulin isoforms upon isoelectric focusing of tubulin from vetebrate brains which do not express more than six genetic isotypes demonstrate the existence of additional post-translational modification on P tubulin in vivo (Field et al., 1984).
24 Y tubulin It has been shown that the isolation of extragenic suppressors of a mutation can lead to the identification of genes whose product potentially interacts with the product of the initial mutant gene investigated (Jarvik & Botstein, 1975). Therefore, in an effort to identify novel proteins that interact with microtubules or that are essential for microtubule function, Berl Oakley and his colleagues undertook a reversion analysis to look for suppressors of a P- tubulin mutation, benA33. benA33 is a heat sensitive mutation which seems to cause a hyperstabilization of microtubules at restrictive temperatures (Oakley &
Morris, 1981). Among the extragenic suppressors analyzed, four cold-sensitive mutants mapped to two previously unidentified loci designated mipA and mipB
(Weil et al., 1986). Sequencing the mipA gene product revealed the existence of a third member of the tubulin superfamily, y tubulin (Oakley & Oakley, 1989).
It was subsequently found that y tubulin is a ubiquitous protein, present in evolutionarily divergent organisms ranging from humans to primitive red algae
(reviewed in Bums, 1995). Disruption of the y-tubulin genes in A. nidulans and
Schizosaccharomyces pombe revealed that y tubulin is essential and is required for microtubule assembly in vivo (Oakley et at., 1990; Horio et al., 1991). In addition, y tubulin was localized to the microtubule organizing centers in all organisms investigated, which led Oakley (1992) to propose a model whereby y tubulin would physically interact with P tubulin at the minus end, nucleate microtubule assembly and establish polarity in a simple fashion. Indeed, it has
25 been shown that injection of anti-Y-tubulin antibodies into cultured mammalian cells blocks microtubule nucléation (Joshi et nZ., 1992). Moreover, recent biochemical purification of the so called ‘‘y-some” (a y-tubulin-contaiiung complex named as such by Steams & Kirschner, 1994) from Xenopus leavis extracts, demonstrated that y-tubulin is a component of a 25S open-ring complex capable of binding to the minus end and nucleating microtubule assembly in vitro (Zheng et al., 1995). It was also found that there were 10-13 y- tubulin molecules per molecule of y-tubulin complex, in addition to one or two tubulin molecules (Zheng et a i, 1995).
Rationale for dissertation research
Despite decades of extensive research aimed at providing a better understanding of microtubule structure and function, the absence of a high- resolution tubulin structure has precluded the elucidation of the sites involved in the interdimer and intradimer interactions as well as lateral interactions along microtubules. A high-resolution of tubulin structure should also reveal the GTP binding sites and the conformational changes that tubulin undergoes upon binding and hydrolyzing GTP. Additionally, it will show the tubulin sites involved in the binding of medically and agriculturally important drugs. This latter issue has gained more interest by the medical community since microtubules are the site of action of promising antitumor agents.
The three-dimensional structure of macromolecules can, in principle, be elucidated using various techniques including NMR, high resolution electron
26 microscopy, x-ray crystallography and scanning tunneling microscopy. In the case of tubulin, however, its high molecular weight (~ 100 kD) has precluded the use of NMR to determine its stmcture. As to x-ray crystallography, three main factors may explain the difficulty experienced by researchers in growing suitable tubulin crystals. First, tubulin, purified from rich sources such as mammalian brain, is a mixture of many a- and ^-tubulin isoforms. Additional heterogeneity originates from multiple posttranslational modifications. Second, tubulin seems to exhibit an intrinsic lability demonstrated by its tendency to denature with varying temperatures and pH and over time. Finally, tubulin has the tendency to assemble into microtubules and other protofilamentous structures, which suggests that the tubulin subunit interactions involved in the formation of these structures might be more favored than the formation of crystals.
Obtaining homogeneous tubulin could theoretically be achieved through the expression of individual tubulin genes in bacteria which not only would express only one isotype but is also devoid of posttranslational modifications.
To date, expression of native tubulin in bacteria has not been possible periiaps because of a requirement of chaperonin complex for correct tubulin folding.
It has therefore become clear that in order to be able to grow suitable tubulin crystals, protocols have to be devised that would provide native, stable and homogeneous tubulin preparations expressed in eukaryotic systems. Even with the use of high resolution electron microscopy (for review see Downing,
1991) which has proven to be a valuable tool in examining the arrangement of
27 tubulin subunits within zinc sheets and continuing advances in these techniques are likely to provide close-to-atomic resolution (Nogales et al., 1995;
Nogales et al., 1996), better results have been obtained with tubulin of reduced heterogeneity (Nogales et al., 1995). In Chapter 2 of this dissertation, I will describe the use of the filamentous fungus Aspergillus nidulans to express and purify isotypically pure tubulin. I will first describe the advantages of using this model organism, and then move to explain the methodology and the results obtained. Finally, I will include a discussion of the results and how they might impact our understanding of microtubule structure and function. Since A. nidulans tubulin may not prove to be stable enough to withstand crystallization or other structural studies, I have investigated the tubulin genes of the thermophilic red alga Cyanidium caldarium with the goal of expressing these genes in heterologous organisms and obtaining heat-stable tubulin. In Chapter 3 ,1 will present the rationale for this study in detail, in addition to a description of the experimental design and results, followed by a sequence analysis of the cloned tubulin genes.
28 CHAPTER 2
EXPRESSION AND PURIFICATION OF ISOTYPICALLY PURE TUBULIN FROM ASPERGILLUS NIDULANS
Introduction Tubulin exists in several genetically and posttranslationally modified isotypes within tissues and even within individual cells (Cleveland & Sullivan, 1985; MacRae, 1992). In almost all organisms examined, a and P tubulins, which form the tubulin heterodimer, are encoded by multigene families, and exist as a heterogeneous mixture of isotypes in a single cell. In mammalian brain, the usual source of tubulin for biochemical studies, at least five different a-tubulin genes and six different ^-tubulin genes are expressed (reviewed in
Little & Seehaus, 1988; Luduena et a l, 1992). Assuming that all a tubulins will form heterodimers with all P tubulins, a total of thirty different types of tubulin heterodimers may be present This heterogeneity precludes a number of important biochemical and structural analyses. It is not possible, for example, to determine the assembly characteristics of the various individual isotypes or their sensitivity to antimicrotubule agents, using conventional unfractionated tubulin preparations. Such information could help in understanding the necessity for eukaryotic cells to express such a variety of tubulin isotypes, and
29 possibly attribute to these isotypes differential roles in microtubule function. In addition, this heterogeneity has hindered attempts to determine the structure of tubulin at the atomic level which would give insights into the mechanism of microtubule assembly and GTP hydrolysis, and the binding mechanisms of various medically and agriculturally important drugs. Such knowledge could aid in designing more specific therapeutic compounds with fewer side effects. In addition, the structure of tubulin, both from x-ray diffraction data and electron crystallography, should also provide useful information about the mechanism by which different microtubule-binding proteins such as y tubulin, molecular motors and structural MAPs, nucleate microtubule assembly, move along the microtubules and stabilize them, respectively. As mentioned in Chapter 1, the heterogeneity of tubulin has undoubtedly contributed to the difficulties experienced by various laboratories in producing tubulin crystals and would make interpreting any structural data difficult
Progress in reducing the heterogeneity of brain tubulin has been made by Luduena and coworkers. They were able to purify tubulin dimers of single P-tubulin isotype, but different a-tubulin isotypes, from bovine brain, with the composition apn. ctpni. and aPiy. This was achieved by immunoaffinity chromatography using monoclonal antibodies raised against specific peptides for each of these P-tubulin isotypes (Baneijee et al., 1988; Baneijee et al.,
1990; Baneijee et al., 1991; Baneijee et al, 1992a). Subsequent biochemical studies demonstrated that these isotypes have different assembly
30 characteristics under different in vitro conditions, as well as different affinity constants (Kg) for binding the antimitotic alkaloid colchicine (Baneijee et aL, 1992b; Lu & Luduena, 1994). In addition, these purified isotypes were shown to have unique conformations based on the findings that they reacted differently with N, N’-polymethylenebis (iodoacetamide) which is known to form specific intrachain cross-links in P tubulin (Shaima & Luduena, 1994). Subsequently, Panda et al. (1994) used the same tubulin preparation to demonstrate that microtubule dynamics, observed using video-enhanced differential interference microscopy (DIG), are also regulated, in vitro, by the tubulin isotype composition. These studies suggested that mammalian cells might regulate the different microtubule dynamics properties and functions by altering the relative amounts of the various tubulin isotypes expressed. Furthermore, the reduced heterogeneity of this tubulin preparation has also contributed to a better understanding of the structure of tubulin in zinc sheets and has yielded structural information to 6.5 angstroms resolution (Nogales et al., 1995). Although the efforts to reduce tubulin heterogeneity from mammalian brain have yielded important information as to the possible roles of the multiple P-tubulin isotypes, they did not, however, address the heterogeneity of the a-tubulin isotypes in these preparations.
Applying biochemical and structural techniques with isotypically pure tubulin from a genetically tractable organism could allow the structural investigation of already existing tubulin mutations as well as engineered mutations and loops that could then be easily localized, for example, in tubulin
31 zinc sheets. In an attempt to characterize different tubulin mutations biochemically, Davis et al. (1993) purified assembly-competent tubulin from the budding yeast, Saccharomyces cerevisiae. The advantage of using this system lies in the fact that S. cerevisiae has only two a-tubulin genes and one
P-tubulin gene (Neff et al., 1983; Schatz et al., 1986), which produces only two kinds of tubulin heterodimers in the cell. In addition, its genetics has allowed Sage et al. (1995) to characterize the efrects of different mutations in the putative tubulin GTP-binding domains, on microtubule assembly and dynamics in vitro. The purification of assembly-competent tubulin from S. cerevisiae, however, does not yield isotypically pure tubulin and this may limit its use for high resolution structural studies.
We have thus chosen to attempt to purify functional and isotypically pure tubulin dimers from an equally genetically amenable system, the filamentous fungus Aspergillus nidulans. A. nidulans (order Plectascineae, family: Aspergillacea) is a filamentous ascomycete which was initially chosen as a model system because it lends itself to genetic analysis (Clutterbuck,
1974).
Its life cycle (reviewed in Pontecorvo, 1953) consists of two phases, vegetative and sexual. In the vegetative cycle (Figure 3), a uninucleate haploid vegetative spore (conidium) sends out a germ tube in a process called germination. Following germination, the conidium produces colorless septate hyphae with multinucleate cells. Some of these cells (foot cells) differentiate to form a multinucleate stalk (conidiophore) which grows out of a solid medium
32 Figure 3: Aspergillus nidulans life cycle.
A. nidulans undergoes both sexual and asexual life cycles. In the asexual or vegetative stage, an asexual spore or conidium. sends out a germ tube in a process called germination where nuclei divide. At a specialized location of the resulting branched hyphae, a conidiophore forms at the end of which conidia bud out. In the sexual cycle, two nuclei fuse in what is called the ascus primordium. This diploid nucleus undergoes meiosis followed by two mitotic divisions generating eight binucleate ascospores enclosed in an ascus. Several thousand asci are contained in fruiting bodies called cleistothecia.
33 ©a: Q. g)
_aoaoQlDonoo*oo « oooTC1 ascospoie branched hypha
SEXUAL ASEXUAL
(g o O P) germling Conidiation cleistothecium i Germination
conidia Meiosis
early ascus
o I O o O q O b o o o o O |o qOq « o o p O q «T o o o Oô conidiophore (Nuclear Fusion IN > 2N)
(Courtesy of Dr. MaiyAnn Martin)
Figure 3.
34 and ends in a multinucleate vesicle. On the surface of the vesicle, a number of uninucleate elongated buds (primary steiigmata) develop, and each gives rise to a second series of cells called secondary sterigmata. The nucleus in each secondary sterigmata divides repeatedly, with one daughter nucleus remaining in the proximal part of the sterigmata, whereas the other daughter nucleus migrates to the distal part and is then constricted out to differentiate into a conidium.
In the sexual cycle, a spherical ascus primordium, carrying a big nucleus, buds out of a hypha. This nucleus is almost certainly the result of the fusion of two smaller nuclei. This nucleus undergoes a meiotic division (meioses I and n), and the four products of meiosis divide again, giving in all eight haploid nuclei. The content of the ascus is then divided into eight spores, each with one nucleus. The nucleus in each spore divides again before the spore is fully mature, and each resulting binucleate spore is called an ascospore. Asci are contained in sacs called cleistothecia which generally form after 8-10 days of incubation at 37®C.
Pontecorvo (1953) showed that mutations in genes of interest can be made, mapped and maintained in A. nidulans. Eight linkage groups have been defined in this organism, in addition to the identification and characterization of many markers (Clutterbuck, 1974; Cove, 1977; Clutterbuck, 1993). Moreover, A. nidulans is homothallic which facilitates crosses between any two strains (Pontecorvo, 1953; Clutterbuck, 1974). At 37“C, which is the optimal temperature for growth, the asexual cycle takes approximately two
35 days, but it can also grow at temperatures up to 4S**C. It is naturally haloid, but diploid strains can be created under certain conditions, and maintained.
Tubulin studies in A. nidulans have been very firuitful, and the first a-, ^ and y-tubulin genes ever identified were all identified in A. nidulans (Sheir- Neiss etal.^ 1978; Morris etal., 1979; Oakley & Oakley, 1989). A. nidulans has only two a-tubulin genes, tub A and m6B, and two ^-tubulin genes, benA and tube. The tub A gene which encodes the major a tubulin, is essential and is required for nuclear division and migration in the vegetative cycle (Oakley et a i, 1987a; Doshi et. al., 1991); the tubB gene which encodes the minor a tubulin, functions in sexual reproduction and is not essential for viability (Kirk & Morris, 1991). These two a-tubulin genes, however, are functionally interchangeable when appropriate amounts are expressed (Kirk & Morris,
1993). Similarly, the benA gene which encodes the major P tubulin, is essential and required for nuclear division and migration (Oakley & Morris, 1980; 1981) while the tubC gene encoding a minor P tubulin, plays a role in conidial development, but is not required for cell viability and is present in very low amounts in hyphae (Weatherbee et al., 1985; May et a/.,1985; May & Morris,
1988). Both P-tubulin genes are functionally interchangeable (May, 1989).
Since A. nidulans grows at temperatures up to 45°C, its tubulin might be more heat stable than mammalian tubulins. Biochemical studies of tubulin in lower eukaryotes has, however, been hindered in the past by the low concentration of tubulin in the cytoplasm (less than 1% of total proteins in A. nidulans).
36 Recently, Yoon and Oakley (1995) developed a procedure to purify assembly-competent tubulin from A. nidulans. In order to overcome the problem of low tubulin concentration in fungi, they overexpressed the products of the tubA and benA genes by placing these genes under the control of the inducible aleA (alcohol dehydrogenase A) promoter (Waring et al., 1989), and purified the overproduced tubulin by ion-exchange chromatography followed by cycles of microtubule assembly and disassembly.
They were able to use this preparation to investigate the effect of taxol on microtubule assembly and disassembly. They found that taxol facilitated the assembly of A. nidulans tubulin into microtubules in vitro but only at concentrations ^ 100 pM which is much higher than the concentration required for maximal promotion of the assembly of brain tubulin. They also measured the critical concentration for the assembly of A nidulans tubulin in the presence of 100 pM taxol, and found it to be 0.16-0.2 mg/ml compared to
0.05 mg/ml for brain tubulin. In addition, A. nidulans microtubules that are assembled in the presence of taxol can be depolymerized under conditions in which taxol-stabilized mammalian microtubules remain intact. Their results therefore suggest that A. nidulans tubulin has a lower affinity for taxol than
Their procedure, however, did not yield homogeneous tubulin and required the overexpression of the major tubulin genes. Overexpression of tubulins is not conducive to the growth of large A. nidulans cultures since the methyl-ethyl ketone-containing inducing medium is somewhat toxic to the
37 hyphae and cultures had to be grown in complete medium and then shifted to inducing medium. In order, therefore, to purify homogeneous tubulin composed of the products of the endogenous expression of the tubA. and benA genes only from
A. nidulans, we first chose to tag the benA protein with six histidine residues which are known to have a high affinity for metal ions. Metal chelate or immobilized metal affrnity chromatography has been shown to be a powerful technique to purify recombinant proteins under mild conditions. An agarose- based resin is used (Invitrogen Corp.) whereby a metal chelating group is first immobilized on a chromatographic medium and a multivalent metal ion (in this case, the metal ion is Ni2+) binds in a way that leaves some coordination sites free for selective interaction with proteins. Typically, 5-6 histidines residues
(commonly called a His-tag) are added to the C- or N-terminus of a target protein. This tag specifically interacts with the chelated metal ions, thereby retaining these proteins on the media. Other components bind weakly or not at all. Elution of the fusion protein is usually performed by increasing the concentration of a competitive eluting agent such as imidazole, or by simply reducing the pH of the buffer (Schmidbauer et al., 1996, Janknecht et aln
1991).
Subsequently, the strain carrying the 6-His-tagged benA gene was crossed with another strain carrying a deletion of the tubB gene encoding the minor a tubulin, and segregants carrying both the 6-His-tagged benA gene and the tubB gene deletion were identified. When grown in liquid cultures,
38 these segregants will theoretically express the product of the tubX gene, the products of both the wild-type and 6-His-tagged benA and small amounts of the product of the tubC gene. Upon purification through a nickel-chelated resin, however, I was able to obtain isotypically pure tubulin (with respect to the genes, since we don't know much about posttranslational modifications in A. nidulans) tagged with six histidine residues at the C-terminus of P tubulin, and consisting of the products of the tubA and benA genes only. The strain expressing the 6-his-tagged tubulin was viable and grew normally at different temperatures. Furthermore, I show that the addition of the six histidine residues did not interfere with tubulin function by demonstrating its ability to assemble into microtubules in vitro.
Materials and methods
Strains and media
The haploid A. nidulans strain G191 (pyrG89, pabaA\,fwA\, uaY9) was previously obtained from Dr. G. Turner (University of Bristol) via Dr. C. F. Roberts (University of Leicester). Strain KK2.70.7 (j>yroA4; tubB::pyr4; pyrG%9\ wA3) was constructed by Dr. Karen Kirk in Dr. Ron Morris’ laboratory (UMDNJ, Robert Wood Johnson Medical School). Strains YAYYl and YAYY2 are two different transformants of pYA4 (see next paragraph for
39 the description of plasmid pYA4) in 0191. Strains AY1-AYI2 are different segregants of the cross between YAYY2 and KK2.70.7. In preparation for conidia collection, 0191 was grown on solid PYRO medium {20 g/1 malt extract (Difco Labs), 1 g/1 peptone (Difco Labs), 20 g/1 dextrose, 2 ml/1 trace elements solution (1.0 g/1 ferrous sulfate, 8.8 g/1 zinc sulfate, 0.4 g/1 copper sulfate, 0.15 g/1 manganese sulfate, 0.1 g/1 sodium borate, and 0.05 g/1 ammonium molybdate), 1 g/1 uracil (Sigma), 25 g/1 Furcelleran (Pretested Burtonite 44c, TIC Oums)} supplemented (after cooling to 65"C) with 5.7 pM p-aminobenzoic acid (paba) (Sigma) and 10 mM uridine (U. S.
Biochem. Inc.). 0191 conidia were collected firom solid media in S/T solution
{8.5 g/1 sodium chloride and 1 ml/1 Tween-80 (Sigma)} and germinated in YO liquid medium {5 g/1 yeast extract (Difco Labs), 20 g/1 dextrose} supplemented with 10 mM uridine. A. nidulans strains YAYYl, YAYY2, AY1-AY12 were grown on FYO medium {25 g/1 Furcelleran, 5 g/1 yeast extract (Difco Labs), 20 g/1 dextrose, and 2 ml/1 trace elements solution} in preparation for conidia collection. Conidia from these strains were collected in S/T solution, and germinated in YG liquid medium. PYRG, FYG and YG were used as complete media.
For the 6-His tubulin purification experiments, strain AYl was spread on
FYG plates, and spores were collected in S/T solution and grown in 10 liters of YG at 2 X 106 spores/ml of YG in the 10-liter fermenters of the College of
Biological Sciences Fermentation facility. After 15 hours, mycelia were collected, two liters at a time, on Myracloth (Calbiochem. Inc.) placed in a
40 Buchner funnel for rapid aspiration of the medium, washed in distilled water, dried thoroughly using p ^ r towels, and frozen in liquid nitrogen. The frozen mycelia were stored at -7Cf C until use. Strain JM109 {«ndAl, recAl, gyrA96, thi, hsdR ll (rg-, mK+), relAl, supE44, A(lac-proAB), [F’, troD36, proAB, /aclqZAMlS]} was used for bacterial transformations. JM109 was streaked to single colony from frozen stocks on M9 medium {2 mM magnesium sulfate, 0.2% glucose, 0.0001 p^rnl thiamine, 0.2 mM L-tryptophane, 0.1 mM calcium chloride, and 15 g/1 Bacto- Agar (Difco Laboratories) supplemented with 1 X salts solution adjusted to pH
7.4 (1 X salts solution; 0.6 g/1 monobasic sodium phosphate, 0.3 g/1 potassium phosphate, 0.05 g/1 sodium chloride, 0.1 g/1 ammonium chloride)} to select for the F-plasmid which carries the coding sequence for the truncated P- galactosidase enzyme. Liquid JM109 cultures were grown in 1 ml of LB medium (5 g/1 yeast extract (Difco Laboratories, 10 g/1 Bacto-Tryptone (Difco
Laboratories), 10 g/1 NaCl) to an OD 500 of 0.5, and then processed for electroporation according to Bio-Rad recommendations. All ligation products were introduced into JM109 by electroporation using the Bio-Rad Gene
Puiser in Dr. Donald Dean’s laboratory (Departments of Biochemistry and
Molecular Genetics). The electroporated bacterial cells were recovered in LB medium and plated on LBA medium supplemented with ampicillin (35 pg/ml),
IPTG (0.8 mg/plate) and X-Gal (0.8 mg/plate) for recombinant plasmid selection.
41 Plasmid construction
All plasmid DNA manipulations were conducted following the methods described in Sambrook et aL (1989) or according to the recommendations of the enzymes’ manufacturers (New England Biolabs and U. S. Biochemicals).
A. nidulans tranformations
G191 protoplasts were transformed with plasmid pYA4 using the method described by Oakley et al. (1987b). G191 conidia, at a concentration of S X 106 conidia/ml of YG supplemented with 10 mM uridine, were incubated at 37®C with gentle shaking for 4-5 hours, until the conidia swelled. These conidia were collected, prior to germ tube formation, with a 3 minute centrifugation at 2500 x g in a swinging-bucket rotor followed by a wash with
40% of the initial volume of YG. After vortexing, the conidia were centrifuged and resuspended again in 40% of the initial volume of YG. This was followed by rigorous vortexing for 3 minutes to break up conidial clumps. An equal volume of freshly prepared 2X protoplasting solution {1.2 M potassium chloride, 100 mM citric acid, 12 mg/ml Driselase (Sigma) (the starch carrier was removed by centrifugation at 2500 x g for 5 minutes at 4*’C), 12 mg/ml
Novozyme 234 (NovoBio Labs), 20 mg/ml bovine serum albumin (Sigma), 20 pl/ml P-glucuronidase (Sigma G-0762), and 20 mM uridine} was filter sterilized, chilled on ice, then warmed to 25-30°C 5 minutes before use. This solution was then added to the conidial solution and the mixture was incubated at
30°C with gentle shaking. The conidia were pipetted up and down with 1 ml
42 transfer pipette (IX per ml of protoplasting solution) every 30 minutes to
prevent clumping until the majority of conidia had formed protoplasts. The
formation of protoplasts was monitored periodically using a phase-contrast microscope (Olyn^us BH-2). Subsequently, the protoplasts were pelleted by centrifigation at 2500 x g for 10 minutes and resuspended in 1/10 of the initial
volume of 0.8 M Ammonium sulfate, 0.1 M citric acid solution. This was
followed by another wash in half the volume of the same solution, and the final
pellet was resuspended in 1/20 of the initial volume of 0.6 M potassium chloride and washed twice with the same solution. The protoplasts were then washed once with 1/20 of the initial volume of 0.6 M potassium chloride and
50 mM calcium chloride (KCI/CaCl 2) solution, and the pellet was finally washed in 1/100 of the initial volume of the above KCl/CaCh solution. The resulting protoplast solution was distributed, 100 |il/1.5 ml tube, for the subsequent transformation steps. 5 pg of pYA4 was added to each protoplast tube in less than 15 pi volume in TE, and vortexed. This was followed by the addition of 50 pi of PEG solution {25% w/v polyethylene glycol, 4000 MWT
(Sigma), 0.6 M potassium chloride, 50 mM calcium chloride, 10 mM Tris pH 7.5 } with vortexing until thoroughly mixed and incubation in ice water for 25 minutes. One ml of PEG solution was then mixed in each transformation tube and incubated for 30 minutes at room temperature. The protoplast solution was then spread on YAG plates supplemented with 1 M sucrose for osmotic balance, and incubated at 37®C for several days. Transformants were streaked to single colony and analyzed using Southern hybridization.
43 Crossing YAYY2 to KK2.70.7
A. nidulans transfonnant YAYYl and strain KK2.70.7 were streaked to
single colonies on FYG solid medium, and the resulting colonies from these two strains were incubated together on several FYG plates. The plates were wrapped in plastic to create slightly anaerobic conditions that favor the entry
into the sexual life cycle. After two weeks of incubation, large, mature fruiting
bodies or cleistothecia were harvested. Their surfaces were cleaned from
adhering parental conidia, and their ascospores were dispersed in 1 ml aliquots of S/T solution. Cleistothecia from hybrid crosses were identified by the segregation of several conidial color markers when the ascospores were spread on FYG plates.
Minipreparation of A. nidulans genomic DNA
The strains of interest were streaked to single colony on FYG medium and PYRG medium supplemented with uridine, in preparation for conidia collection. Conidia were collected in S/T solution, and germinated in 10 mis of complete medium at a concentration of 2 x 106 spores/ml. Cultures were incubated overnight at 37"C with aeration and gentle shaking. The next day, mycelia were collected on Miracloth (Calbiochem. Inc.), washed with distilled water, and pressed to remove excess water. Mycelia were then transferred to 1.5 ml microcentrifuge tubes, and frozen in an ethanol-dry ice bath. The samples were subsequently lyophilized for 24 hours. The dried mycelia were
44 then ground to a fîne powder with a clean dry spatula in the same microcentrifuge tube. 400 |xi of deoxy-Brij solution (4 mg/ml sodium deoxycholate, 10 mg/ml Brij 58 and 2 M sodium chloride) was added to each sample. The sample was vortexed for one minute, and incubated for 20 minutes at room ten^rature. Samples were centrifuged at 11,600 x g for 2 minutes, and the supernatant was transferred to a fresh tube and mixed with 1200 pi of trichloroacetic acid-ethanol solution (Summerton et a l, 1983). This solution was mixed by inversion 5-6 times, and incubated on ice for 20 minutes before centrifugation at 11,600 x g for 10 minutes. The supernatant was discarded and the nucleic acid pellet was resuspended in 112 pi of RNase A solution (0.4 mg/ml in 0.01 N ammonium acetate, stored at -20°C) and incubated in a 50°C water bath for one and a half hours. The mixture was then centrifuged at 11,600 x g for 15 minutes to pellet unwanted carbohydrates.
The DNA containing supernatant was transferred to a fresh tube and the DNA precipitated with 0.4 volumes of 5 M ammonium acetate and 2 volumes of isopropanol for 10 minutes at room temperature. After centrifugation at 11,600 X g for 15 minutes, the DNA pellet was washed with ice cold 70% ethanol, centrifuged again at 11,600 x g for 15 minutes, and dried under vaccum for 15 minutes. The dry pellet was subsequently resuspended in 50 pi of TE buffer
(10 mM Tris, pH 8.0 and 2 mM EDTA) for 2 hours before storage at -70"C. The relative concentration of the DNA and its high molecular weight quality was determined by running 2.5 pi of each sample on a 0.7% agarose-TBE gel (TBE:
45 5.4 g/l Tris [hydroxymethyl]amino-niethane, 2.7 g/l boric acid and 0.465 g/l EDTA).
Southern Hybridizations
Genomic DNA was digested with restriction enzymes following the methods recommended by the enzymes’ manufacturers (Boehringer Mannheim and New England Biolabs). Approximately 2 |xg of DNA was loaded in 0.7% agarose-TBE gels. After running at 25 volts, the gels were stained with 1 pg/ml ethidium bromide (Sigma), photographed (along with a ruler on the side of the gel) and the DNA in the gels denatured in 500 ml of 50 mM sodium hydroxide at room temperature for 45 minutes with gentle shaking. The gels were then rinsed several times with distilled water and soaked for 30 minutes in 500 ml of distilled water. This was followed by blotting between several pieces of 3 MM chromatography paper (Whatman) and drying the gels in a vacuum dryer for 10 minutes with the heat off, 10 minutes at 80°C, and 10 minutes with the heat off, sequentially. In preparation for hybridization, the gels were floated off the 3 MM paper in distilled water, and sealed in a “seal-a-meal” plastic bag for prehybridization in 10 ml of
BLOTTO (Bovine Lacto Transfer Technique Optimizer, Johnson et a i, 1984)
(300 ml/120X SSC (1753 g/1 sodium chloride, 88.2 g/1 sodium citrate, pH 7.0) and 2.5 g/1 dry milk (Carnation)} for three and a half hours at the appropriate stringency temperature. Hybridization was carried out with 2 x 106 cpm/ml of BLOTTO at 65®C for 18 hours. The next day, nonspecifically bound probe
46 was removed from the gels with two 25 minute washes in 2X SSC, 0.1% SDS at 65"C, and two 25 minute washes in 0.2X SSC, 0.1% SDS at 65**C, followed by radioautography. The washing solutions, 2X SSC, 0.1% SDS and 0.2X SSC, 0.1% SDS were prewarmed overnight in a 65"C waterbath. Probes were radiolabelled to high specific activity using the method described by Feinbetg
& Vogelstein (1983) using random 9-mers. Excess primers and nucleotides were separated from the probe with a Microcon 30 microconcentrator (Amicon, Inc.).
Preparation of the chromatography columns
DEAE-cellulose column preparation: Preswollen DEAE-cellulose resin
(Sigma) was placed in a beaker and initially resuspended with concentrated sodium phosphate buffer, pH 7.8 (0.5 M sodium phosphate, 0.2 M sodium chloride, pH 7.8). The supernatant was decanted after the resin had settled.
This step was repeated three times until the pH of the decanted buffer reached
7.8. Subsequently, the resin was resupended with 20 mM sodium phosphate pH 7.8, and 0.2 M sodium chloride, and this step was also repeated three times to ensure enough dilution of the concentrated buffer used above. The resin was then used to pack a 4.0 cm x 2 J cm column (Bio-Rad).
Nickel-chelated agarose resin column: Ten milliliters of nickel- chelated agarose resin resuspended in 20% ethanol (ProBond resin, Invitrogen
Corp.) was packed into a 2.5 cm diameter column and washed initially with double-distilled water to remove the alcohol, then equilibrated with 20 mM
47 sodium phosphate buffer pH 7.8, supplemented with 0.5 M sodium chloride (recommended by Invitrogen Corp.). Although the manufacturers state that it is possible to recycle the resin up to three times, especially when purifying the
same protein, we found that it was best to use fresh resin for each 6-His tubulin
purification experiment
Sephadex G-25 size exclusion column'. Sephadex G-25 powder
(Sigma) was resuspended in PEM buffer pH 6.9 {100 mM 1,4- Piperazinediethanesulfonic acid (PIPES), 1 mM EGTA, and 1 mM magnesium chloride} for three hours at room temperature or overnight at 4°C in order to
swell the porous beads, which were then packed into a 5 cm x 1 cm column.
More PEM was passed through the column in order to ensure proper equilibration.
Purification of A.nidulans 6-His tubulin
Conidia from strain AYl were inoculated into YG liquid medium at a final concentration of 2 x 106 /ml, and incubated at 37®C for 15 hours.
Harvested mycelia were pressed against clean paper towels to remove excess water, frozen in liquid nitrogen, and stored at -70°C until use. Sixty five to 75 grams of frozen mycelia (wet weight) were disrupted by cryoimpaction (Smucker & Pfister, 1975) each 20 g at a time for 3 minutes and resuspended in 10 mis of DEAE binding/washing buffer per 10 g of mycelial wet weight (DEAE binding/washing buffer 20 mM sodium phosphate and 0.5
M sodium chloride, pH 7.8 containing 1 mM magnesium chloride, 0.1 mM GXP,
48 protease inhibitors {1 mM Phenylmethylsulfonyl fluoride (PMSF) and 5 p ^ n l
leupeptin} and nuclease solution (20 |xg/ml of RNaseA and 10 |ig/ml of DNasel) (after cryoimpaction, each 20g equivalent of extract was resuspended in DEAE binding/washing bufler in separate plastic beakers in order to avoid
refleezing of the already resuspended material). The suspensions were left to
thaw completely at 4**C for ~ 45 minutes, and then combined to spin down the
big cell debris at 3,800 x g for 15 minutes in a precooled JA-14 rotor.
Subsequently, the high-speed supernatant, obtained following a spin at
110,000 X g for 30 minutes in a precooled 60Ti rotor, was loaded onto a DEAE colunm (4.0 cm x 2.5 cm) fleshly pre-equilibrated with DEAE binding/washing
buffer supplemented with 0.1 mM GTP, 0.1 mM PMSF, and 1 mM magnesium
chloride. Non-speciflcally-bound proteins were washed with the same above buffer until no proteins came out (as judged by the Bio-Rad Protein Assay solution diluted 1:4 with water). The 6-His tubulin-containing fraction was eluted from the DEAE column with DEAE elution buffer (20 mM sodium phosphate and 0.35 M sodium chloride, pH 7.8, supplemented with 0.1 mM
GTP, 0.1 mM PMSF, and 1 mM magnesium chloride). The DEAE eluate, 10-15 mis in volume, was made to 0.5 M sodium chloride and loaded onto the nickel- chelated agarose resin column (2.0 cm x 2.5 cm) fleshly equilibrated with nickel binding buffer pH 7.8 (20 mM phosphate, 0.5 M sodium chloride, pH
7.8) containing 0.1 mM GTP, 0.1 mM PMSF, and 1 mM magnesium chloride. Non-specifically bound proteins were washed off with nickel washing buffer
(20 mM sodium phosphate, 0.5 M sodium chloride, pH 6.0) containing 100
49 mM imidazole, 0.1 mM GTP, 0.1 mM PMSF, and 1 mM magnesium chloride,
until no proteins came out The 6-His tubulin was eluted with elution buffer (20 mM sodium phosphate, 500 mM sodium chloride, pH 6.0; recommended by Invitrogen) containing 300 mM imidazole, 0.1 mM GTP, 0.1 mM PMSF, and 1
mM magnesium chloride. The 6-His tubulin fraction was pooled, precipitated with two volumes of PEM saturated with ammonium sulfate (77 g of
ammonium sulfate per 100 mis of PEM), and incubated on ice for 30 minutes.
After centrifugation at 39,2(X) x g in a precooled Beckman JA-20 rotor for 30 minutes, the protein pellet was resuspended in PEM containing 0.1 mM GTP and 0.1 mM PMSF, to a final volume of 300-500 pi and desalted on a
Sephadex G-25 colunm (Sigma) (1.0 cm x 5 cm) freshly equilibrated with PEM
containing 0.1 mM GTP and 0.1 mM PMSF. The 6-His tubulin containing
fractions, 1-2 mis in volume, were eluted with the same buffer.
Temperature-dependent in vitro assembly and disassembly of 6-His tubulin The desalted protein solution (~ 1-2 mis) was cleared by centrifugation
at 110,000 X g for 30 minutes at 4“C in a precooled Beckman 50Ti rotor. The
supernatant was made to 1 mM GTP and incubated at 32**C for 30 minutes in
the presence of 100 pM taxol to allow microtubule assembly. The sangle was then centrifuged in a prewarmed Beckman 70.1Ti rotor at 110,000 x g for 20 minutes at 32®C. The pellet was resuspended in PEM containing 0.1 mM GTP
and 0.1 mM PMSF (one fifth of the initial volume) and incubated on ice for 45 minutes to allow depolymerization of any formed microtubules. Six-His
50 tubulin was recovered in the supernatant of a cold spin in a precooled
Beckman 50Ti rotor at 56,000 x g for 20 minutes at 4**C, and used for a second round of microtubule assembly at 32°C in 1 mM GTP and 100 pM taxol for 20 minutes followed by a warm spin in a prewarmed TLS-S5 table-top ultracentrifuge rotor at 110,000 x g for 16 minutes. The pelleted microtubules were resuspended in PEM containing 0.1 mM GTP and 0.1 mM PMSF (one fifth of the initial volume), and left to disassemble on ice for 45 minutes. Six-
His tubulin was again recovered in the supernatant of a second cold spin in a precooled TLA. 100.2 table-top ultracentrifuge rotor at 56,000 x g for 6 minutes at 4"C, and stored at -70°C. The third cycle was carried out in the same way as the second cycle. At each step, samples were collected for SDS-
PAGE and electron microscopy observations. Protein quantitations were performed following the method of Lowry et aL (1951).
Electron microscopy Samples were taken after each assembly at 32*C, and after disassembly for electron microscopy observations. These samples were fixed with 0.1% glutaraldehyde and deposited on Fonnvar-coated grids (200 mesh. Electron
Microscopy Sciences) for three minutes. After two washes with 10 pi double distilled water each, 10 pi of 2% uranyl acetate were added to the grids for negative staining. These grids were then examined using either a Zeiss 10 or a
Phillips CM12 electron microscope at 80 kV and 60 kV respectively.
51 SDS-polyacrylamide gel electrophoresis and Western blots One fourth volume of 4X sample buffer (0.125 M Tris-HCl, pH 6.8,4%
SDS, 10% 2-p-meicaptoethanol, 20% glycerol, and 0.004% bromophenol blue)
(Laemmli, 1970) was added to the protein solutions and the mixtures were boiled for 10 minutes to denature the proteins. These protein samples were loaded into the wells of a 3.75% stacking gel {125 mM Tris-HCl, 12.5% v/v of
a 30%w/v acrylamide (Serva): 0.8% w/v bis-acrylamide (Serva) solution, 0.1%
w/v SDS, 0.075% w/v ammonium persulfate (Ultrapure, GibcoBRL) and
0.00075% TEMED (N, N, N’, N’-tetramethyethylenediamine, Boehinger Mannheim), loaded onto 5 mis of 10% polyacrylamide resolving gel {375 mM Tris-HCl, 33.4% v/v of 30%w/v acrylamide (Serva), 0.1% w/v SDS, 0.075%
w/v ammonium persulfate (Ultrapure, GibcoBRL) and 0.00075% TEMED}. The gel was run in reservoir buffer (743 mM Tiis base, 1.92 M glycine (Sigma),
and 1.0% w/v SDS, final pH 8.3} at 200 volts. For gel staining, 0.1%
Coomassie blue R250 in waterrmethanol: acetic acid (5:5:2 by volume) was used. The gels were destained for protein visualization with destaining
solution (30% methanol, 10% acetic acid, 60% distilled water).
For Western blotting, proteins were transferred from the gel to a nitrocellulose filter using a PolyBlot apparatus (American Bionetics, Inc.) equipped with MilliBlot electrodes (Millipore). The filter was then blocked with Tris-buffered saline with Tween (TBST: 10 mM Tris-HCl, pH 7.5,150 mM Sodium chloride, and 0.05% Tween-20) containing 5% nonfat dry milk for one hour. The blocked filter was incubated with primary antibody in TBST
52 containing 1% nonfat dry milk, for one hour, and then washed with three
TBST buffer changes for 15 minutes each. This was followed by a one hour incubation with alkaline phosphatase-conjugated secondary antibody diluted in TBST and 1% nonfat dry milk. Before use, the secondary antibody was preadsorbed to A. nidulans acetone powder [prepared by Dr. Kathy Jung following the method described by Harlow & Lane (1988)] for 2 hours to eliminate non-specific reactions of the antibody with A. nidulans proteins.
After three 7-minute washes with TBST, the filter was submerged in alkaline phosphatase buffer (1(X) mM Tris-HCl, pH 9.5,5 mM magnesium chloride, and
100 mM Sodium chloride) containing 3.3 mg/10 ml NBT and 1.65 mg/10 ml BCIP for color development All the incubations and washes were performed at room temperature. The primary antibodies used for this work were DMIA
(Sigma Chem. Co.), a monoclonal anti-a-tubulin antibody, and Tu27B, a monoclonal anti-^-tubulin antibody generously donated by Dr. Lester I. Binder (Molecular Geriatrics Corp.). Alkaline phosphatase conjugated goat anti-mouse IgG (Hyclone) was used as the secondary antibody in all cases.
Two-dimensional gel electrophoresis of tubulin samples
First-dimension gels were prepared following the method recommended by Bio-Rad Laboratories. (Capillary gel tubes were loaded with first dimension gel monomer solution (9.2 M urea, 4% acrylamide/bis solution (30% T/5.4% C) (Serva), 2% Triton X-100 (Sigma), 1.6% Bio-Lyte 5/7 ampholyte (Bio-Rad Laboratories), 0.4% Bio-Lyte 3/10 ampholyte (Bio-Rad Laboratories), 0.01%
53 ammonium persulfate (Ultrapure, GibcoBRL), 0.1% TEMED}. The protein sample was mixed with the first dimension sample buffer (9.5 M urea, 2% Triton X-100,5% P-mercaptoethanol, 1.6% Bio-Lyte 5/7 ampholyte, and 0.4%
Bio-Lyte 3/10 ampholyte) and overlayed with 20-40 p.1 of first dimension sample overlay buffer (9 M urea, 0.8% Bio-Lyte 5/7 ampholyte, 0.2% Bio-Lyte 5/7 ampholyte, 5CX) pi of a 0.05% w/v bromophenol blue stock solution). The first dimension was run with 20 mM sodium hydroxide as the upper chamber buffer, and 10 mM phosphoric acid as the lower chamber buffer, at 500 volts for 10 minutes initially, then at 750 volts for 3.5 hours. The gels from the first dimension were used as samples for the second dimension which was run using standard SDS-polyarylamide-gel electrophoresis.
Results
Construction of an A. nidulans strain expressing a 6-His tagged P tubulin In order to make use of the metal affinity chromatography technique which would theoretically allow the purification of A nidulans tubulin in one step and to high purity, a series of plasmids were initially constructed in order to create a strain expressing a 6-His-tagged P tubulin. First, plasmid pBBAR2 was constructed by subcloning a 5.4 Kb PstI fragment containing the entire benA gene of Aspergillus nidulans (1.778 Kb) in addition to 5’ and 3’ flanking sequences (~ 3.4 Kb of 5’ sequence, and ~ 0.25 Kb of 3’ sequence)
54 into the PstI site of pBluescript KS+. In addition, both the Clal and Hindm sites in the polylinker were abolished, and a novel Hindm site was created at the 3’ end of the henK coding region (in place of the termination codon). This plasmid was constructed by Dr. Yisang Yoon. Subsequently, an oligonucleotide encoding six histidine residues and flanked by Hindm sites
(courtesy of Dr. Tetsuya Horio) was ligated into plasmid pBBAR2 at the newly created Hindm site, and the resulting plasmid was named pRR2. This plasmid was constructed by Rachel Rennard and Dr. Berl Oakley. The 5.4 kB henk.- 6his-containing PstI fragment in plasmid pim2 was digested with PstI and ligated into plasmid pPL6 which was previously constructed by Ms. Patricia
Kretz by ligating the pyrQ gene of A. nidulans from plasmid pJR15 (Oakley et a i, 1987b) into the Ndel site of pUC19. The pyrG gene encodes the enzyme orotidine S’-phosphate decarboxylase which confers uridine prototrophy to a pyrQS9 strain. The resulting plasmid was named pYA4. Diagrams of plasmids pRR2, pPL6 and pYA4 are shown in figure 4.
The benA gene was tagged with the six histidine residues at the C- terminal end of its coding region rather than the N-tenninal end because the C- terminal region is highly divergent among tubulins from various organisms (Little & Seehaus, 1988; Bums 1995). Therefore, an alteration in this region is not likely to affect the function of the protein. In addition, it is thought that the C-tenninal end of P tubulin is exposed at the surface of the protein due to its highly negative, hence polar nature, a fact that would allow for easier purification.
55 Figure 4: The construction of plasmid pYA4.
The pUC-based plasmid pRR2 harboring a 5.4 Kb PstI figm ent containing the benA gene tagged with 6 histidine residues at its C-terminus in addition to the 3’ and 5’ regulatory regions, was digested with PstI to release the 5.4 Kb fragment. In parallel, plasmid pPL6 containing the pyrG gene (encoding the enzyme orotidine-5’-phosphate decarboxylase) at its Ndel site was also digested with PstI located in the polylinker. This digested plasmid was then ligated with the above 5.4 Kb PstI fragment and the resulting plasmid carrying the 6-His tagged benA gene in pPL6 was called pYA4.
56 pyrQ
pRR2 pPL6
MCS MCS
PstI PstI PstI
Hindlll Cut with PstI
6-His 1 pyrG
PstI benA. h- pPL6 5' is** Hindlll MCS
6-His PstI PstI I Ligation pyrG
pYA4
MCS
PstI
Hindlll
6-His
Figure 4.
57 Plasmid pYA4 was transformed into the A. nidulans strain G191 (pyrG89), and transformants were selected for their ability to grow on complete medium lacking uridine due to the complementation of the pyiG89 by the pyrG gene on pYA4. To investigate the site of integration of pYA4, total genomic DNA from six pyrG-*- transformants (YAYY1-YAYY6) were analyzed by Southern hybridization. Total DNA from each of these six transformants was digested with EcoRI and probed with both pRR2
(containing the 6-his-tagged benA. gene) and pPL6 (containing the pyrG gene) separately, in order to check whether homologous recombination occurred at the benA locus or the pyrG locus. Homologous recombination during transformation is known to occur readily in A. nidulans (Oakley et al^
1987). In wild-type strains, the restriction enzyme EcoRI cuts outside of the genomic copy of the benA gene, generating a 19 Kb fragment (Figure 5). In plasmid pYA4, EcoRI cuts once in the polylinker. Control DNA from the parental strain G191 showed a 19 Kb single band as expected. When one copy of the plasmid integrates by homologous recombination into the endogenous benA gene, two copies of the benA gene are present. One of them has a 6-His tag at the C-terminus, the other doesn’t, and the two genes would flank the pyrG gene carried by pYA4 (Figure 5). On a Southern blot,
DNA from these transformants would show two bands of hybridization when cut with EcoRI and probed with pRR2 (Figure 6a). If the EcoRI site of the polylinker is near the C-terminal end of the benA gene (and not near the 5’ end of the gene, since cloning into pPL6 was not directional), the two bands
58 Figure 5: Integration of plasmid pYA4 in the A. nidulans strain 0191.
In A. nidulans, integration of a plasmid into a host strain occurs usually by homologous recombination. In tins case, transformants of pYA4 in 0191 that showed specific integration at the benA locus were chosen. One such transformant, YAYY2, has two copies of the benA gene flanking the pyrG gene. This latter confers to the transformants uridine prototrophy and can thus grow in a medium lacking uridine. The Southern hybridization pattern shows two EcoRI bands, 19.2Kb and 9.5 Kb in length.
59 pYA4^ benA _ 5UTR 3TJTR 6^is Homologous X recombination E E ■ ■■ ■■ * ■ - ■ ■ 1 G191 benA+
1 9 K b
ON o \ Gene duplication ® benA E benA+ E J" ■ ixzxx8s::a«;>J--i ■ ■■CVVWWI» ; ss8;8;;k x x x x > « » » ■ ■ 1 ^ 6-Æ pyrt3 9 .5 Kb * 4 19.2 Kb
Figure 5. Figure 6: Southern hybridization analysis of the pYA4 in G191 transformants in comparison with G191.
(6a) Lanes 1-7 are genomic DNA samples digested with EcoRI. ~ 1 pg digested genomic DNA sample was loaded on the gel: Lane 1, G191; lane 2, YAYYl; lane 3, YAYY2; lane 4. YAYY3; lane 5, YAYY4; lane 6, YAYY5; lane 7, YAYY6. The gels were processed for Southern analysis as described in the Materials and Methods section, and plasmid pRR2 was used as a radioactive probe. The genomic EcoRI fragment flanking the benA gene in G191 is ~ 19 Kb in size (4.1 Kb in the 5’ region, 5.4 Kb encompassing the gene, and 9.5 Kb in the 3’ region). Single integration of pYA4 at the benA locus should give a 4.1 + 5.4 = 9.5 Kb EcoRI fragment, and a 4.3 Kb (size of pPL6) + 5.4 Kb (encompassing the benA gene) + 9.5 Kb = 19.2 Kb EcoRI fragment. This pattern is observed in lanes 2-5 whereas the control DNA lane 1 shows the genomic 19 Kb fragment Lanes 6 and 7 do not show plasmid integration. (6b) Lanes 8-14 are the same above genomic DNA samples digested with EcoRI, but probed with pPL6 to make sure that pYA4 did not integrate at the pyrG locus in the above transformant The genomic EcoRI fragment flanking the pyrG gene is ~3 Kb in size, and this fragment is visualized in the control DNA lane 8. Transformants in lanes 9-12 do not show integration at the pyrG locus as shown by the normal size of the genomic copy of the gene (~ 3Kb), but still show the signal for pYA4 (carrying the pyrG gene) integration at die benA locus (~19 Kb fragment). Transformants in lanes 13 and 14 do not show any plasmid integration but can grow on a medium without uiridine. This suggests that the pyrG gene from pYA4 might have corrected the pyrGS9 mutation in G191 by gene conversion.
61 23 Kb
9.4 Kb
6.6 Kb
4.4 Kb
M 8 9 10 11 12 13 14
23 Kb
9.4 Kb 6.6 Kb
4.4 Kb
2.3 Kb
Figure 6.
62 would be 19.2 and 9.5 Kb in size. In four of six transformants (YAYYl-
YAYY4), these two band sizes were observed and hence the plasmid had
homologously integrated at the benA locus, leading to gene duplication (Figure 6a). DNA from these four positive transformants, also cut with EcoRI
but probed with the pPL6 plasmid carrying the pyrG gene, showed two bands
of hybridization, one corresponding to the integration site and is 19.2 Kb in
size, and the other corresponding to the endogenous pyrG gene (as shown in the control DNA lane) and is ~3 Kb in size (Figure 6b). At the protein level, the parental strain G191 (which has wild-type tubulin genes) expresses the product of the wild-type benA which will bind weakly to metal ions (and will hence elute from metal-chelated columns with lower concentrations of imidazole) and show up as a single band on Western blots (Figure 7a). Strains YAYY1-YAYY4 in which pYA4 integrated at the benA locus would, on the other hand, theoretically express the products of both the wild-type and 6-His-tagged benA, with the former product binding weakly to metal ions and hence eluting at low imidazole concentrations, and the latter product binding tightly to metal ions and eluting at high imidazole concentrations. The 6-His^^nA product will also have a slightly higher molecular weight than the wild-type benA product due to the addition of the six histidine residues (Figure 7b). Initial metal affinity purifrcation experiments of the parental strain G191 and two pYA4 transformants, YAYYl and YAYY2, followed by Western blotting (performed by Dr. Yisang Yoon) revealed the expected results for both G191 and YAYYl (Figure 7a and b). Strain YAYY2,
63 Figure 7: Western analysis of the gradient purification of wild-type and 6-His tubulin from FGSC4, YAYYl and YAYYl
Total proteins from strains FGSC4 (7a, control), YAYYl (7b), and YAYY2 (7c) were loaded on a nickel-chelated agarose resin (Invitrogen), and the wUd ^fpe and 6-His tubulin purified with buffers containing increasing concentrations of imidazole. The samples were run out on PAGE-gels, b lo tti to nitrocellulose membranes, and reacted with the monoclonal anti P-tubuHn antibody Tu27b. Lane 1, total proteins; lane 2, flow through sample at pH 7.8 and 0 mM imidazole; lane 3, sangle washed at pH 6.0 and 0 mM imidazole; lane 4, sample eluted with 50 mM imidazole, pH 6.0; lane 5, sample eluted at 100 rnM imidazole, pH 6.0; lane 6, sample eluted at 150 mM imidazole, pH 6.0; lane 7, sample eluted at 200 mM imidazole, pH 6.0; lane 8, sample eluted at 250 mM imidazole, pH 6.0; lane 8, sample elu t^ at 300 mM imidazole, pH 6.0. In panel 7a, wUd-type tubulin from strain FGSC4 elute at imidazole concentrations between 50 mM and 250 mM. In panel 7b, bands corresponding to both wild-type and 6-His tubulin from strain YAYYl are seen with the latter eluting at imidazole concentrations ranging from 150 mM to 300 mM. In panel 7c, bands corresponding to only 6-His tubulin from strain YAYY2 can be seen, and this protein elutes at imidazole concentrations between 100 mM and 300 mM. In this latter strain, bands corresponding to wild-type tubulin are absent This Western analysis was performed by Dr. Yisang Yoon.
64 FGSC4
YAYYl
& ^ F 9 ^ S S
YAYY2 'lÆ!Sk> s m m
Figure 7.
65 however, seems to have lost the wild-^rpe benA gene product and showed, on a Western blot, only a relatively higher molecular weight band corresponding
to the product of the 6-His-tagged benA gene that eluted at high imidazole concentrations (figure 7c). Since Southern analysis of YAYY2 did not
indicate any gene replacement or multicopy plasmid integration events (usually, as the copy number of the integrated plasmids increases, the hybridization bands should become denser) we concluded that a gene
conversion event may have occurred in YAYY2 whereby the wild-type copy
of the benA gene had acquired six histidine residues. This phenomenon has
been demonstrated in A. nidulans (Dunne & Oakley, 1988). In any case, this
transformant was a good candidate for further purification experiments since only 6-His-tagged benA products will be present in the cells.
Construction of an A. nidulans strain expressing a 6-His tagged p tubulin
and one functional a-tubulin iso ^ e
The next step was to construct a strain that not only has the 6-His- tagged benA, but also a single a-tubulin isotype. The rationale behind this strategy is that 6-His-tagged p tubulin can be purified away from non-tagged P
tubulin present in the cells (such as the product of the tubC gene which is
expressed in low levels in hyphae) using metal-affinity chromatography. In
addition, if these same cells express only one of the two a tubulin isotypes usually present in A. nidulans, then the 6-His tagged p tubulin will dimerize
66 with this a tubulin isotype, and homogeneous tubulin (6-His P, tubX a) can be purified.
In order to construct a strain that expresses both a 6-His-tagged P tubulin and a single a-tubulin isotype, I crossed strain YAYY2 to strain
KK2.70.7. In KK 2.70.7, the tubh gene has been deleted and replaced by the
Neurospora crassa pyr4 gene. In addition, KK 2.70.7 carries pyroAl which is linked to tubB. KK2.70.7 was constructed by Dr. Karen Kirk in Dr. Ron Morris’s lab at Rutgers University.
Ascospores from the cross between strains YAYY2 and KK2.70.7 were plated on FYG medium to recover single colonies for genotypic analysis
(Clutterbuck, 1974). Since the tubB gene and the pyroA gene are linked
(Doshi et al., 1992), conidia carrying the pyroA mutation are likely to carry the tubB deletion. pyroA mutants can be identified by their inability to grow on minimal medium lacking pyrodoxin. By replica plating, segregants from the above cross were tested for their ability to grow on complete medium but not on minimal medium lacking pyrodoxin. Of 25 segregants that were unable to grow in the absence of pyrodoxin, 12 (AY1-AY12) were selected for Southern analysis. Southern analysis was used to identify those pyroAl segregants from the YAYY2 x KK2.70.7 cross that carry the tubB disruption (m^BA) in addition to the 6-His benA. Total DNA from this progeny was digested with
EcoRI and probed with pRR2 in order to identify those segregants that carry
6-His-benA (see previous Southern for hybridization pattern). Additionally,
67 DNA from the same segregants was digested with Hindm and probed with an internal fragment of the tubB gene (generously provided by Dr. Yisang Yo As mentioned previously, segregants carrying 6-tUs-benA should have two hybridization bands 19.2 and 9.5 Kb in size, on Southern blots (Figure 8a). Moreover, since Hindm does not cut within the tubB gene, the absence of any hybridization bands in the rn6B-probed blot indicates the absence of this gene in these segregants (Figure 8b). Eight mbBA, 6-His-benA segregants were identified. Although low amounts of the tubC gene product can be expressed in the hyphae of these above segregants, only the P tubulin encoded by the 6- His benA gene and dimerized to the tubA gene product, will be expected to bind tightly to the nickel-bound resin column. One of these segregants was subsequently used for tubulin purification and was named AYl (6-His benA; pyrA::tubBA; pyrG89; pyroA). Genetic studies of the 6-His tubulin A. nidulans strains It has been postulated that the highly negative C-terminal end of P tubulin is the site of binding of many structural MAPs that stabilize microtubules (Littauer et. al., 1986). These MAPs are also known to be highly positively charged, and the neutralization of the C-terminus negative charge by the positively charged MAPs is believed to confer stability to the bearing microtubules (Mejillano et al., 1992). In addition, deletion of the C-terminal 6 8 Figure 8: Southern analysis of genomic DNA from the segregants of the cross between strains YAYY2 and KK2.70.7. (8a) Lanes 1-13 are genomic DNA samples from different segregants of the above cross digested with EcoRI and probed with pRR2. Lane 1, G191; lane 2, AY6; lane 3, AY7; lane 4, AY8; lane 5, AY9; lane 6, AY2; lane 7, AY3; lane 8, AYIO; lane 9, AYll; lane 10, AY4; lane 11, AYl; lane 12, AY12; lane 13, AY5. Except for the DNA control lane 1, all segregants (lanes 2-13) show the pattern corresponding to the integration of plasmid pYA4 at the benK locus (as shown in figure 6a). (8b) Lanes 14-26 are genomic DNA samples from the same segregants digested with Hindm and probed with a 837 bp BamHI-EcoRI fragment containing a region of the tubB coding sequence. Lane 14, AY6; lanelS, AY7; lane 16, AY8; lane 17, AY9; lane 18, AY2; lane 19, AY3; lane 20, AYIO; lane 21, AY ll; lane 22, AY4; lane 23, AYl; lane 24, AY12; lane 25, AYS; lane 26, G191.The genomic copy of the tubB gene is visualized in the GI91 control lane 26 as a single ~5.5 Kb band. The absence of this band in several segregants indicated that the tubB is indeed deleted. Strain AYl was chosen for 6-His tubulin purification. 69 1 2 3 4 5 6 7 8 9 10 II 12 13 6-UisbenA 14 15 16 17 18 19 20 21 22 23 24 25 26 tubB # Figure 8. 70 end of P tubulin also permits assembly of microtubules in the absence of MAPs and results in stable microtubules (Serrano et al., 1984). This suggests that the absence or the neutralization of the negative charge on P tubulin has a stabilizing effect on microtubules (Mejillano et al., 1992). I was, therefore, interested in investigating the phenotype of YAYY2 which carries only 6-His-tagged copies of the benA. gene, and no wild-type benA. I wanted to determine if the addition of six histidine residues, which are positively charged, would stabilize microtubules, and alter the growth of these strains. Observations of the growth of both YAYYl and YAYY2 as well as the segregants AY1-AY5 on complete medium showed that all these strains grew about as well as a wild-type control at 3TC. These strains also grew as well as wild-type strains at 25"C and 42*C, which suggests that the addition of six histidine residues did not interfere dramatically with the cells’ microtubule dynamics or architecture (Figure 9). Purification of 6-His tubulin from strain AYl Total proteins from 65-75 g (wet weight) of strain AYl were resuspended in DEAE binding/washing buffer (see Materials and Methods for the composition of the buffers mentioned in this section), and loaded onto a DEAE-cellulose column (4.0 cm x 2.0 cm) freshly equilibrated with the same buffer. The column was washed with DEAE binding/washing buffer, and the 6- His tubulin-enriched fraction was eluted with DEAE elution buffer. Initial pilot experiments had shown that most proteins can be washed off the DEAE- 71 Figure 9: Growth of strains AYl-AYS compared to the parental strains YAYY2 and KK2.70.2 and wild-type strains (R153 and FGSC4) at diffament temperatures. Conidia from the strains shown in this frgure were stabbed onto FYG (complete medium) plates with toothpicks. The diagram illustrated below represents the order of the strains on the above plates. The growth of the AYl- AYS, YAYYl, YAYY2, and KK2.70.7 strains seems to be similar to that of wild- type strains (R153 [wA3; pyroA4] and FGSC4 [(Glascow) wild-type]) at all three temperatures tested (25“C, 37®C, and 42®C). 72 25X 37°C 42°C R153 • # • YAYYl AY5 AY3 e • e AY2 AYl AY4 e # YAYY2 KK2.70.7. Figure 9. 73 cellulose column with phosphate buffer containing 0.2 M sodium chloride, and 6-his tubulin can be eluted with the same buffer containing 0.35 M sodium chloride (data not shown). The DEAE eluate was then loaded onto the nickel- chelated agarose resin column, and the column was washed with nickel washing buffer containing 100 mM imidazole. The 6-His tubulin fraction was eluted with nickel elution buffer containing 300 mM imidazole. Following precipitation with PEM saturated with ammonium sulfate and desalting by gel filtration chromtography on a sephadex G-25 column, the 6-His tubulin fraction was used for cycles of microtubule assembly (at 32*’C) and disassembly. Figures 10 and 11 show Coomassie blue stained gels of the purificatioa steps. Quantitation of the purified 6-His tubulin after two cycles of assembly and disassembly yielded 200 pg of protein at - 800 pg/ml. 6-His tubulin assembles into normal microtubules Generally, for information from the x-ray crystallogr^hic determination of the three-dimensional structure of a certain molecule, or any other structural studies to be useful, the starting material must be in a native configuration. The cycling procedure (shown in Figure 2 of Chapter 1) provides a purification of native tubulin away from other proteins and denatured tubulin. Assaying for the correct conformation of tubulin samples during the cycling procedure can be easily achieved by demonstrating their ability to assemble into microtubules in vitro. Figure 12 shows the results of the first cycling of 6-His tubulin. 74 Figure 10: Coomassie blue stained gel of the partial purification of A. nidulans 6-His tubulin on a DEAE-cellulose column. Total cell extract from strain AYl was applied to a DEAE-cellulose column. The column was washed with DEAE binding/washing buffer with 0.2 M NaCl, and the 6-His tubuUn-containing faction was eluted with DEAE elution buffer with 0.35 M NaCl. Lane 1, DEAE column flow through; Lane 2, eluate with 0.2 M NaCl; lane 3, eluate with 0.35 M NaCl. 75 50 Kd Figure 10. 76 Figure 11: Coomassie blue stained gel of the purification of A. nidulans 6-His tubulin on a nickel-chelated agarose column followed by a desalting step on a sephadex G-25 column. The 6-His tubulin-containing eluate from the DEAE-cellulose colunm was applied to a nickel-chelated agarose column. The column was washed with nickel washing buffer with 75 mM imidazole, and the 6-His tubulin fraction was eluted wiA nickel elution buffer with 300 mM imidazole. This eluate was precipitated with 2 volumes of PEM saturated with ammonium sulfate, and desalted on a sephadex G-25 column. This was followed by a cold spin at 110,000 X g in a Beckman 50Ti rotor to pellet denatured tubulin aggregates. Lane 1, nickel-chelated %arose column flow through; lane 2, nickel-chelated agarose column eluate wi& 100 mM imidazole; lane 3, nickel-chelated agarose column eluate with 300 mM imidazole; lane 4, cold spin supematent following desalting. 77 50 Kd Figure 11. 78 Figure 12: Coomassie blue stained gel of samples from the first cycle of assembly and disassembly in the presence of taxol following 6-His tubulin purification. Following the desalting step and the centrifugation step, the 6-His tubulin was subjected to one cycle of assembly and disassembly. Lanes 1 and 2, supernatant and pellet after the first warm spin (desalted and cleared protein solution was incubated at 3TC for 20 minutes in PEM in the presence of ICX) |xM taxol and 1 mM GTP, and centrifuged at 32**C for 20 minutes in a Beckman 70.1Ti rotor at 110,000 x g); lanes 3 and 4, supernatant and pellet after the first cold spin (the protein peUet from the above warm spin was resuspended in PEM plus 0.1 mM GTP, and incubated on ice for 45 minutes, and centrifuged at 4**C for 20 minutes in a Beckman 50Ti rotor at 56,0(X) x g). 79 1st Cycle 32°C 4“C Figure 12. 8 0 Following purification, the 6-His tubulin-containing sample was incubated at 32**C in the presence of taxol and GTP. Observations of the samples under electron microscopy revealed that the polymerized products were coiled protofilamentous structures and short microtubules (data not shown). These products were pelleted by centrifugation. The pellet was disassembled in the cold and centrifuged to remove disassembly incompetent aggregates. The supernatant was then warmed to assemble microtubules. When examined with the electron microscope, this second cycle assembly sample contained intact microtubules (Figures 13). In addition, as described by Yoon & Oakley (1995) for wild-type A. nidulans tubulin, in the absence of taxol, the 6-His tubulin did not assemble into normal microtubules, instead it polymerized into coiled protofilaments only (data not shown). The fact that 6- His tubulin was able to assemble into normal microtubules after a second assembly in the presence of taxol demonstrated that neither the addition of a 6- His tag nor the purification procedure prevented the assembly of microtubules in vitro. Following one cycle of assembly and disassembly, the 6-His tubulin supematent was stored at -80°C. Frozen samples from four purification experiments were combined and subjected to two additional cycles of assembly and disassembly following a cold spin to remove non-assembly competent tubulin aggregates (Figure 14). In the third cycle, we can see enrichment in the microtubule pellet and the tubulin supernatant samples, which indicates that these samples are enriched in native tubulin. 81 Figure 13: Negatively stained microtubules assembled in the presence of taxol. Six-His tubulin, purified through one cycle of assembly and disassembly, was assembled into microtubules in the presence of taxol. a. Magnification: x 11,500. Inset in panel a is magnified in panel b. b. Magnification: x 53,000. 82 Æ Figure 13. 83 Figure 14: Further purification of A. nidulans 6-His tubulin by cyclic assembly and disassembly in the presence of taxol. Following the first cycle of assembly and disassembly, the cold tubulin supernatant from four purification experiments were combined and subjected to two more cycles of assembly and disassembly . Lanes 1 and 2, supernatant and pellet after the second warm spin (the protein solution was incubated at 32"C for 20 minutes in PEM in the presence of 100 )xM taxol and 1 mM GTP, and centrifuged at 32"C for 16 minutes in a Beckman TLS-S5 rotor at 110,(XX) X g); lanes 3 and 4, supernatant and pellet after the second cold spin (the protein pellet from the above warm spin was resuspended in PEM plus 0.1 mM GTP, and incubated on ice for 45 minutes, and centrifuged at 4°C for 6 minutes in a Beckman TLA1(X).2 rotor at 56,(XK) x g); lanes 5 and 6, supernatant and pellet after 3rd warm spin (conditions for incubation and centrifugation were the same as the above 2nd cycle); lanes 7 and 8, supernatant and pellet after 3rd cold spin (conditions for incubation and centrifugation were the same as the above 2nd cycle). 84 2nd Cycle r 3rd Cycle 32°C 4°C 32°C 4°C 50 Kd 50 Kd #### Figure 14. 85 Isotypical purity of the purified 6-His tubulin Two-dimensional gel electrophoresis of the tubulin species present in wild-type A. nididans extracts reveals the presence of three a tubulin spots (designated a l , a2, and o3) and two p tubulin spots (designated p i and P2). A third species of P tubulin (P3) is present but is occluded by the other P tubulins (Weatherbee & Morris, 1984). Analysis of these tubulin species from wild-type and mutant A. nidulans strains demonstrated that the al-tubulin and a3-tubulin spots are the products of the tubK gene (Morris et al., 1979), whereas a2-tubulin is encoded by the tubB gene (Weatherbee & Morris, 1984). Similarly, the pi-tubulin and p2-tubulin spots are products of the benA gene (Sheir-Neiss etal., 1978), whUe P3-tubulin is encoded by the tubC gene. P3-tubulin was detected on two-dimensional gels when tubulin species were isoelectrically focused from a benA mutant strain in which the benA species were shifted (Weatherbee & Morris, 1984; Weatherbee etal., 1985). I wished to examine the composition and homogeneity of the eluted 6- His tagged tubulin from strain AYl, by isoelectric focusing using two- dimensional gel electrophoresis and used partially purified wild-type A. nidulans tubulin as a control (generously provided by Dr. Yisang Yoon). Western blotting of the second dimension gels using the monoclonal anti a- tubulin (Sigma T-9026) and anti P-tubulin antibodies (kindly provided by Dr. Lester Binder) showed, in the case of the wild-type tubulin sample, three a tubulins corresponding to the two products of the tub A gene (a l and oc3) and the product of the tubB gene (a2), and two P tubulins correponding to the 86 products of the benA gene (Pl and ^2). As mentioned above, a third species of P tubulin (P3), encoded by the tubC gene, is also present, but is known to be occluded by the other P tubulins present (Weatherbee & Morris, 1984) (Figure 15a). Separation of the 6-His tagged tubulin from strain AYl on the second dimension gel showed the two a tubulins known to be encoded by the tubA gene. The a tubulin encoded by the tubB gene was absent as expected. The two major benA products were shifted towards the basic side of the gel due to the addition of six histidine residues. Since this shift should in principle reveal the tubC gene product, the total absence of a signal at this position indicated, as expected, that detectable quantities of the tubC gene product did not elute with the 6-His tagged tubulin (Figure 15b). Finally, in order to prove that the tubB gene product is absent and is not merely occluded by the shift of the benA gene products at this position, we isoelectrically focused another AYl purified protein sample and probed it with anti-a-tubulin antibody alone. Results from this experiment indicated that the two tubA gene products were the only a tubulins present consistent with the Southern analysis of the tubB deletion (Figure 15c). These series of experiments indicated that the partially purified 6-His tagged tubulin from strain YA2 is composed of the products of the tubA and benA genes only, and is thus isotypically pure with respect to the tubulin gene composition. 87 Figure IS: Isoelectric focusing of wild-^rpe and 6-His tubulin. (14a) A partially purified wild-type tubulin sample provided by Dr. Yisang Yoon was isoelectrically focused, run on a PAGE-gel, blotted on a nitrocellulose membrane and reacted with both an ti-a- and P-tubulin monoclonal antibodies (DMIA and Tu27b). The left-most spot (on the basic side of the gel) corresponds to the product of the gene. The midcUe spot corresponds to the two products of the tubA. gene. The right most spot (on the acidic side of the gel) corresponds to the two products of the benA gene. Under these conditions, the spot for the product of the tubC gene is known to be occluded under the product of the benA gene. (14b) A partially purged 6-His tubulin sample from strain AYl was also isoelectrically focused, run on a PAGE-gel, blotted on a nitrocellulose membrane and reacted with both anti-a- and p-tubulin monoclonal antibodies (DMIA and Tu27b). The left most spot corresponds to the products of the benA gene which had shifted to the basic side of the gel due to the addition of six histidine residues. This shift allows us to notice the absence of the tubC gene product The middle spot corresponds to the products of the tubA gene. (14c) A partially purified 6-His tubulin sample fi'om strain AYl was isoelectrically focused, run on a PAGE-gel, blotted on a nitrocellulose membrane, but this time reacted with only an anti-a-tubulin monoclonal antibodies (DMIA). The deletion of the tubB gene is indicated by the absence of a signal on the basic side of the tubA gene products. 88 Basic Acidic W.T. k • : ttd>A ap benA fn 6-His Kf-k- ' - À-: tubA : « i : a 6-His tubR tubA Figure 15. 89 Discussion In this study, we have combined advances in tubulin genetics and biochemistry in A. nidulans, in order to address the issue of tubulin heterogeneity. As mentioned above, tubulin is expressed as a variety of isotypes in single cells, and this property has hindered the elucidation of the structural aspect of tubulin biology, and the understanding of the functional significance of the expression of multiple tubulin isotypes. To begin to address this problem, we were able to construct a strain carrying a 6-His tagged P tubulin and one a-tubulin isotype, and purify assembly-competent and isotypically pure tubulin from this strain. The previously published method for purifying tubulin from A nidulans had necessitated the overexpression of the two major tubulin genes benA and tubA, with the ale A inducible promoter (Waring et al., 1989) in order to recover sufficient amounts of tubulin for microtubule assembly, or increase the ratio of tubulin over assembly inhibitors (Yoon & Oakley, 1995). Although this method has yielded milligram quantities of tubulin from 4 liters of culture, the procedure involved shifting the growing culture from complete media to inducing minimal media containing methyl ethyl ketone. This procedure is not convenient for the growth of large quantities of liquid A. nidulans cultures and is not optimal for hyphal growth. We have attempted to improve this procedure by tagging the P-tubulin with six histidine residues to allow purification on a metal-chelated resin. We hoped that this would eliminate the 90 need for special expression systems and facilitate purification. In combination with the tubB deletion, we hoped to be able to obtain assembly-competent and iso^ically-pure tubulin. Initial attempts at purifying 6-His tubulin from strain AYl using the metal-chelated agarose column (Invitrogen Corp.) alone showed that many other proteins coeluted with 6-His tubulin from the nickel-chelated agarose column at high imidazole concentrations (data not shown). In these experiments, although the 6-His tubulin was able to assemble into normal microtubules after a second cycle of assembly and disassembly, microtubule formation was quite variable among different preparations. This phenomenon could be explained either by the presence of assembly inhibitors copuiifying with the 6-His tubulin, or by the dénaturation of the majority of the tubulin molecules during the purification procedure. We have therefore initially attempted to address the dénaturation possibili^, and made sure that all solutions contained GTP and magnesium ions which are thought to be necessary for tubulin to remain in a native configuration (Weisenberg et al., 1968), and protease inhibitors. In addition, all the steps were performed at 4**C to prevent both dénaturation and proteolysis. Subsequently, we decided to include a DEAE-purification step prior to the metal affinity step. Since DEAE-cellulose is an anion exchanger, it will bind the negatively charged proteins and titrate off the majority of those proteins that are positively charged. Therefore, the inclusion of the DEAE 91 purification step would not only allow for tubulin enrichment, but would also get rid of possible positively charged assembly inhibitors that would normally bind to the negatively charged tubulin and prevent microtubule assembly. As discussed in the Results section, this procedure gave reliable results, and allowed us to obtain not only homogeneous tubulin, but also a pure preparation of this protein. An interesting and encouraging observation made in this study is the fact that the addition of the six histidine residues to the negatively charged C- teiminus of P tubulin did not interfere dramatically with tubulin fimction. This was significant not only with respect to our ability to purify tubulin using affini^ chromatography, but also from a biological point of view. Since the highly polar C-terminus of P tubulin is postulated to bind positively charged MAPs and those latter stabilize microtubules, it has been inferred that in mammalian systems, this region of the dimer contributes to the microtubule disassembly process. We, hence, thought that the six histidine residues might act in a manner analogous to MAPs and stabilize microtubules. If true, the addition of the six histidine residues would dramatically influence, among others perhaps, the ability of the mitotic spindle to disassemble which would lead to a mitotic arrest This phenotype, however, was not observed, and the strains carrying 6-His tubulin grew normally at all temperatures tested. Strains carrying the 6-His-tagged benA gene also showed a near wild-type growth in the presence of the antimicrotubule drug benomyl albeit a slight growth disadvantage (data not shown). This can be explained in several ways, the 92 most simple of which is that six histidine residues is too small of a peptide to make an effect on the tubulin dimer and hence on microtubule dynamics. On the other hand, it might be that the mechanisms of microtubule stabilization and disassembly are different in A. nidulans than in other systems. In conclusion, the development of the protocol described in this chapter for the purification of isotypically pure tubulin from A. nidulans, may allow the continuous production of tubulin from this organism. Although single tubulin preparation experiments do not yield enough protein for subsequent cycling, many such preparations can be frozen and stored (experiments have shown that thawing does not totally abolish activity). These samples can then be combined, subjected to several cycles of assembly and disassembly until aU the tubulin in the sample is native and pure, and then theoretically be used for structural studies such as electron and x-ray crystallography and for the elucidation of the functional significance of these multiple tubulin isotypes. These studies will undoubtedly allow a better understanding of the structure and function of microtubules. 93 CHAPTER 3 INVESTIGATION OF THE TUBULIN GENES OF THE THERMOPHILIC ALGA CYANIDIUM CALDARIUM Introduction Tubulins from conventional sources are highly labile. The instability of tubulin was fîrst noticed by Boiisy & Taylor (1967) when they observed that the binding activity of tubulin for colchicine was labile, and decreased after a short incubation time at 37"C. Weisenberg et al. (1968) subsequently determined that tubulin has a strong tendency to aggregate, a state correlated with protein dénaturation. The T m of this protein, measured by its binding to colchicine in the absence of GTP (pH 6.5,0“C), was found to be eleven hours. This instability is highly influenced by temperature, and the protein is stable only over a narrow pH range. Activity was approximately twice as stable at 0“C as at 37°C, and higher temperatures rapidly destroyed activity. Warming a brain extract containing tubulin to 58°C for 90 seconds at pH 6.8 resulted in 15% loss of colchicine-binding activity (Wilson, 1970). Stable tubulin would be valuable not only for attempts at crystallization but also for many other biochemical and biophysical studies. Several reagents and buffers have been tested in attempts to increase the T 1/2 of tubulin in 94 solution. These reagents were subsequently shown to act on tubulin either by decreasing the solvent contact with the protein, and thus increasing native protein-protein interactions, or perhaps, by maintaining a tubulin conformation that would induce assembly, or by locking the dimer in a native configuration. Examples of the fîrst case were investigated by Timasheff and coworkers who attempted to elucidate the effects of monosodium glutamate, sucrose, glycerol, DMSO, and ammonium sulfate on the stabilization of tubulin and the promotion of microtubule formation. The results indicated that the protein shows a large preferential hydration in the presence of these reagents, and that this stabilization effect is due to the large unfavorable free energy of interaction between these additives and tubulin, which leads to tubulin self-association. This entropically unfavorable solvent distribution around the protein is thought to be the factor that imparts to these compounds their thermodynamic protein stabilizing and salting-out properties (Arakawa & Timasheff, 1984). These reagents not only stabilize tubulin, but also promote microtubule assembly (Arakawa & Timasheff, 1984; Frigon & Lee, 1972; Lee et al., 1975; Algaier & Himes, 1988; Robinson & Engelborghs, 1982). In addition, they were shown not to induce any significant conformational changes, and to leave the secondary structure of the tubulin protein intact, as measured by far- UV circular dichroism (Lee et al., 1975). In the second case, the addition of antimitotic drugs, such as colchicine, nocodazole and vinblastine, was also shown to stabilize tubulin in vitro and to increase its T 1/2, presumably by protecting it against the loss of GTP-binding 95 activity (Borisy & Taylor, 1967 a, b; Weisenberg et al. 1968). Similar stabilizing effects were also observed with the addition of GTP and magnesium ions. Weisenberg et al. (1968) observed that the inclusion of 10-3 M GTP and 10-2 M magnesium chloride in all solutions used in their tubulin purification procedures largely prevented the loss of colchicine-binding activity during preparation of the protein. These stabilizing agents have proven to be extremely useful in allowing various biochemical studies of tubulin, especially in enabling researchers to store tubulin at freezing temperatures without loss of activi^. Their use for the growth of tubulin crystals is, however, limited, due to the fact that most of these additives might not be conducive to crystal formation (except for ammonium sulfate). In addition, in the presence of these compounds, tubulin might undergo a conformational change that might not be informative as to its role in vivo or might provide some information about certain tubulin conformation and not others. The process of crystallization, therefore, requires an intrinsic stability of the protein over time and wide ranges of temperatures and pH. In Chapter 2, I have described the expression and purification of isotypically pure tubulin from A. nidulans. As mentioned previously, A nidulans survives in temperatures up to 45°C which suggest that its tubulin may be more heat stable than mammalian tubulin. However, in case A nidulans tubulin proves not to be stable enough for structural studies, we decided to use a thermophilic organism as a tubulin source. One potential 96 source of heat- and pH-stable tubulin is the thermophilic, acidophilic red alga Cyanidium caldarium. Thermophilic organisms that grow at temperatures from 5QPC to 6(yC have been known for several decades (reviewed by Brock, 1967) and it has been proposed that the survival of such thermophiles is mostly due to an inherent stability of their macromolecules, in particular their cellular proteins (Singleton & Amelunxen, 1973). This suggests that thermophilic organisms are a good source of heat-stable proteins. Nuclear magnetic resonance and crystallographic analyses of thermophilic proteins indicated that the thermal stability of these proteins is not due to gross structural differences compared to their mesophilic analogs. Instead, it appears to be the result of subtle modifications of the secondary structure on the surface of the protein, in addition to a decrease in the surface area to volume ratio. C. caldarium is a thermophilic, acidophilic red alga. It is found only in acid thermal habitats and grows optimally at pH 2-3 and at temperatures between 55®C and 60®C (Doemel & Brock, 1970). It apparently undergoes asexual reproduction only, and its multiplication occurs by endospore formation. Four daughter cells appear within the mother cell, and are released after the mother cell wall ruptures (Seckback et al., 1981). Like all other red algae, it has no flagella, undergoes the normal stages of mitosis, and appears to have a spindle that develops totally within the nuclear envelope (Scott & Broadwater, 1990). 97 A variety of proteins, mostly those involved in the photosynthetic pathway in C caldarium, have been purified and found to be more heat stable than their counterparts in mesophilic algae (Rigano & Violante, 1972; Ford, 1979). In addition. Bums (1990) has shown that tubulin from C. caldarium remains native when incubated at SO*C for 30 minutes while mammalian brain tubulin denatures at this temperature with a half-life of ~8 minutes. This suggests that tubulin from this organism is heat stable even in a cell-free system. We have, therefore, chosen to investigate the tubulin genes from C. caldarium with the eventual goal of expressing these genes in heterologous systems. Prior to this project. Dr. Roy Bums and Liz Oakley used PCR to amplify intemal fragments of one a-tubulin, four p-tubulin and one y-tubulin gene from C. caldarium. 1 have isolated genomic DNA from C. caldarium cells and have sequenced intemal fragments of genes encoding one a-tubulin, four P-tubulin and one y-tubulin gene. I have also constmcted a C. caldarium genomic library and have cloned and restriction mapped the full-length copies of the four P-tubulin genes and one of the existing y-tubulin genes. In addition, I have sequenced one p-tubulin gene (pi) and the y-tubulin gene on both strands and have analyzed their sequence in relation to their homologs in a variety of other organisms. I have also examined the total number of tubulin genes in C. caldarium by low stringency Southern hybridization and investigated the genomic arrangement of the four P-tubulin genes. The results suggest that the P-tubulin genes might be clustered. 98 Materials and Methods Isolation ofcaldarium C. genomic DNA Frozen Cyanidium caldarium Geitler cells were obtained from Dr. Roy Bums (Imperial College). The cells were disrupted by cryo-impaction (Smucker & Pfister, 1975), and the frozen powder was resuspended in lysis buffer (4 mg/ml sodium deoxycholate, 10 mg/ml Brij 58,2 M NaCl), vortexed for one minute, left at room temperature for 20 minutes and centrifuged for 2 minutes at 3000 rpm. The supernatant was decanted into 4 volumes of 4.5 M sodium trichloroacetate-ethanol solution (Summerton et al. 1983) and placed on ice for 30 min. Precipitated DNA was pelleted by centrifugation at 10,000 rpm for 10 min and resuspended in 3 mis of RNaseA solution (0.4 mg/ml in 0.01 N ammonium acetate, stored at -20"C). After incubation at 50®C for 1 hour, total DNA was purified by two rounds of cesium chloride-ethidium bromide gradient centrifugation following the method described in Sambrook et al (1989). Cloning of the caldariumC. internal tubulin fragments C. caldarium intemal tubulin fragments were obtained by PCR using fully degenerate primers encoding peptides corresponding to conserved regions of a, P -, and y-tubulins (done by Dr. Roy Bums and Liz Oakley). 99 Following minipreparation of the insert-containing M13mpl9 DNA (Sambrook et al. 1989), Liz Oakley and I sequenced these clones using Sequenase 2.0 (U.S. BiocheoL Inc.). M13mpl9 DNA (5 pi of DNA in a 30 pi volume) was mixed with 0.5 pmoles universal sequencing primer and IX sequencing buffer and incubated to 65"C for 2 minutes. The mixture was cooled to 3S°C for 35 minutes, and sequenced following the protocol recommended by U.S. Biochem. Inc.. Construction of a C. caldarium genomic library A total of 210 pg of C. caldarium genomic DNA was partially digested with Sau3AI (New England Biolabs). Partial digestion was achieved by digesting 30 pg aliquots of DNA with 10.5 units of Sau3AI, in a 200 pi volume, and incubating each of these aliquots at 37*’C for 8, 12,16,24, 32,48, and 64 minutes. After running a diagnostic agarose-TBE {0.089 M Tris-base (Boehringer Mannheim Corporation), 0.088 M Boric Acid (Ohio State stores), 0.0034 M Na2 EDTA (GPS Chemicals)} gel with 0.5 pg DNA from each digestion time, the 8, 12, 16, and 24 minutes digestion times were chosen for sucrose density fractionation. Three additional aliquots of 30 pg of DNA were digested with the same enzyme for 8, 12, and 16 minutes and combined with the above samples. The Sau3AI restriction enzyme was subsequently removed by phenol extraction (1:1 volume) in the presence of 50 mM EDTA. Ultraclear Polyallomer tubes (14 x 89 nun) (Beckman, Inc.) were loaded with 10-40% a sucrose density gradient (10-40% sucrose in 1 M sodium 1 0 0 chloride, 20 mM Tris pH 8.0, and 5 mM EDTA pH 8.0) using a gradient- forming device (kindly provided by Dr. Neil Baker, department of Microbiology, The Ohio State University), and the combined Sau3AI partial digests were loaded onto three of the above tubes. The samples were centrifuged in a swinging-bucket rotor SW41 at 30,000 rpm, at 15*’C for 22 hours. DNA fractions (0.5 ml each) were collected from each tube, and precipitated with 2 volumes of 95% ethanol in the presence of glycogen (30 |xg) for 15 hours at -20°C. The next day, the precipitated DNA was centrifuged at 13,000 rpm for 15 minutes, washed with 70% ethanol, recentrifuged at 13,000 rpm for 15 minutes, and thoroughly dried using a vaccum dryer. The 24 DNA fractions from one gradient tube were subsequently resuspended in 10 pi of TE solution (10 mM Tris, pH 8.0, and 2 mM EDTA) and stored at 4**C. A microliter sample from each fraction was loaded onto an agarose-TBE gel to evaluate the size fractionation of the DNA. In order to be able to ligate this. I selected Sau3AI-cut DNA fragments between the sizes of 9 and 23 Kb (fractions #9 and #10). These fractions were quantitated for their amount of DNA, and ligated to BamHI-cut arms of a A.GEM vector (Promega). Three different amounts of the size-fractionated DNA (0.1 p g, 0.3 pg, and 0.6 pg of DNA, separately) were ligated into BamHI-digested XGEM anns (0.5 Pg and 1 pg of vector) (Promega) at 16®C for 15 hours, and packaged for two hours (Packagene™ system, Promega). In order to calculate the titer of the library, several dilutions of the packaging mixes, in a 1(X) p i volume, were plated with 100 pi of E. coli strain LE392 (F‘, hsdR574, (rg,m*^), siqÆ M, 101 supFSS, /ûcYl, or A(laclZY)6, galKl, gaTTZl, tfpR55; Murray, 1977) grown to an OD described in Sambrook et al., 1989) using infected E. coli strain KW251 (F, supE44, galK2, galT22, metBl, hsdR2, mcrBl, mcrA, [orgASlrTnlO], rgcD1014) grown to an OD^oo of 0.6 in LB medium, collected into SM buffer (0.1 M NaCl, 8 mM MgS 0 4 .7H20, and 0.01% weight/volume gelatin) with few drops of chloroform, and stored at 4°C, and also as frozen stocks in the presence of 7% DMSO (Sigma). Preparation of probes for hybridizations The longest PCR-generated fragments for each of the a -, P- and y- tubulin genes were used to probe the library, and were labeled using radioactive PCR. First round (30 cycles) PCR reactions, 100 |a1 each, were carried out with 5 |il of minipreped M13-containing tubulin intemal fragments, 10 pmoles of universal primers, 1.25 mM each of dATP, dCTTP, dGTP and dTTP, and 2.5 units of AmpliTaq DNA polymerase (Perkin Elmer Cetus) in IX PCR buffer (10 mM tris pH 8.3, 50 mM KCl, 1.5 mM MgCh, and 0.01% weight/volume gelatin). Ten percent of the rirst round products were used as templates for radioactive, 25 cycle second round PCR amplifications using 0.3 p.M of [a-^^P]dATP, 1.25 mM each of dCTTP, dGTP and dTTP, and universal primer. In all reactions, the mixture was overlayed with 50 pi of mineral oil and 1 0 2 subjected to 30 or 25 cycles of amplification (1 minute at 94°C, and 3 minutes at 50°C). Excess primers and nucleotides were separated from the probe with a Microcon 30 microconcentrator (Amicon, Inc.). A diagnostic agarose-TBE gel was run for each probe in order to check for radiolabeling of a fragment of the expected size. Library screening The first round of screening was carried out by plating 2x10^ pfu per plate on strain KW251 grown to an ODgoo of 0.6, on LEA plates (15 g of Bacto-agar per liter of LB medium, pH 7.5). The resulting plaques were transferred to 4 nitrocellulose filters (Schleicher & Schuell), denatured by laying each filter, plaque side up, on one sheet of 3 MM paper soaked with 0.5 M NaOH, 1.5 M NaCl for 5 min, and neutralized on 3 MM paper soaked with 3 M NaCl, 0.5 M Tris-HCl pH 7.0 for 10 min. Plaque DNA was subsequently cross-linked to the filters using UV Stratalinker 1800 (Stratagene). These filters were then prehybridized in BLOTTO (Bovine Lacto Transfer Technique Optimizer, Johnson et al., 1984) (300 ml/120X SSC (175.3 g/1 sodium chloride, 88.2 g/1 sodium citrate, pH 7.0) and 2.5 g/1 dry milk (Carnation)} for 4 hours and hybridized to the ^V-labelled-PCR-generated probes at 2x10^ cpm/ml of BLOTTO for 12-18 hours. Four filters were lifted from each plate. Each filter was probed with two probes in the following combinations: y and jJl, y and P2, P2 and ^3, and pi and ^3. The double probing reduced the number of plates, filters and amount of probe required. The ^4-tubulin gene was cloned 103 separately. Both prehybridization and hybridization were carried out at 65°C. Nonspecifîcally bound probe was removed by washing the filters twice with 2X SSC (0.6 M NaCl, 34 mM sodium citrate, pH 7.0), 0.1% SDS fw 25 minutes each, followed by two washes with 0.2X SSC (0.06 M NaCl, 0.34 mM sodium citrate, pH 7.0), 0.1% SDS for 25 minutes each. The washing solutions, 2X SSC, 0.1% SDS and 0.2X SSC, 0.1% SDS were prewarmed overnight in a 65°C waterbath. Positive clones identified for each of the tubulin genes were further purified through repeated rounds of dilution, plating and hybridization. DNA was purified from each positive clone using the infection at high multiplicity method described by Sambrook et al. (1989), and restriction mapped using several restriction enzymes. The pi-tubulin and the y-tubulin containing fragments were identified by Southern analysis, subcloned into pBluescript KS+ and pUClS respectively, and sequenced completely on both strands by primer walking using Sequenase 2.0 (U.S. Biochem. Inc.) following the protocol described by U.S. Biochem. Inc.. Sequencing primers, specific to each of the two genes, were ordered from Operon Technologies. Sequence analysis PileUp program from the GCG (Genetics Computer Group) Wisconsin Sequence Analysis Package was used for the alignment of the C. caldarium pi-tubulin and y-tubulin genes (separately) to those from other organisms. The sequences used for this alignment were obtained from GenBank. 104 Southern Hybridizations Genomic DNA was digested with restriction enzymes following the methods recommended by the enzymes’ manufacturers (Boehringer Mannheim and New England Biolabs). Approximately 2 |xg of DNA was loaded per lane of 20 ml 0.7% agarose-TBE gels. The procedure for Southern hybridizations is described in Chapter 2. Probes for Southern analysis to identify the tubulin fragments within the positive phage clones, were prepared using the tubulin intemal fragments generated originally by PCR as described above. Low stringency Southern hybridizations were performed at 55"C and 60°C following the same method described above, except that the gels were washed three times for 10 minutes each, with 2X SSC and 0.1% SDS following hybridizations. The 2X SSC, 0.1% SDS solution was prewarmed overnight in a 55®C or 60“C waterbath. The probes were prepared by amplifying, separately, the 5’ half and the 3’ halves of each of the C. caldarium a-, P-, and y-tubulin genes using synthetic primers (Operon Technologies, Inc.) specific for each of the C. caldarium a-,p -, and y-tubulin genes (Table 1), in PCR reactions run under the conditions described above. Screening for C. caldarium P-tubulin clustering The first round of screening was carried out by plating 2x10^* pfu per plate on strain KW251 and the DNA transferred to four nitrocellulose filters for each plate using the same procedures described above. Each of the four filters 105 Primer Nucleotide sequence Tubulin gene Orientation/ Position NREVl ataaggcacgttgtcccgttactg a tubulin Sense/5’ half NLIB3 atctgtgtgctccagcagagaatg a tubulin Antisense/5’ half NREV4 tgctggagcacacagatgtcgatg a tubulin Sense/3* half CREVl aaaatccttagcgtccagttgtcc a tubulin Antisense/3* half CBETAF3 agcagtcgctgttac pi tubulin Sense/5’ half CBETAR2 atgttataaagagcc p i tubulin Antisense/5’ half o CBETAF2 tcacaatactttgaa pi tubulin Sense/3’ half ON CBETAR4 attcctctccatcac pi tubulin Antisense/3’ half CGAMMAFl gcaattgggacacga 7 tubulin Sense/5’ half CGAMMARl ggtctactgcaatcc 7 tubulin Antisense/5’ half CGAMMAF2 tgactgtgttgtggt 7 tubulin Sense/3’ half CGAMMAR4 acgcgaattgtcgaa 7 tubulin Antisense/3’ half Table 1: Primers used in probe preparation for low stringency Southern hybridizations. was hybridized to 2 different P-tubulin-labeled PCR clones (corresponding to Pl, P2, ps, and P4 tubulin clones identified originally by PCR). Any common signal between 3 filters was attributed to two P-tubulin genes present on the same phage clone and was selected for further purification by several rounds of screening and amplification following the protocol described in Sambrook e ta l (1989). Results Identification of one a-tubulin, four P-tubulin, and one y-tubulin genes firom C. caldarium by PCR In order to identify the tubulin genes of C. caldarium. Dr. Roy Bums and Liz Oakley used a strategy whereby primers, corresponding to conserved regions in the three tubulin superfamily members, were designed and used for PCR on total C caldarium DNA. The combinations of primers used in the PCR reactions and the results obtained are shown in Table 2. Sequencing the PCR products revealed the presence of one a-tubulin, four P-tubulin, and one y-tubuIin intemal gene fragments in C. caldarium. The amplification of the second P-tubulin internal fragment (P2) using the CLEGH primer was, however, somewhat surprising since CLEGH was designed to search for a- tubulin and y-tubulin genes and is not totally conserved in P-tubulin genes. All the P-tubulin intemal fragments identified in this search differed firom each 107 Primer combination Tubulin gene predicted Tubulin gene amplified firom to be amplified C. caldarium N-EFQTNL-C and N-FVHYWY-C a tubulin a tubulin N-QAGQCG-C and N-GGTGSG-C P and y tubulins pi tubulin N-GAGNNW-C and N-GGTGSG-C P and y tubulins p2, P3, and P4 tubulins N-CLEGH-C and N-GAGNNW-C y tubulin P2 tubulin N-CLEGH-C and N-GGTGSG-C a and y tubulins P2 tubulin o N-KDVFFY-C and N-GAGNNW-C y tubulin Y tubulin oo N-KDVFFY-C and N-GGTGSG-C Y tubulin Y tubulin Table 2: Primer combinations used to amplify the C. caldarium tubulin genes. other mostly at the wobble position, leaving the encoded amino acid conserved in most cases. Construction of acaldarium C. genomic library In order to clone and sequence the full-length copy of the tubulin genes identified in C. caldarium by PCR, I constmcted a phage genomic library from this organism (Figure 16). At the time of the constmction of this library, the C. caldarium genome size was not known, so we didn't know the number of inserts required to represent the whole genome. We obtained more than 2 x 10^ plaques with inserts, however, enough to give a library representative of a genome as big as the human genome. A year later, it was established that C. caldarium has one *7 of the smallest genomes among eukaryotic cells (~ 1.3 x 10 nucleotides per cell, Ohta^ro/., 1992). The library was amplified in order to multiply the number of each insert- bearing bacteriophage and stored as liquid and frozen stocks. This library is a good source of potentially heat stable proteins that could be used for a variety of structural and biochemical studies. Screening, cloning and sequencing theC. caldarium P- and y-tubulin genes Since at the time we began this project, the size of the Cyanidium caldarium genome was not known, we decided to plate 20,000 plaques per plate for the first round of screening for the tubulin genes. The first round of 109 Figure 16: Schematic diagram of the construction of the Cyanidium caldarium genomic library. C. caldarium total genomic DNA was partially digested with Sau3AI and fractionated on a 10^0% sucrose gradient. Following centrifugation, DNA fragments 9-23 Kb in length were pooled and ligated to X.GEM-11 bacteriophage vector arms previously cut with BamHI, and the ends of which are compatible with those generated by SauSAI. The ligation mixtures were then packaged in vitro and used to infect E. coli strain L£392. More than 2 x 106 plaques with inserts were obtained. 1 1 0 SauSAl partially digested C caldarium genomic DNA Sucrose gradient 9-23 Kb Ligation into XGEM vectory In vitro packaging Figure 16. Ill screening yielded more than 12 positive plaques per probe suggesting that the genome is small. This was also consistent with the later published data suggesting that the genome of this organism is very small (Ohta et al., 1992). The library was screened at high stringency using the PCR products as probes. As described in the Materials and Methods section of this chapter, four filters were lifted from each plate, and each filter was probed with two different probes. Following this first round screening, an interesting observation was made: A number of signals but not all, corresponding to the P- tubulin genes, were found to be common to three filters which suggested that more than one P-tubulin gene was present on one clone. Plaques corresponding to these signals were not chosen for further purification, instead, plaques corresponding to signals common to only two filters (which suggests that only one tubulin gene resides in this clone) were chosen. DNA from pure plaques corresponding to each of the four p-tubulin genes and the y-tubulin gene was isolated and mapped using EcoRl, BamHI and SacI which are present in the polycloning site of the XGEM vector (Figure 17). This was followed by Southern analysis in order to locate the tubulin gene fragments within each insert, and to verify that the inserts were indeed from C. caldarium (data not shown). Separately, Dr. Roy Bums and Dr. Richard Pearson cloned the a-tubulin gene from the same library (Pearson & Bums, 1993). A representative of each of the C. caldarium tubulin superfamily members was sequenced. I sequenced the P 1-tubulin gene and the y-tubulin gene, and Dr. Bums sequenced the a-tubulin gene. 1 1 2 Figure 17: Restriction maps of the C. caldarium P- and Y-tubulin XGEM-l 1 clones. The clones containing the full-length copies of the four P-tubulin genes (Pl-22, P2-24, P3-33, and P4-A) and the one clone containing the full-length copy of the y-tubulin gene (y-16) were digested with three restriction enzymes, EcoRI (E), BamHI (B), and SacI (S), and mapped to position these restriction sites. The shaded area on the map of each clone corresponds to tiie location of the corresponding tubulin gene within the large insert, identified by Southern analysis. The positions of two EcoRI sites in the P4-A clone was ambigious and their exact position will require digestion with a fourth restriction enzyme. Bar, 1Kb. 113 SS E EE SE EES .16 I !------1_ L J L ^ _____ p ___ I B B B B B S E S E S E S I L , 1______U—LI B B SE ES S E S p2-24 llseeeeeseeeeeesaeeaeeeeL^HBi^^HBi^^Hi^^HBJL^MiMiLiMH^^ B SEES ES ES P3-33 111^ 11 I I.— B B S BSE E / \ E EB S 1 Kb P4-A I____ LU__ I I__ LL__I Figure 17. The complete nucleotide sequence and the predicted amino acid sequence of the pi-tubulin gene and the y-tubulin gene are shown in Figures 18 and 19. Perhaps surprisingly, the sequences of these tubulin genes were not GC rich (the a-, P -, and y-tubulin genes had G+C contents of 43.08%, 40.8%, and 40.1%, respectively). In addition, no introns were found in the pi-tubulin gene or the y-tubulin gene sequences (see Discussion), whereas the a-tubulin gene sequence contained a single 49 bp intron. A putative TATA box was found in the pi-tubulin sequence near the start site, but no equivalent consensus sequence was found at the S’ end of the y-tubulin gene or the a-tubulin gene at that same position. Conversely, a putative poly A signal (AAATAAA) was encountered in the 3’ untranslated region of the y-tubulin gene and the a- tubulin gene but such a signal was absent from the pl-tubulin gene, although this latter exhibited a highly A-rich motif in this region. Determination of the total number of tubulin genesC. caldarium in Following the identification of one a-tubulin, four P-tubulin, and one y- tubulin genes from C. caldarium^ a logical question to ask was how many total tubulin genes does this organism have? It has long been known that tubulin proteins are encoded by multigene families and several hypotheses have been postulated to account for the need of these organisms to have so many tubulin genes (for review see Raff, 1994). The existence of four P-tubulin genes in C. caldarium led us to investigate the number of a-tubulin genes in this organism especially that in every species where multiple P-tubulin genes were found, a 115 Figure 18: The nucleotide sequence of the C. caldarium pi-tubuIin gene and its predicted amino acid sequence. The nucleotide sequence of part of the pi-22 genomic clone that contains the complete open reading frame of the C. caldarium pi-tubulin gene in addition to some 5’ and 3’ untranslated regions is shown. No introns were found in the gene, and the open reading frame encodes a protein of 446 amino acids. The 5’ untranslated region revealed a putative promoter consensus sequence at nucleotide position 332 (underlined sequence), but the 3’ region lackW a poly- A signal, although exhibited a highly A-rich region. 116 1 n o TTT OCC CTT COT OCA Oft* «0& OaC rX T Ota KTX CAT OAA 43 OAC TTT ATO AAO OCA OTt COA AAA ATT OCC OAT AAT AAO AAO as TTO OAA tec AAA OR OAC TAT tCC AOT AOT T R AAA CAA AOC U 7 OAA CAA ACC TOC OR OOC OCA TCA OAC AOC AAA ACO CAT TTO 169 TCC A R TTC CCO TAO OAA AR OCO COC OCC ACA TTC AAA ACO 211 TOT C R COT CAA OOA tCO TAO CCA CCT CAT ACO AOC CTC TCT 253 OR AAA ACA AOC AOT COC TOT TAC OR TOC TCO TTC ACT TR 295 TTO O R TR OtO TR OOT OAA OR CAO T R OCA CAT CTA TAT 337 ACA ACA AAT ATO COT OAO AR OCA CAC OTA CAA OCT OOT CAO 1 M t m rg fflu Urn vml hi# v # l gin #1# gly g ls 379 TOT OOA AAC CAA AR OOC ACC AAO TTC TOO OAA OTA AR TOC 12 ey# gly ##n gla 11# gly thr ly# ph# trp gla vml 11# oy# 421 OAC OAA CAT OOT CTC TCT CCA OAT OOA TAT TAT OTA OOA OAC 26 map glm hi# gly l#a ##r pro map gly tyr tyr vml gly map 463 ACA AAC TCT CAA CTA OAC AOA ACA AAT OCC TAT TAT CCT OAA 40 thr m#a ##r gla l#o map mrg il# man vml tyr tyr aar glu 505 OCT TCC OAT AAO COC TAT OTA CCT COT OCA OR CTC OTO OAC 54 mlm a a r map lya mrg ty r vml pro mrg mlm vml la a vml map 547 TTO OAA CCT OOA ACA ATO OAT OCT ATC AAA AOT OOT AAA CTO 66 laa gla pro gly thr mat map mlm 11a lya aar gly lya laa 589 OOC AAA ATO TR COT CCA OAT AAC TR ATC TAT OOT CAA AOT 82 gly lya mat pha mrg pro map man pha ila tyr gly gla aar 631 OOT OCA OOA AAT AAC TOO OCC AAA OOT CAT TAT ACO OAA OOT 96 gly mlm gly man man trp mlm lya gly hla tyr thr gla gly 673 OCA OAA TTA OTC OAT OCT OTO TTA OAT OTA OTA AOA AAO OAO 110 mlm g la la a vml map mlm vml laa map vml vml mrg lya g la 715 OCA OAA OCT TOT OAT TOC TTA CAA OOT TTC CAA OR ACT CAT 124 mlm gla mlm eya map eya laa gla gly pha gla vml thr hia 757 TCT TTO OOT OOT OOT ACA OOC TCT OOA ATO OOT ACT CTA CTO 138 aar laa gly gly gly thr gly aar gly mat gly thr laa laa 799 ATA TCC AAO AR AOA OAA OAA TAT CCT OAT COT ATO ATO OOA 152 ila aar lya ila mrg gla gla tyr pro map mrg mat mat gly 841 ACT TAT TCC OTA TTO CCT TCT CCA AAO OTA TCT OAT ACT OR 166 th r ty r aar vml laa pro aar pro lya vml aar map th r vml 883 OTC OAO CCT TAC AAC TOC AR CR TCC OR CAT CAA CTO OTO 180 vml g la pro ty r man cya ila laa mar vml hia gin laa vml 925 OAA AAT OOA OAT OAA OTA TTC TOT ATA OAC AAT OAO OCT CR 194 g la man gly map gla vml pha eya il a map man g la mlm laa 967 TAT AAC AR TOT CAC AAT ACT TTO AAA TTO AOT AAT CCC TCT 208 tyr man ila cya hla man thr Ima lya laa aar man pro aar 1009 TAT AOC OAC CTC AAT CAO TTO OTA ACT OCA OTA ATO TCO OOA 222 ty r a a r map la a man gin laa vml th r mlm vml mat aar gly 1051 ATC ACT TOT TCT CR COT TR CCA OOA CAA CTC AAT OCA OAT 236 i l a th r cya aar Ima mrg pha pro gly gin la a man mlm map 1093 TTO COT AAA TTA OCT ACC AAT CTO AR CCA TTC CCT COT CTA 250 Ima mrg lya la a mlm th r man laa il a pro pha pro mrg laa 1135 CAC T R TTC ATO AR OOA TTC OCT CCT TTA OCT OCT CCC OOA 264 hla pha pha mat ila gly pha mlm pro laa mlm mlm pro gly 1177 ACO CAO CAO TAC AAO TCA AOT AOT AR OCT OAC TTO TOT CAA 278 thr gla gin tyr lya aar aar aar ila mlm map laa cya gin (To be continued) Figure 18. 117 (Figure 18 continued) U19 CAA ATC TTT OAT TCT COT AAC ATO ATO OCA OCA TOT OAT CCT 3 9 i g la ila pba •ap aar •rg •aa • la • la eya •ap pro 1361 corCAT OOO COT TAC CTT ACT OCA OCA OCT TAT TTC COA OOA 306 •rg hia gly •rg ty r lau th r • la • la •la ty r pha •rg gly 1303 AAO OTO CCA ACC AAC OAA ATT OAT OAC CAA CTA ATO AAC OTT 330 ly* val pro th r •aa glu i l a «ap •ap gla lau mat •aa VU 1345 CAA AAC AAO AAT OCT OCT TCC TTT OTA OAO TOO ATT CCO AAC 334 g la •aa lya •aa • la • la aar pha v al glu trp i l a pro •aa 1387 AAT ATT AAO AOT TCA CTT TOT OAT ATT CCT CCC AAA OOA ATO 348 •aa ila lya aar aar lau cya •ap ila pro pro lya g ly aat 1439 CAA COC TCT OCO ACA TTT ATT OOT AAT TCT ACT OCA ATT CAO 363 g la •rg aar • la th r pha i l a gly aaa aar th r • la i l a gla 1471 OAA TTA TTT AAA COA OTT OOC OAA CAO TTT OCA OCC ATO TTC 376 glu lau pha lya •rg v a l gly glu g la pha • la • l a a a t pha 1513 COA COA AAO OCT TTT CTT CAT TOO TAT ACC OOA OAA OOA ATO 390 •rg •rg lya • la pha lau hia trp ty r th r gly g lu gly mat 1555 OAT OAA ATO OAA TTT ACO OAA OCA OAO AOC AAT ATO AOC OAT 404 •ap glu aat glu pha th r glu • la glu aar •aa mat aar •ap 1597 TTO OTT TCC OAO TAT CAA CAA TAT CAA OAO OCA ACA ATA OAT 418 lau val aar glu ty r g la g la ty r g la glu a la th r il a •ap 1639 OAT OAC TTT OOA OAO OAO OAT OAT OOT OAT OOA OAO OAA TAT 433 •ap •ap pha gly glu glu •ap •ap gly •ap gly glu glu ty r 1681 TOA OTO AAA OTA ATA AAO TTC CTT TTT TOT TOA ATO TTO ITT 446 1733 CTA TOA OCA AOT OOA AAT OTT CAC ACA AAA OTA TTC CAA CAA 1765 OAO AAA AOC COT TOA COA CAT TCC OCA TTA ATT OTT OOA TTO 118 Figure 19; The nucleotide sequence of the C. caldarium y-tubulin gene and its predicted amino acid sequence. The nucleotide sequence of part of the y-16 genomic clone that contains the complete open reading frame of the C. caldarium y-tubulin gene in addition to some 5’ and 3’ untranslated regions is shown. No introns were found in the gene, and the open reading frame encodes a protein of 457 amino acids. The 5’ and 3’ untranslated regions lack the eukaryotic consensus promoter sequence and a poly-A tail, respectively. The sequence does show, however, a poly A signal at nucleotide position 1643-1649 (underlined sequence). 119 1 CM MT MC TAT TM CAT OAA AAA TCA ACT TOC AAT CM MT 43 OM ACA TCA ACC ACC AAT AAC ACC TAC AAO AAT AAC ACC ACA S5 ACT TTT CAC AAA TCA AM AM AAT CCA AM TCA ACO CAA ACC 137 oca CCA AAA AAT TM TTT CAA ATT CCA ATT CCC ACA CCA ACT 169 MT CAC ACC CCT ACT TOA ATT AM CCT COA CAC ATA ATA ACC 1 mat pro arg glu il a ila th r 211 CTA CAC ATA CCA CAA MT CCT AAC CAC ATT CCT ACA CAC TTT • lew gla 11# gly gla ey# gly «#a glaila g ly th r glu pha 353 TCC AAA CAA CTT TCT CCT CAA CAT CCA ATA ACA CCT CAT CCC 33 tzp ly# gla lea ey# ala gla hi# gly i l a arg pro aap gly 395 TTA TM CAA CAA TCT OM OTT CAT ACA CCC OAC AOA AAA CAT 36 laa l#a gla gla a a r v a l v a l aap th r gly aap arg lya aap 337 CM TTC TTT TAT CAA CCA CAC CAC CAC CAC TAT ATT CCT AOA 50 v a l ph# ph# tyr gin ala aap aap aap hia ty r ila pro arg 379 CCC TM CTT ATT OAC TM OAA CCA ACA CTA ATA AAC COA AM 64 a la la a lau ila aap lau glu pro arg v al i l a aan gly ila 431 COC AAC TCA TCT TTT COC AAC TTT TAT AAC CCT OAO AAC ATT 78 axg aaa ##raar pha arg aan pha ty r aan pro glu aan ila 463 TTT CTT TCT CAA CTT CCC COT OOA CCA CCC AAT AAC TOO CCA 92 ph# v a l ■#r gin v a l gly gly giy aia gly aan aan trp ala 505 AOT CCC TAT ACA CAA CCA OAA OAA AAC CAC CAA CAC CM AM 106 •#r gly tyr arg gla gly gla gla lye glu glu glu lau 547 CAT AM ATA CAA AOA OAC CCC CAT CCA TCC CAC TCC CTT OAA 130 aap a#t ila glu arg glu ala a#p gly aar aap aar lau glu 589 CCA TTC CTA CTT TOC CAC TCC ATT CCC CCA CCT ACA COC TCA 134 g ly ph# val lau ey# hi# aar ila ala gly gly thr gly aar 631 CCT TTA OCT TCC TM CTT CTT CAA AAO CM AAT OAA coo TTT 148 g ly lau gly ##r ph# val lau glu lya lau aan glu arg pha 673 CCC AAA AAA CTT OTT CAC ACA TAT MC CM TTT CCT AAC CAA 163 pro ly# ly# lau v a l gin th r ty r aar val pha pro aan gin 715 CAO CAA TCC ACC OAC CTA CTT CTT CAA CCC TAT AAT TCC ATT 176 g la glu #«raar aap v al v al v al gla pro ty r aan aar i l a 757 CTC ACC CTC AAA CCC TM ACT CAC AAT CCT OAC MT CTT OM 190 l#tt th r lau lya arg lau th r gin aaa ala aap cya v al v al 799 CM TTA CAT AAT ACA OCC CM AAT AOC ATT OCA CTA OAC COA 204 v al lau aap aan th r a la lau aan arg ila a la v al asp arg 841 CTA CAT CTO CAO AAT CCT ACC TTT CCT CAA CM AAT MT CTT 218 1#U hi# l#u glu aan pro th r pha ala gla v al aan aar lau 883 CTA TCA CCT CM AM CCC CCT AOC ACA TCA ACT TM AOA TAT 233 v al ##rala val a la a la aar th r aar th r lau arg ty r 925 CCA COA TAT AM AAC AAT CAC CTT CTT COC TM TTA CCT MT 246 pro gly ty r mat aan aan aap lau val gly lau lau ala aar 967 CTC ATT CCA ACC CCA CAO MT CAC TAT TM OTA ACT CCA TAT 260 l#u 11# pro th r pro gin cya hla ty r lau v al th r gly ty r 1009 ACT CCC CTT ACA CTT CTT CAA CAA CAC COA OCT CCA ACT AOC 274 th r pro lau th r lau lau glu glu aap arg a la gly th r aar 1051 CAA OTT ACC AAA ACT ACC CM TTA CAT CM AM CCA COT CM 288 g la v al th r ly# th r th r v al lau aap val mat arg arg lau (To be continued) Figure 19. 1 2 0 (Figure 19 continued) 1093 CTA CAO CCC AAA AAC ATT ATO OTT TOC TOT TCO ACT COA AAA 303 l«u g la pro ly» aaa il a v al aar cya aar th r arg lya 1135 OOC TOT TAC ATT TCT ATC CTO AAT OTT ATT CAA OOA OAA OTA 316 gly ey# ty r il a aar ila la a aaa v al U a g la Oly g la v al 1177 QIC CCT OCC CAA OTA CAT AAA AOT CTA CAA AOA AXA COA OAA 330 MP pro a la g la v al hia lya aar laa gla arg ila arg g la 1219 COA AAO CTT OCT ACC TTC ATT CCC TOO OOT CCO ACO OOA ATC 344 •rg ly# la a a la th r pha il a pro trp oly pro th r gly i l a 1261 CAO OTT OCO CTT TCO AAO AOA TCT CCO TAT CTT AAO AOT CAT 358 gin v al a la lau aar lya arg aar pro ty r laa lya aar hia 1303 CAT AOO ATA TCT OOT CTT ATO TTO OCT AAT CAT ACC AOC ATA 372 hi# arg il a #ar oly laa aat laa ala aaa hia th r aar i l a 1345 CAA TCC TTA TTT TCT COO TCT TTA OTA CAA TAT OAT AAO TTO 386 g la #ar lau pha aar arg aar laa val gla ty r aap lya la a 1387 AOA AAO COA AAT OCA TTT CTC OAC AAC TAT AAO AAO OAA CCC 400 «rg ly# arg aaa a la pha la a aap aan ty r lya lya g la pro 1429 ATO TTT CAA OAT OOC TTO OAO OAA TTC OAC AAT TCO COT CAO 412 mat pha g la aap oly laa gla gla pha aap aaa aar arg gin 1471 OTT OTC OAA OAC TTO ATT OCA OAA TAC ACA OCT OCA OAA COT 428 v al v al glu aap lau ila ala gla ty r th r ala a la gla arg 1513 CCA OAC TAT CTC AAT TOO AOT TAT TCA AAC OTA TCA OAA CAO 442 pro a#p ty r la a aaa trp aar ty r aar aan val aar glu g la 1555 AAC AOO TAA OAO CAC ATC AAT AAC AAA TAT OCA AAC OAT TOO 456 aaa arg • •• 457 1597 ACC AAT OTA TAT OOA ATT TTT ATT CCA CTA AAA ATO ATC ATT 1639 TCT OAA ATA AA* TAC ACA OTC ACT TTC AAT TOT TAA OTO TCO 1681 AOA AAA CAA CTA CCA CAA CAT ATA OTA OCT TCC CAA CTO OAT 1723 OOA ACC OTT OTA CCO ATA TCT CTC OTT OCA TAA ACC TOC CTC 1765 CTT TOC TCC AAT CAT CCC 1782 t 121 similar, but not necessarily identical number of a-tubulin genes was also encountered (Cleveland & Sullivan, 1985; Little & Seehaus, 1988). In addition, following the recent discovery of y tubulin in the filamentous fungus Aspergillus nidulans, this protein was also found to be encoded by multigene families in highly divergent organisms such as humans (Wise & Oakley, 1995), Arabidopsis thaliana (Lui, 1994), Drosophila melanogaster (Zheng et al., 1991), and two Euplotes species (Tan et al., 1996 a and b, GenBank). In order to determine the total number of tubulin genes in C. caldarium, we chose to perform low stringency Southern hybridizations on total genomic DNA digested with different restriction enzymes. The hybridization temperatures were lowered from 65®C to 60®C and 55®C to allow for base-pair mismatches between the members of the same tubulin gene family. In addition, the 5’ and the 3’ halves of each gene were used separately as probes. This will allow us to better interpret the results obtained since if both probes indicate the presence of more genes, it is very likely that more than one gene indeed exists. In addition, we wanted to make sure to encompass the whole gene after digestion and to account for differential homologies in different parts of the sequences of these genes. Total genomic DNA was digested with several different restriction enzymes, and probed using the 5’ and 3’ halves of each of the three sequenced tubulin genes as probes. At the lowest temperature, we obtained hybridization to tubulin sequences in control lanes containing digested DNA from Aspergillus nidulans (Figures 20,21, and 22). We were, thus, reasonably 1 2 2 confident that the stringency we used was low enough to obtain hybridization to all of the C. caldarium tubulin sequences. The low stringency Southern hybridization data did not reveal the existence of P-tubulin genes in addition to the ones already identified by PCR (Figure 20). By contrast, probing separately with the 5’ and 3’ halves of the alpha-tubulin gene indicated the presence of a-tubulin gene(s) in addition to the one Pearson & Bums (1993) had cloned. PstI and PvuII which do not cut within the region of the cloned a-tubulin gene covered by the 5’ probe, each gave at least two bands. EcoRI which cuts twice within the above region (although the second site is at the end of this region and the probe might not hybridize to it) gave three bands, with the 2 Kb band being thicker than the others. In addition, Hindm, which cuts twice within that same region, gave four bands (Figure 2Ia). Similar results were obtained with the enzymes cutting the region covered by the 3’ probe, except for Hindm (discussed later) (Figure 21b). These results suggest the presence of an additional a-tubulin gene to which the probe is hybridizing. The low stringency Southern analysis also suggested the presence of one additional y-tubulin gene. In this case, BamHI, Hindm, PstI and PvuH which do not cut within the region of the cloned y-tubulin gene covered by the 5’ probe, each gave at least 2 bands. Hindin which is expected to cut once within the region covered by the 3’ probe, gave three bands, whereas PstI and PvuH which should not cut within the 3’ probe gave at least two bands (Figure 22a and b). We could not determine the exact number of genes 123 Figure 20: Low stringency Southern analysis of the C. caldarium P-tubulin genes. (20a) Genomic C. caldarium DNA samples (1 |xg) were digested with Kpnl, Hindm, PstI, and PvuII (lanes 2-5). Control A. nididans genomic DNA sample from strain G191 was digested with EcoRI (lane 1). The digests were run on agarose gels, processed for Southern analysis, and probed with the 5’ half of the C. caldarium P 1-tubulin gene at 55®C. (20b) The samples are the same as above but were probed with the 3’ half of the C. caldarium P 1-tubulin gene at 55®C. 124 lliiBili i s ^ \ ;.''9.4^- 6.6> 4.4» Z 3 » 2.0» Figure 20. 125 Figure 21: Low stringency Southern analysis of the C. caldarium a-tubulin genes. (21a) Genomic C. caldarium DNA samples (1 |xg) were digested with EcoRI, Hindm, PstI, and PvuII Oanes 2-5). Control A. nidulans genomic DNA sample from strain G191 was digested with EcoRI (lane 1). The digests were run on agarose gels, processed for Southern analysis, and probed with the 5’ half of the C. caldarium a-tubulin gene at 55°C. (21b) The samples are the same as above but were probed with the 3’ half of die C. caldarium a-tubulin gene at 55°C. 126 IXÊÊêM Figure 21. 127 Figure 22: Low stringency Southern analysis of the C. caldarium y-tubulin genes. (22a) Genomic C. caldarium DNA samples (1 pg) were digested with BamHI, Hindm, PstI, and PvuII (lanes 2-5). Control A. nidulans genomic DNA sample from strain G191 was digested with EcoRI (lane 1). The digests were run on agarose gels, processed for Southern analysis, and probed with the 5’ half of the C. ccUdarium y-tubulin gene at 55®C. (22b) The samples are the same as above but were probed with the 3* half of the C. caldarium y-tubulin gene at 55®C. 128 ■J»; fNJ N3 A. midmons PvuH lo ro ^ 0> (o £* ■p^ ^ in ^ 'Ÿ Iw Êmm for each of a and y tubulins with certainty because any additional band revealed by Southern hybridization might indicate the presence of a third gene or might simply reflect the presence of more restriction sites for a particular enzyme in the second gene. Interestingly, while the specified restriction enzymes indicated additional tubulin genes, other enzymes did not For example Hindm in the analysis of a tubulin (Figure 21) and BamHI in the analysis of y tubulin (Figure 22) failed to indicate the presence of any additional tubulins. This might indicate that the sites for these latter enzymes are conserved in the other genes and might therefore indicate a high sequence homology between the multiple genes of each of the tubulin superfaimly members. Furthermore, this would also suggest that these genes might have been recently duplicated. In summary, we conclude that C. caldarium has at least two a-tubulin, four P-tubulin, and two y-tubulin genes. Genomic arrangement of the P-tubulin genes ofcaldarium C. The implication, from the low stringency Southern hybridization results, of a recent tubulin gene duplication in C. caldarium, led us to investigate the possibility of the multiple tubulin genes being tandemly repeated in the genome of this organisnL In addition, the initial screening strategy that led to the cloning of the four P-tubulin genes and the y-tubulin gene, also inferred that the former genes might be clustered (see Materials and Methods). Although tubulin genes are dispersed in the genomes of most organisms 130 investigated, there is precedent for tubulin tandem repeats. In parasitic microorganisms such as Trypanosoma brucei and several species of Leishmania, and in sea urchins, tubulin genes are clustered (Tomashow et al^ 1983; Landfear et of ., 1983; Huang et al., 1984; Landfear & Wirth, 1985; Alexandraki & Ruderman, 1981; Alexandraki & Ruderman, 1983; Alexandraki & Ruderman, 1985; reviewed in Cleveland & Sullivan, 1985). In T. brucei, a- and P-tubulin gene pairs are tandemly repeated, whereas in Lelshmania enrietti, only the P-tubulin genes are tandemly repeated. The significance of this genomic arrangement is not well understood but it has been proposed to be important for the regulation of expression through common regulatory DNA elements (Cleveland & Sullivan, 1985). In order to investigate the possibility of tandem repeats in C. caldarium, I screened for clones that contain two or more P-tubulin genes in the same insert (see Materials and Methods) using the same screening strategy used in the initial cloning of the C. caldarium tubulin genes. Briefly, four filters were lifted from each plate containing 2 x 10^ pfu. Each filter was probed with two probes in the following combination: pi and P3, pi and P4, P2 and P3 and P2 and p4. The results from the first round screening yielded 11 positive signals on the filters probed with p2 and p4, p2 and p3, and p i and p3. These signals presumably correspond to clones carrying both the P2- and P3-tubulin genes. In addition, 2 positive signals were obtained on the filters probed with pi and p4, p i and p3, and P2 and P4. These signals, in turn, may correspond to clones that carry both the p i- and P4-tubulin genes. These results are not likely to be 131 artefacts of cross-hybridization of the p-tubulin probes since I did obtain signals that were common to only two filters and hence carry only one P- tubulin gene. This is possible since the library was made from partially digested DNA and sites might have been digested in some clones but not others. In summary, my results suggest that the p i- and the P4-tubulin genes, and the P2- and pS-tubulin genes, separately, are clustered. Interestingly, one positive signal was found on all four filters, and was therefore attributed to a clone that carries aU the identified P-tubulin genes. It is, hence, possible that all the C. caldarium P-tubulin genes are clustered. These results have allowed me to purify, through several rounds of purification, positive clones that putatively contain tandemly repeated P- tubulin genes. Further analysis of these clones using Southern hybridizations and restriction mapping will be necessary in order to make sure that these purified clones do indeed carry more than one P-tubulin gene. It will also be interesting to investigate whether the two a- and two y-tubulin genes are also clustered in this organism. This might provide some insights into the mechanisms into the regulation of tubulin expression in C. caldarium. Discussion The intrinsic heat instability of tubulin from mammalian sources led us to investigate the tubulin genes of a thermophilic alga with the eventual goal of 132 expressing these genes in more genetically amenable organisms, and obtaining heat-stable tubulins that would be more conducive to structural as well as biochemical studies. Indeed, enzymes from thermophilic organisms have been isolated and purified, and have been found to withstand higher temperatures than their mesophilic counterparts (reviewed in Adams & Kelly, 1995). The mechanism behind this differential stability is not, however, fully understood. Nuclear magnetic resonance in addition to crystallographic analyses still indicate that the thermal stability of these proteins is not due to gross structural differences, and that indeed, their overall structures are virtually identical to that of their mesophilic counterparts (reviewed in Adams & Kelly, 1995). This is, in fact, an important point when considering the use of these proteins for biochemical and physical analyses, as a gross difference in the structure of a thermostable protein, such as tubulin in this case, will only reveal the properties of this protein in its thermophilic milieu and would not reveal its properties in general. In this study, 1 have reported the identification of the tubulin genes from the thermophilic red alga Cyanidium caldarium. Initial screening of tubulin genes was done by PCR whereby internal fragments encoding for one a- tubulin, four ^-tubulin, and one y-tubulin genes were identified. This strategy has proven to be successful in identifying known genes from different organisms especially in the case of proteins that are as conserved as tubulin, and where sequence information, from which we can design primers to conserved regions, is readily available. 133 A C. caldarium genomic library was subsequently constructed and used to screen the full-length copies of the four P- and one y-tubulin genes identified by PCR. One P-tubulin gene (Pl) and one y-tubulin gene were sequenced completely on both strands. Perhaps surprisingly, and contrary to what would be expected of the DNA of a thermophilic organism such as C. caldarium, the nucleotide sequences of these two genes were not GC rich. This is in agreement with reports on the sequencing of ribosomal RNA genes from this organism (Elela & Nazar, 1992; Jakab etal, 1993). In order to gain some insights into the characteristics and evolution of the C. caldarium tubulin sequences, I undertook an analysis of the Pl-tubulin sequence from C. caldarium by comparing it with 105 P-tubulin sequences from a variety of evolutionarily divergent organisms. Similarly, I compared the C. caldarium y-tubulin sequence with the 23 reported y-tubulin sequences from different organisms. This analysis was done at the amino acid level using the alignment program PileUp with default parameters, from the GCG Wisconsin Package. PileUp creates an alignment based on sequence similarity. This alignment can be illustrated by a dendrogram where similar sequences are clustered together. Dendrograms of the pi- and y-tubulin genes are shown in Figures 23 and 24. The dendrogram representing the alignment of the P-tubulin genes show that the C. caldarium pi-tubulin gene is divergent, and shares the most recent common ancestor with a group of organisms encompassing the animals. 134 Figure 23: Dendrogram of the ^tubulin sequences. The C. caldarium ^1-tubulin amino acid sequence was aligned with 105 P- tubulin sequences obtained from GenBank, using the PileUp program from the GCG Wisconsin package, with default parameters. The output of the alignment is illustrated by a dendrogram shown in diis figure. 135 c isSSÎ" r .p » I r.wM» Figure 23. 136 Figure 24: Dendrogram of the y-tubulin sequences. The C. caldarium y-tubulin amino acid sequence was aligned with 23 y- tubulin sequences obtained from GenBank, using the PileUp program from the GCG Wisconsin package, with default parameters. The output of the alignment is illustrated by a dendrogram shown in this figure. 137 A. nidulans N. crassa S. pombe U. violacea E. octocarinatus 1 E. octocarinatus 2 - E. aediculatus — E. crassus 2 — E. crassus 1 H. sapiens C X. laevis — D. melanogaster I — D. melanogaster 2 A. thaliana 1 rCA. thaliana 2 Z. mays A. phyllitidis C. caldarium*** C. reinhardtii T. brucei R.filosa P. falciparum C. elegans S. cerevisiae Figure 24. 138 plants, cillâtes, fungi, and green algae included in the analysis. The dendrogram shows, therefore, that, with respect to the ^-tubulin genes, C. caldarium split off before animals, plants, fungi, and ciliates split from each others, and evolved in separate directions. In turn, the dendrogram of the C. caldarium y-tubulin gene and 23 other y-tubulin genes from a wide variety of organisms showed that the C. caldarium y-tubulin gene clusters with plants. These cluster next with animals, followed by ciliates, fungi, a green alga and parasitic protozoans. The Coenorhabditis elegans and Saccharomyces cerevisiae sequences do not cluster with any of the above sequences, and are also divergent from each others. This is in agreement with the proposal that their genes do not encode bona fide y tubulins (Bums, 1995). The clustering of the C. caldarium y- tubulin gene with those of plants is surprising since, in evolutionary trees based on the sequences of the ribosomal RNA genes, red alga usually cluster with ciliates and are divergent from plants (Dr. Bill Birky, personal communication). This dendrogram, however, is not a very accurate phylogenetic analysis, and although the taxonomy of C. caldarium as a red alga is a matter of debate, its clustering with plants might be an artefact of the PileUp analysis. Because of the difficulty in purifying y tubulin, it has not been possible to demonstrate whether this protein binds GTP. Sequence conservation of the putative GTP binding peptides in all of (X, p, and y tubulins suggested, however, that y tubulin might also be a GTP binding protein. Similar to the pi-tubulin 139 gene from C caldarium, the y-tubulin gene from this organism show the same sequence conservation regarding putative GTP-binding domains. Secondary structure analysis of the C. caldarium y-tubulin sequence (using the “Coils’* program on the World Wide Web which predicts the presence of coiled coils in the sequence submitted) predicted (99% prediction probability) a coiled coil region between amino acids 100 and 150. Interestingly, this coiled coil region was not found in any of the other y-tubulin sequences analyzed. Whether this putative structure is related to thermostability is unclear. Analysis of the C. caldarium ^1-tubulin sequence using the same program did not reveal any unusual properties of this sequence. The interest in expressing these genes and obtaining heat-stable mbulin entails that the thermal stability is inherent in the protein sequence, and is not merely due to stabilizing cellular factors. The sequences of the pi-and y- tubulin genes, however, did not reveal any unusual properties. The absence of introns in both the P-and y-tubulin genes was intriguing. Several other genes, cloned from both the nucleus and chloroplast of C. caldarium, were also found to be intronless, while others had short intervening sequences as in the case of the a-tubulin gene (Ziegler et at., 1995; Pearson & Bums, 1993). If C. caldarium is indeed a primitive eukaryote, then these findings would support the late-intron hypothesis which states that ancestral organisms lacked introns, and that the acquisition of these intervening sequences occurred late in evolution (Palmer & Logsdon, 1991). Both the relative sparsity of introns and the thermal stability of the C. caldarium 140 proteins present an advantage in using C. caldarium as a source of thermostable proteins, since the expression of proteins from genes cloned from this organism does not require the isolation of cDNA, and makes our constructed genomic library a invaluable source of such stable proteins. The identification of four P-tubulin genes, but only one a-tubulin and one y-tubulin genes from our initial PCR screen, led us to investigate the possibility that C. caldarium has more of these latter genes that were not picked up by PCR. This hypothesis was tested by performing low stringency Southern hybridizations, the results of which revealed the existence of at least another a-tubulin gene and another y-tubulin gene. These results were not surprising since it has long been know that the tubulin superfamily members exist in multigene families, the requirement for which is not well known. The presence, however, in this eukaryote, of at least eight tubulin genes is intriguing. Moreover, the fact that the data from the low stringency Southern hybridization results showed that some restriction enzymes revealed the presence of additional genes and others did not, suggested that the tubulin genes in each superfamily member are highly conserved with respect to these restriction sites, and might have only duplicated recently (see Results section). This, in turn, led us to investigate the possibility that these genes might still be clustered and have not yet dispersed around the genome. Our screen for clones containing more than one P-tubulin gene showed that indeed each two 141 of the four P-tubulin genes identified (Pl with ^4, and ^2 with ^3) are clustered. The advantage of tubulin genes being clustered was hypothesized to be in having common regulatory elements that could allow orchestrated expression of both tubulin subunits. These conclusions, however, remain highly speculative and awaits further analysis of tubulin expression in C. caldarium and in other organisms. 142 BIBLIOGRAPHY Adams, M. W. W„ and Kelly, R. M. (1995). Enzymes from microorganisms in extreme environments. Chem. Eng. News 75,32-42. Alexandraki, D., and Rudennan, J. V. (1983). Evolution of a - and p-tubulin genes as inferred by the nucleotide sequences of sea urchin cDNA clones. J. Mol. Evol. 19,397-410. Algaier, J., and Himes, R. H. (1988). The effects of dimethyl sulfoxide on the kinetics of tubulin assembly. Biochim. Biophys. Acta. 954,235-243. Amos, L. A., and Baker, T. S. (1979). The three-dimensional structure of tubulin protofilaments. Nature 279,607-612. Amos, L. A., and Klug, A. (1974). Arrangement of subunits in flagellar microtubules. J. Cell Sci. 14, 523-549. Andreu, J. M., and Timasheff, S. N. (1981). The ligand and microtubule assembly induced GTPase activity of purified calf brain tubulin. Arch. Biochem. Biophys. 211,151-157. Arakawa, T., and Timasheff, S. N. (1984). The mechanism of action of Na glutamate. Lysine HCl, and piperazine-N, N'-bis(2-ethanosulfonic acid) in the stabilization of tubulin and microtubule formation. J. Biol. Chem. 259, 4979-4986. Baneijee, A., Roach, M. C., Wall, K. A., Lopata, M. A., Cleveland, D. W., and Luduena, R. F. (1988). A monoclonal antibody against the type H iso^r^ of beta-tubulin. Preparation of isotypically altered tubulin. J. Biol. Chem. 263, 3029-3034. Baneijee, A., and Luduena, R. F. (1991). Distinct colchicine binding kinetics of bovine brain tubulin lacking the type IH isotype of beta-tubulin. J. Biol. Chem. 266,1689-1691. 143 Baneijee, A., and Luduena, R. F. (1992). Kinetics of colchicine binding to purified beta-tubulin isotypes from bovine brain. J. Biol. Chem. 267, 13335-13339. Baneijee, A., Roach, M. C., Trcka, P., and Luduena, R. F. (1990). Increased Microtubule Assembly in Bovine Brain Tubulin Lacking the Type-UI Isotype of P-Tubulin. J. Biol. Chem. 265,1794-1799. Baneijee, A., Roach, M. C., Trcka, P., and Luduena, R. F. (1992). Preparation of monoclonal antibody specific for the class IV iso^rpe of ^-tubulin. J. Biol. Chem. 267, 5625-5630. Barra, H. S., Rodriguez, J. A., Arce, C. A., and Capputo, R. (1973). A soluble preparation from rat brain that incorporates into its own proteins (14C)arginine by a ribonuclease-sensitive system and (14C)tyrosine by a ribonuclease-insensitive system. J. Neurochem. 20,97-108. Barton, N. R., and Goldstein, L. S. B. (1996). Going mobile; Microtubule motors and chromosome segregation. Proc. Natl. Acad. Sci. USA 93, 1735-1742. Beese, L., Stubbs, G., and Cohen, C. (1987). Microtubule structure at 18 Angstrom resolution. J. Mol. Biol. 194,257-264. Belmont, L. D., and Mitchison, T. J. (1996). Identification of a protein that interacts with tubulin dimers and increases the catastrophe rate of microtubules. Cell 84,623-632. Bems, M., and Richardson, M. S. (1977). Continuation of mitosis after selective laser microbeam irradiation of the centriolar region. J. Cell Biol. 75,977-982. Boiisy, G. G., and Taylor, E. W. (1967). The mechanism of action of colchicine. Binding of colchicine-3H to cellular protein. J. Cell Biol. 34, 525-533. Brinkley, B. R. (1985). Microtubule organizing centers. Ann. R. Cell Biol. 1, 145-172. Brinkley, B. R. (1990). Centromeres and kinetochores: Integrated domains on eukaryotic chromosomes. Curr. Opin. Cell Biol. 2,446-452. Brock, T. D. (1967). Life at high temperatures. Science 15,1012-1019. Brylawski, B. P., and Caplow, M. (1983). Rate for nucleotide release from tubulin. J. Biol. Chem. 258,160-763. 144 Bums, R. G. (1990). Detection of thermostable alpha tubulin from Cyanidium caldarium. J. Cell BioL lllS , 412a. Bums, R. G. (1991). a-, P- and y-tubulins: Sequence comparisons and stmctural constraints. Cell Motil. Cytoskel. 20,181-189. Bums, R., G (1995). Analysis of the y-tubulin sequences: implications for the functional properties of y-tubulin. J. Cell Sci. 108,2123-2130. Bums, R., G, and Surridge, C., D. (1994). TubuliniConservation and Structure. In Microtubides, J. Hyams S, and C. Lloyd W, eds. (New York: Wüey-Liss), pp. 3-32. Caplow, M., Shanks, J., and Ruhlen, R. (1994). How taxol modulates microtubule disassembly. J. Biol. Chem. 269,23399-23402. earlier, M. P., and Pantaloni, D. (1983). Taxol effect on tubulin polymerization and associated guanosine 5'-triphosphate hydrolysis. Biochem. 22, 4814-4822. Cassimeiis, L., Fryer, N. K., and Salmon, E. D. (1988). Real-time observations of microtubule dynamic instability in living cells. J. Cell Biol. 107,2223-2231. Chapin, S. J., and Bulinski, J. C. (1991). Non-neuronal 210 x 10^ Mr microtubule-associated protein (MAP4) contains a domain homologous to the microtubule-binding domains of neuronal MAP2 and tau. J. Cell Sci. 98,27-36. Cleveland, D., W, and Sullivan, K., F (1985). Molecular Biology and Genetics of Tubulin. Ann. Rev. Biochem. 54,331-365. Clutterbuck. (1974). Aspergillus nidulans in Handbook of Genetics, R. C. king ed., vol. I. (New York: Plenum Press). Clutterbuck, A. J. (1993). Aspergillus nidulans. In Genetic Maps: Locus Maps of Complex Genes, S. J. O'Brien, ed. (Cold Spring Harbor Press), pp. 3.71-3.84. Cove, D. J. (1977). The genetics of Aspergillus nidulans, J. E. Smith and J. A. Pateman ed. (London: Academic Press). Davis, A., Sage, C. R., Wilson, L., and Farrell, K. W. (1993). Purification and biochemical characterization of tubulin from the budding yeast Saccharomyces cerevisiae. Biochem. 32, 8823-8835. David-Pfeuty, T., Simon, C., and Pantaloni, D. (1979). Effect of antimitotic dmgs on tubulin GTPase activity and self-assembly. J. Biol. Chem. 254, 11696-11702. 145 Dhamodharan, R., Jordan, M. A., Thrower, D., Wilson, L., and Wadsworth, P. (1995). Vinblastine suppresses dynamics of individual microtubules in living interphase cells. Mol Biol. Cell 6 ,1215-1229. Doemel, W. N., and Brock, T. D. (1970). The upper temperature limit of Cyanidium caldarium. Arch. Mikrobiol. 72, 326-332. Doshi, P., Bossie, C. A., Doonan, J. H., May, G. S., and Morris, N. R. (1991). The two a-tubulin genes of Aspergillus nidulans encode divergent proteins. Mol. Gen. Genet 225,129-141. Downing, K. H. (1991). Spot-scan imaging in transmission microscopy. Science 251, 53-59. Drechsel, D. N., Hyman, A. A., Cobb, M. H., and Kirschner, M. W. (1992). Modulation of the dynamic instability of tubulin assembly by the microtubule-associated protein tau. Mol. Biol. Cell 3 , 1141-1154. Dunne, P. W., and Oakley, B. R (1988). Mitotic gene conversion, reciprocal recombination and gene replacement at the benA, beta-tubulin locus of Aspergillus nidulans. Mol. Gen. Genet 213, 339-345. Elela, S. A., and Nazar, R N. (1992). Extended secondary structure as a basis of increased RNA stability in a thermophilic alga Cyanidium caldarium. Biochim. Biophys. Acta. II30, 339-342. Erickson, H. P. (1974). Microtubules surface lattice and subunit structure and observations on reassembly. J. Cell Biol. 6 0 ,153-167. Erickson, H., P, and O'Brien, E. T. (1992). Microtubule Dynamic Instability and GTP hydrolysis. Ann. Rev. Biophys. and Biomolec. Struct 2 1 ,145-166. Euteneuer, U., and McIntosh, J. R. (1981). Structural polarity of kinetochore microtubules in PtKi cells. J. Cell Biol. 89,338-345. Evans, L., Mitchison, T., and Kirschner, M. (1985). Influence of the centrosome on the structure of nucleated microtubules. J. Cell Biol. 100,1185-1191. Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specificity. Analyt Biochem. 132, 6-13. Field, D. J., Collins, R A., and Lee, J. C. (1984). Heterogeneity of vertebrate brain tubulin. Proc. Natl. Acad. Sci. USA 81,4041-4045. 146 Ford, T. W. (1979). Ribulose 1,5-bisphosphate carboxylase from the thermophilic, acidophilic alga, Cyanidium calmrium (Geitler). Purifrcation, characterization and thermostabiUty of the enzyme. Biochim. Biophys. Acta. 569, 239-248. Frigon, R. P., and Lee, J. C. (1972). The stabilization of calf-brain microtubule protein by sucrose. Arch. Biochem. Biophys. 153, 587-589. Fulton, C., and Simpson, P., A. (1976). Selective Syntheses and Utilization of Flagellar Tubulin. The Multi-tubulin Hypothesis. In Cell Motili^, R. Goldman, T. Pollard, and J. Rosenbaum, eds. (New York: Cold Spring Harbor Press), pp. 987-1005. Gard, D. L., and Kirchner, M. W. (1985). A polymer-dependent increase in phosphorylation of beta-tubulin of a mouse neuroblatoma cell line. J. Cell Biol. 100, 764-774. Gaskin, F., Cantor, C. R., and Shelanski, M. L. (1974). Turbidimetric studies of the in vitro assembly and disassembly of porcine neurotubules. J. Mol. Biol. 89, 737-758. Geuens, G., Gundersen, G. G., Nuydens, R., Comelissen, F., Bulinski, J. C., and DeBrabander, M. (1986). Ultrastructural localization of tyrosinated and detyrosinated alpha tubulin in interphase and mitotic cells. J. Cell Biol. 103, 1883-1893. Gould, R. R., and Borisy, G. G. (1977). The pericentriolar material in Chinese hamster ovary cells nucleates microtubule formation. J. Cell Biol. 73,601-615. Gozes, I., and Sweadner, K. J. (1981). Multiple tubulin forms are expressed by a single neurone. Nature 294, 277-280. Gundersen, G. G., and Bulinski, J. C. (1986). Microtubule arrays in diffemtiated cells contain elevated levels of post-translationally modified form of tubulin. Eur. J. CeU Biol. 42, 288-294. Gundersen, G. G., Kalnoski, M. H., and Bulinski, J. C. (1984). Distinct populations of microtubules: tyrosinated and nontyrosinated alpha tubulin are distributed differently in vivo. Cell 38,779-789. Haimo, L. T., Telzer, B. R., and Rosenbaum, J. L. (1979). Dynein binds to and crossbridges cytoplasmic microtubules. Ptoc. Natl. Acad. Sci. USA 76, 5759-5763. Harlow, E., and Lane, D. (1988). Antibodies: A laboratory manual. Cold Spring Harbor Press, New York, pp. 633. 147 Hastie, S. B. (1991). Interactions of colchicine with tubulin. Pharmacol. Ther. 572, 377-401. Heidemann, S. R., and McIntosh, J. R. (1980). Visualization of the structural polarity of microtubules. Nature 286,517-519. Himmler, A., Drechsel, D., Kirschner, M. W., and Martin, D. W. J. (1989). Tau consists of a set of proteins with repeated C-terminal microtubule-binding domains and variable N-terminal domains. Mol. Cell. BioL 9,1381-1388. Hirose, K., Fan, J., and Amos, L. A. (1995). Re-examination of the polarity of microtubules and sheets decorated with kinesin motor domain. J. Mol. Biol. 251, 329-333. Hirose, K., Lockhart, A., Cross, R. A., and Amos, L. A. (1995). Nucleotide-dependent change in kinesin motor domain bound to tubulin. Nature 376, 277-279. Hoenger, A., Sablin, E. P., Vale, R. D., Fletterick, R. J., and Milligan, R. A. (1995). Three-dimensional structure of a tubulin-motor-protein complex. Nature 376, 271-274. Horio, T., and Hotani, H. (1986). Visualization of the dynamic instability of individual microtubules by dark-field microscopy. Nature 321, 605-607. Horio, T., Uzawa, S., Jung, M. K., Oakley, B. R., Tanaka, K., and Yanagida, M. (1991). The fission yeast gamma-tubulin is essential for mitosis and is localized at two different microtubule organizing centers. J. CeU Sci. 99,693-700. Hoyle, H., D, and Raff, E., C (1990). Two drosophila P Tubulin isoforms are not functionally equivalent. J. Cell Biol. Ill, 1009-1026. Hyman, A. A., Salser, S., DrechseL D. N., Unwin, N., and Mitchison, T. J. (1992). Role of GTP hydrolysis in microtubule dynamics: Information from a slowly hydrolyzable analogue, GMPCPP. Mol. Biol. Cell 3 , 1155-1167. Jakab, G., Kis, M., Poliak, T., and Solymosy, F. (1993). Nucleotide sequence of cytoplasmic 5S rRNA from a eukaryotic thermophilic unicellular alga, Cyanidium caldarium. Nucl. Acids Res. 21,2770. Janknecht, R., de Martynoff, G., Lou, J., Hipskind, R. A., Nordheim, A., and Stunnenberg, H. G. (1991). Rapid and efficient purification of native histidine-tagged protein expressed by recombinant vaccinia virus. Proc. Natl. Acad. Sci. USA 88,8972-8976. 148 Jarvik, J., and Botstein, D. (1975). Conditional-lethal mutations that suppress genetic defects in morphogenesis by altering structural proteins. Proc. Natl. Acad. Sci. USA 72,2738-2742. Johnson, D. A., Gautsch, J. W., Sportsman, J. R., and Elder, J. H. (1984). Improved technique utilizing nonfat dry milk for analysis of protein and nucleic acid transferred to nitrocellulose. Gene Anal. Tech. i, 3. Jordan, M. A., Margolis, R. L., Himes, R. H., and Wilson, L. (1986). Identification of a distinct class of vinblastine binding sites on microtubules. J. Mol. Biol. 187,61-73. Joshi, H. C., Palacios, M. J., McNamara, L., and Cleveland, D. W. (1992). 7-tubulin is a centrosomal protein required for cell cycle-dependent microtubule nucléation. Nature 356, 80-83. Khawaja, S., Gundersen, G. G., and Bulinski, J. C. (1988). Enhanced stability of microtubules enriched in detyrosinated tubulin is not a direct function of detyrosination level. J. Cell Biol. 106,141-149. Kikkawa, M., Ishikawa, T., Wakabayashi, T., and Hirokawa, N. (1995). Three-dimensional structure of the kinesin head-microtubule complex. Nature 376, 274-277. Kirchner, K., and Mandelkow, Eva-M. (1985). Tubulin domains reponsible for assembly of dimers and protofilaments. Embo. J. 4 , 2397-2402. Kirk, K. E., and Morris, N. R. (1991). The mhB alpha-tubulin gene is essential for sexual development in Aspergillus nidulans. Genes Dev. 5, 2014-2023. Kirk, K. E., and Morris, N. R. (1993). Either alpha-tubulin isogene product is sufficient for microtubule function during all stages of growth and differentiation in Aspergillus nidulans. Mol. Cell. Biol. 13, 4465-M76. Kowalski, R. J., and Williams, R. C., Jr. (1993). Unambiguous classification of microtubule-ends in vitro: Dynamic properties of the plus- and minus-ends. Cell MotU. CytoskeL 26,282-290. Kreis, T. (1987). Microtubules containing detyrosinated tubulin are less dynamic. Embo J. 6 ,1597-2606. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lee, G., Cowan, N. J., and Kirschner, M. W. (1988). The primary structure and heterogeneity of tau protein from mouse brain. Science 239, 285-288. 149 Lee, J. C., Frigon, R. P., and Timasheff, S. N. (1975). Structural stabili^ of calf brain microtubule protein. Ann. NY Acad. Sci. 253,284-291. Lewis, S. A., Wang, D., and Cowan, N. J. (1988). Microtubule-associated protein MAP-2 shares a microtubule binding motif with tau protein. Science 242, 936-939. L'Hemault, S. W., and Rosenbaum, J. L. (1983). Chlamydomonas alpha tubulin is posttranslationally modified in die flagella during flagellar assemby. J. Osll Biol. 97,258-263. Lieuvin, A., Labba, Jean-C., Dorae, M., and Job, D. (1994). Intrinsic microtubule stability in interphase cells. J. Cell Biol. 124, 985-996. Linck, R. W., and Langevin, G. L. (1981). Reassembly of flagellar B(aP) tubulin into singlet microtubules; Consequences for cytoplasmic microtubule structure and assembly. J. Cell Biol. 89,323-337. Littauer, U. Z-, Giveon, D., Thierauf, M., Ginzburg, I., and Ponstingl, H. (1986). Common and distinct tubulin binding sites for microtubule-associated proteins. Proc. Nad. Acad. Sci. USA 83,7162-7166. Litde, M., and Seehaus, T. (1988). Comparadve analysis of tubulin sequences. Comp. Biochem. Physiol. 90B, 655-670. Liu, B., Joshi, H. C., Wilson, T. J., Silflow, C. D., Palevitz, B. A., and Snustad, D. P. (1994). Gamma-tubulin in Arabidopsis: Gene sequence, immunoblot, and immunofluorescence studies. Plant CeU 6 ,303-314. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and RandaU, R. J. (1951). Protein measurement with the folin phenol reagent J. Biol. Chem. 193, 265-275. Lu, Q., and Luduena, R. F. (1994). In vitro analysis of microtubule assembly of isotypicaUy pure tubulin dimers. J. Biol. Chem. 269,2041-2047. Luduena, R. F., Banetjee, A., and Khan, I. A. (1992). Tubulin structure and biochemistry. Curr. Opin. CeU Biol. 4 , 53-57. MacRae, T. H. (1992). Towards an understanding of microtubule function and ceU organization : An overview. Biochem. CeU Biol. 70, 835-841. Makowski, L. (1995). Electron crystallography: Taxol found on tubulin. Nature 375, 361-362. 150 Mandelkow, E-M., Schultheiss, R., Rapp, R., Muller, M., and Mandelkow, E. (1986). On the surface lattice of microtubules: Helix starts, protofilament number, seam, and handedness. J. Cell Biol. 102,1067-1073. Mandelkow, E.-M., Mandelkow, E., and Milligan, R. A. (1991). Microtubule dynamics and microtubule caps: A time-resolved cryo-electron microscopy study. J. CeU Biol. 114, 977-1003. Margolis, R. L., and Wilson, L. (1981). Microtubule treadmills-possible molecular machinary. Nature 293,705-711. May, G. S. (1989). The highly divergent ^-tubulins of Aspergillus nidulans are functionaUy interchangeable. J. CeU Biol. 109,2267-2274. May, G. S., Gambino, J., Weatherbee, J. A., and Morris, N. R. (1985). Identification and functional analysis of beta-tubulin genes by site specific integrative transformation in nidulans. J. CeU Biol. 101,712-719. May, G. S., Tsang, M. L.-S., Smith, H., Fidel, S., and Morris, N. R. (1987). Aspergillus nidulans p-tubuUn genes are unusually divergent. Gene 55, 231-243. May, G. S., and Morris, N. R (1988). Developmental regulation of a conidiation specific p-tubulin in Aspergillus nidulans. Develop. Bio. 128, 406-414. Mazia, D. (1984). Centrosomes and mitotic poles. Exptl. CeU Res. 153,1-15. McEwen, B., and Edelstein, S. (1980). Evidence for a mixed lattice in microtubules reassembled in vitro. J. MoL Biol. 139,123-145. McIntosh, J. R. (1983). The centrosome as an organizer of the cytoskeleton. Mod. CeU Biol. 2,115-142. McIntosh, J. R., and Koonce, M. P. (1989). Mitosis. Science 246,622-628. MejiUano, M. R., Tolo, E. T., WiUiams, R. C., and Himes, R. H. (1992). The conversion of tubulin carboxyl groups to amides has a stabUizing effect on microtubules. Biochem. 31, 3478-3483. Melki, R., CarUer, M. P., Pantaloni, D., and Timasheff, S. N. (1989). Cold depolymerization of microtubules to double rings: Geometric stabilization of assembUes. Biochem. 28,9143-9152. Mitchison, T. J. (1993). LocaUzation of an exchangeable GTP binding site at the plus end of microtubules. Science 261,1044-1047. 151 Mitchison, T., and Kirschner, M. (1984a). Dynamic instability of microtubule growth. Nature 372, 237-242. Mitchison, T., and Kirschner, M. (1984b). Microtubule assembly nucleated by isolated centrosomes. Nature 312, 232-237. Morris, N. R., Lai, M. H., and Oakley, C. E. (1979). Identification of a gene for a-tubulin in Aspergillus nidulans. Cell 16,437-442. Na, G. C., and Timasheff, S. N. (1986). Interaction of vinblastine with calf-brain tubulin: Effect of magnesium ions. Biochem. 25,6222-6228. Nath, J. P., and Himes, R. H. (1986). Localization of the exchangeable nucleotide binding domain in B-tubulin. Biochem. Biophys. Res. Commun. 135,1135-1143. Neff, N. F., Thomas, J. H., Grisafi, P., and Botstein, D. (1983). Isolation of the P-tubulin gene from yeast and demonstration of its essential function in vivo. Cell 33,211-219. Nogales, E., Wolf, S. G., and Downing, K. H. (1996). A high resolution 3-D map of tubulin. Mol. Biol. Cell 7,43a. Nogales, E., Wolf, S. G., Khan, I. A., Luduena, R. P., and Downing, K. H. (1995). Structure of tubulin at 6.5 Â and location of the taxol-binding site. Nature 375, 424-427. Oakley, B. R. (1992). Gamma-tubulin: the microtubule organizer? Trends in Cell Biology 2,1-5. Oakley, B. R. (1995). A nice ring to the centrosome. Nature 378,555-556. Oakley, B. R., and Morris, N. R. (1980). Nuclear movement is P-tubulin-dependent in Aspergillus nidulans. (]ell 19, 255-262. Oakley, B. R., and Morris, N. R. (1981). A P-tubulin mutation in Aspergillus nidulans that blocks microtubule Amction without blocking assembly. Cell 24, 837-845. Oakley, B. R., Oakley, C. E., and Rinehart, J. E. (1987). Conditionally lethal tub A a-tubulin mutations in Aspergillus nidulans. Mol. Gen. Genet. 208, 135-144. Oakley, B. R., Oakley, C. E., Yoon, Y., and Jung, M. K. (1990). y tubulin is a component of the spindle-pole-body that is essential for microtubule function in Aspergillus nidulans. CeU 61,1289-1301. 152 Oakley, C. E„ Weil, C. F., Kretz, P. L., and Oakley, B. R. (1987). Cloning of the riboB locus of Aspergillus nidulans. Gene 53, 293-298. Oakley, C. E., and Oakley, B. R. (1989). Identification of y-tubulin, a new member of the tubulin superfamily encoded by mipA gene of Aspergillus nidulans. Nature 338, 662-664. O'Brien, E. T., Salmon, E. D., Walker, R. A., and Erickson, H. P. (1990). Effects of magnesium on the dynamic instability of individual microtubules. Biochem. 29, 6648-6656. Ohta, N., Nagashima, H., Kawano, S., and Kuroiwa, T. (1992). Isolation of the chloroplast DNA and the sequence of the tmK gene from Cyanidium caldarium strain RK-1. Plant CeU Physiology 33, 657-661. Palmer, J. D., and Logsdon, J. M., Jr. (1991). The recent origins of introns. Curr. Opin. (3en. Dev. 1 ,470-477. Panda, D., Miller, H. P., Banerjee, A., Luduena, R. P., and Wilson, L. (1994). Microtubule dynamics in vitro are regulated by the tubulin isotype composition. Proc. Natl. Acad. Sci. USA 91,11358-11362. Parker, S. K., and Detrich, H. W. (1996). A vertebrate alpha-tubulin gene cluster. Mol. BioL CeU 7,45a. Pearson, R. C. M., and Bums, R. G. (1993). Cyanidium caldarium, a thermophilic eucaryote: The cells, the tubulin, and the alpha-tubulin gene. Mol. Biol. CeU 45,262a. Pickett-Heaps, J. D. (1969). The evolution of the mitotic apparatus: an attempt at comparative ultrastructural cytology in dividing plant ceUs. Cytobios 3, 257-280. Pierson, G. B., Burton, P. R., and Himes, R. H. (1978). Alteration in numbers of protofUaments in microtubules assembled in vitro. J. CeU Biol. 76,223-228. Pipemo, G., LeDizet, M., and Chang, X. J. (1987). Microtubules containing acetylated alpha-tubulin in mammalian ceUs in culture. J. CeU Biol. 104, 289-301. Pontecorvo, G. (1953). The genetics of Aspergillus nidulans. Adv. Genetics 5, 141-238. Pryer, N. K., Walker, R. A., Skeen, V. P., Bourns, B. D., Soboeiro, M. P., and Salmon, E. D. (1992). Brain microtubule-associated proteins modulate 153 microtubule dynamic instability in vitro. Real-time observations using video microscopy. J. Cell Sci. 103, 965-976. Raff, E., C. (1994). The Role of Multiple Tubulin Isoforms in Cellular Microtubule Function. In Microtubules, J. Hyams S, and C. Lloyd W, eds. (New York: Wiley-Liss), pp. 85-109. Rao, S., Krauss, N. E., Heerding, J. M., Swindell, C. S., Ringel, I., Orr, G. A., and Horwitz, S. B. (1994). 3'-(p-Azidobenzamido)taxol photolabels the N-terminal 31 amino acids of P-tubulin. J. Biol. Chem. 269,3132-3134. Redeker, V., Levilliers, N., Schmitter, J. M., Le Caer, J. P., Rossier, J., Addoutte, A., and Bre, M. H. (1994). Polyglycylation of tubulin: A posttranslational modification in axonemal microtubules. Science 266,1688-1691. Rigano, C., and Violante, U. (1972). Effect of heat treatment on the activity in vitro of nitrate reductase firom Cyanidium caldarium. Biochim. Biophys. Acta. 256, 524-532. Roberts, J. R., Rowinski, E. K., Donehower, R. C., Robertson, J., and Allison, D. C. (1989). Demonstration of die cell cycle positions of taxol-induced "asters” and "bundles" by sequential measurements of tubulin immunofluorescence, DNA content, and autoradiographic labeling of taxol-sensitive and -resistant cells. J. Histochem. Cytochem. 3 7 ,1659-1665. Robinson, J., and Engelborghs, Y. (1982). Tubulin polymerization in dimethyl sulfoxide. J. Biol. Chem. 257,5367-5371. Rowinski, E. K., Donehower, R. C., Jones, R. J., and Tucker, R. W. (1988). Microtubule changes and cytotoxicity in leikemic cell lines treated with taxol. Cancer Res. 4 8 ,4093-4100. Rowinski, E. K., Cazenave, L, A., and Donehower, R. C. (1990). Taxol: A novel investigational antimicrotubule agent. J. Natl. Cancer Inst. 82, 1247-1259. Sage, C. R., Dougherty, C. A., Davis, A. S., Bums, R. G., Wilson, L., and FarreU, K. W. (1995). Site-directed mutagenesis of putative GTP-binding sites of yeast beta-tubulin: Evidence that alpha- beta- and gamma-tubulins are atypical GTPases. Biochem. 34, 7409-7419. Salmon, E. D., Leslie, R. J., Saxton, W. M., Karow, M. L., and McIntosh, J. R. (1984). Spindle microtubule dynamics in sea urchin embryos:analysis using a fluorescein labeled tubulin and fluorescence redistribution after laser photobleaching. J. Cell Biol. 99,2165-2174. 154 Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual, 2nd ed. (Cold Spring Harbor: Cold Spring Harbor Laboratory Press). Saxton, W. M., Stren^le, D. L., Leslie, R. J., Salmon, E. D., Zavortinik, M., and McIntosh, J. R. (1984). Tubulin dynamics in cultured mammalian cells. J. Cell Biol. 99,2175-2186. Schatz, P. J., Pillus, L., Grisafi, P., Solomon, F., and Botstein, D. (1986). Two functional a-tubulin genes of the yeast Saccharomyces cerevisiae encode divergent proteins. Mol. Cell. Biol. 6,3711-3721. Scheele, R. B., Bergen, L. G., and Borisy, G. G. (1982). Control of the structural fidelity of microtubules by initiation sites. J. Mol. Biol. 154,485-500. Schiff, P., and Horwitz, S. (1980). Taxol stabilizes microtubules in mouse fibroblast cells. Proc. Natl. Acad. Sci. USA 77,1561-1565. Schiff, P. B., Fant, J., and Horwitz, S. B. (1979). Promotion of microtubule assembly in vitro by taxol. Nature 277, 665-667. Schmidbauer, S. B., and Strobel, O. K. (1996). Rapid purification of histidine-tagged glutathione S-transferase fusion protein by metal chelate perfusion chromatography. Application note, Boehringer Mannheim. Schulze, E., and Kirschner, M. (1986). Microtubule dynamics in interphase cells. J. CeU Biol. 102,1020-1031. Schulze, E., Asai, D. J., Bulinski, J. C., and Kirschner, M. (1987). Posttranslational modification and microtubule stability. J. CeU Biol. 105,2167- 2177. Schulze, E., and Kirschner, M. (1987). Dynamic and stable populations of microtubules in ceUs. J. CeU Biol. 104, 277-288. Scott, J., and Broadwater, S. (1990). CeU division. In Biology of the red algae. Cole, K. M., and Sheath, R. G. (eds.). Cambridge University ftess (Cambridge), pp. 123-146. Seckback, J., Hammerman, I. S., and Hanania, J. (1981). Ultrastructural studies of Cyanidium caldarium: Contribution to phylogenesis. Ann. N. Y. Acad. Sci. 361, 409-425. Serrano, L., De La Torre, J., Maccioni, R. B., and AvUa, J. (1984). Involvement of the Carboxyl-terminal domain of tubuUn in the regulation of its assembly. Proc. Natl. Acad. Sci. USA 81,5989-5993. 155 Sharma, J., and Luduena, R. F. (1994). Use of N,N'-poIyniethylenebis(iodoacetamide) derivatives as probes for the detection of conformational differences in tubulin isotypes. J. Frol Chem. 75,165-176. Sheir-Neiss, G., Lai, M. H., and Morris, N. R. (1978). Identification of a gene for P-tubulin in Aspergillus nidulans. Cell 15,639-647. Shelanski, M. L., Gaskin, F., and Cantor, C. R. (1973). Microtubule assembly in the absence of added nucleotide. Proc. Natl. Acad. Sci. USA 70,765-768. Singleton, R., and Amelunxen, R. E. (1973). Proteins from thermophilic organisms. BacL reviews 57,320-342. Sloboda, R. D., Rudolph, S. A., Rosenbaum, J. L., and Greengard, P. (1975). Cyclic AMP-dependent endogenous phosphorylation of a microtubule-associated protein. Proc. Natl. Acad. Sci. USA 72,177-181. Smucker, R. A., and Pfister, R. M. (1975). Liquid nitrogen cryo-impacting; a new concept for cell disruption. Appl. Microbiol. 30, 445-449. Song, Young-H., and Mandelkow, E. (1993). Recombinant kinesin motor domain binds to beta-tubulin and decorates microtubules with a B surface lattice. Proc. NatL Acad. Sci. USA 90,1671-1675. Song, Young-H., and Mandelkow, E. (1995). The anatomy of flagellar microtubules: Polarity, seam, junctions and lattice. J. Cell Biol. 128,81-94. Spiegelman, B. M., Penningroth, S. M., and Kirschner, M. W. (1977). Turnover of tubulin and the N site GTP in Chinese hamster ovary cells. Cell 12,587-600. Steams, T., and Kirschner, M. (1994). In vitro reconstitution of centrosome assembly and function: The centnd role of y-tubulin. Cell 76, 623-637. Sullivan, K. F. (1988). Structure and utilization of tubulin isotypes. Ann. R. CeU Biol. 4,687-716. Summerton, J., Atkins T., and Bestwic, R. (1983). A rapid method for preparation of bacterial plasmids. Analyt Biochem. 133, 79-84. Telzer, B. R., and Haimo, L. T. (1981). Decoration of spindle microtubules with dynein: Evidence for uniform polarity. J. CeU Biol. 89,373-378. Thomashow, L. S., Milhausen, M., Rutter, W. J., and Agabian, N. (1983). Tubulin genes are tandemly linked and clustered in the genome of Trypanosoma brucei. CeU 52, 35-43. 156 Tilney, L., G, Bryan, J., Busch, D., J, Fujiwaia, K., Mooseker, M., S, Mui^Ay, D., B, and Synder, D., H (1973). Microtubules: evidence for 13 protofilaments. J. CeU Biol. 59,267-275. Turner, P. F., and Margolis, R. L. (1984). Taxol-induced bundling of brain-derived microtubules. J. Cell Biol. 99,940-946. Uppuluri, S., Knipling, L., Sackett, D. L., and Wolff, J. (1993). Localization of the colchicine-binding site of tubulin. Proc. Natl. Acad. Sci. USA 90, 11598-11602. Vale, R. D., Coppin, C. M., Malik, F., KuU, F. J., and MiUigan, R. A. (1994). Tubulin GTP hydrolysis influences the structure, mechanical properties, and kinesin-driven transport of microtubules. J. Biol. Cîhem. 269,23769-23775. VaUee, R. B. (1982). A taxol-dependent procedure for the isolation of microtubules and microtubule-associated proteins (MAPs). J. CeU Biol. 92, 435-442. Wade, R. H., Chretien, D., and Job, D. (1990). Characterization of microtubule protoûlament numbers. How does the surface lattice accomodate? J. Mol. Biol. 212, 775-786. Walker, R. A. (1995). ncd and kinesin motor domains interact with both alpha- and beta-tubulin. Proc. Natl. Acad. Sci. USA 92,5960-5964. Walker, R. A., O'Brien, E. T., Pryer, N. K., Soboeiro, M. F., Voter, W. A., Erickson, H. P., and Salmon, £. D. (1988). Dynamic instabiUty of individual microtubules analyzed by video light-microscopy—rate constants and transition frequencies. J. CeU Biol. 107,1437-1448. Walker, R. A., Inoue, S., and Salmon, E. D. (1989). Asymmetric behavior of severed microtubules after ultraviolet-microbeam irradiation of individual microtubules in vitro. J. CeU Biol. 108,931-937. Waring, R. B., May, G. S., and Morris, N. R. (1989). Characterization of an inducible expression system in Aspergillus nidulans using alcA and tubulin-coding genes. Gene 79,119-130. Weatherbee, J. A., and Morris, N. R. (1984). Aspergillus contains multiple tubulin genes. J. Biol. Chem. 259,15452-15459. Weatherbee, J. A., May, G. S., Gambino, J., and Morris, N. R. (1985). Involvement of a particular species of beta-tubulin (Beta 3) in conidial development in Aspergillus nidulans. CeU J. Biol. 101,706-711 157 Webster, D. R., Wehland, J., Weber, K., and Borisy, G. G. (1990). Detyrosinatioa of alpha tubuUn does not stabilize microtubules in vivo. J. Cell Biol. 7/7, 113-122. Wehland, J., and Weber, K. (1987). Turnover of the carboxy-tenninal tyrosine of alpha-tubulin and means of reaching elevated levels of detyrosination in Uving cells. J. Cell Sci. 8 8185-203. , Weil, C. F., Oakley, C. E., and Oakley, B. R. (1986). Isolation of mip (microtubule-interacting protein) mutations of Aspergillus nidulans. Mol. (Dell. Biol. 6, 2963-2968. Weingarten, M. D., Lockwood, A. H., Hwo, S.-H., and Kirschner, M. W. (1975). A protein factor essential for microtubule assembly. Proc. Natl. Acad. Sci. USA 72, 1858-1862. Weisenberg, R. C., Borisy, G. G., and Taylor, E. W. (1968). The colchicine binding protein of mammalian brain and its relation to microtubules. Biochem. 7, 4466-4478. Weisenberg, R. C. (1972). Microtubule formation in vitro in solutions containing low calcium concentrations. Science 777,1104-1105. Wilson, L. (1970). Properties of colchicine binding protein from chick embryo brain. Interactions with vinca alkaloids and podophyllotoxin. Biochem. 9, 4999-5007. Wilson, L., and Jordan, M. A. (1994). Pharmacological probes of microtubule function. In Microtubules, Modem (Zell Biology ed., J. S. Hyams, and C. W. Lloyd, eds. (New Yoik; Wiley-Liss, Inc.), pp. 59-84. Wise, D., and Oakley, B. R. (1995). Identification of a second gamma-tubulin gene in Homo sapiens. Mol. Biol. Cell 6 ,39a. Yoon, Y., and Oakley, B. R. (1995). Purification and characterization of assembly-competent tubulin from Aspergillus nidulans. Biochem. 34, 6373-6381. Zheng, Y., Oakley, C. E., and Oakley, B. R. (1991). Identification of a second gamma-tubulin gene in Drosophila melanogaster. J. Cell Biol. 7755, 382a. 23ieng, Y., Wong, M. L., Alberts, B., and Mitchison, T. (1995). Nucléation of microtubule assembly by a y-tubulin-containing ring complex. Nature 378, 578-583. 158