A Gephyrin-Related Mechanism Restraining Glycine Receptor Anchoring at Gabaergic Synapses

1398 • The Journal of Neuroscience, February 11, 2004 • 24(6):1398–1405 Cellular/Molecular A Gephyrin-Related Mechanism Restraining Glycine Receptor Anchoring at GABAergic Synapses Jochen Meier and Rosemarie Grantyn Developmental Physiology, Johannes Mu¨ller Institute, Humboldt University Medical School (Charite´), D-10117 Berlin, Germany Spinal cord neurons release glycine and GABA and accumulate glycine receptors (GlyRs) and GABAA receptors in the same postsynaptic densities. In contrast, supramedullar neurons prefer GABA as a neurotransmitter and exclude GlyRs from postsynaptic anchoring. The general aim of the present study was to elucidate the mechanisms underlying transmitter-appropriate receptor accumulation at inhibitory synapses. Specifically, we intended to clarify the molecular basis for the prohibition of GlyR accumulation in the postsynaptic densities of GABAergic synapses. A green fluorescent protein (GFP)-tagged gephyrin-binding loop of the GlyR ␤ subunit (GFP::␤L) was used as a surrogate for full-length receptors to characterize the GlyR binding capacity of postsynaptic gephyrins in transfected neurons. Both in spinal cord neurons (SCNs) and hippocampal neurons (HNs) GFP::␤L distribution displayed transmitter specificity; i.e., postsynaptic accumulation of GFP::␤L was high opposite terminals able to release glycine and low opposite purely GABAergic terminals. When comparing SCN and HN cultures we found that the level of mRNA coding for gephyrin splice variants containing the cassette C5 (C5-gephyrins) was significantly higher in HNs. In HNs depleted of C5-gephyrins, both GFP::␤L and endogenous GlyRs accumulated at postsynaptic GABAergic sites. Accordingly in SCNs, GFP-tagged C5-gephyrin displayed a preferential postsynaptic accumulation opposite GABAergic synapses. Comparison of glycinergic, mixed, and GABAergic synapses in SCNs showed that the degree of GlyR accumulation was inversely related to the amount of postsynaptic C5-gephyrin. These results identify the C5 splice variant of gephyrin as a factor regulating the transmitter-appropriate degree of GlyR accumulation at inhibitory synapses. Key words: gephyrin; splicing; glycine receptor; transfection; spinal cord; hippocampus; anchoring Introduction ceptors closely matches the transmitter phenotype of presynaptic Glycine and GABA are the two major inhibitory neurotransmit- terminals. A long-standing question is how this alignment be- ters in the CNS. They share the vesicular inhibitory amino acid tween presynaptic and postsynaptic sites is achieved (Nicoll and transporter (VIAAT) (McIntire et al., 1997; Sagne´ et al., 1997; Malenka, 1998). One way to address this question is to analyze Gasnier, 2000) but use distinct plasma membrane transporters. postsynaptic changes associated with a developmental switch Glycine transport into presynaptic terminals is performed by the from one inhibitory neurotransmitter to another (Meier et al., neuronal glycine transporter isoform GlyT2 (Zafra et al., 1995a), 2002). In superior colliculus cultures, inhibitory synapses ini- whereas GABA transport is mediated by the neuronal GABA tially release glycine; later on they release GABA. At either devel- transporter (Radian et al., 1990). Presynaptic GABA levels also opmental stage, postsynaptic receptor accumulation of the ap- depend on the activity of the GABA-synthesizing enzyme glu- propriate receptor matched the transmitter phenotype, and this tamic acid decarboxylase (GAD) (Soghomonian and Martin, coincided with an upregulation of a particular gephyrin isoform. 1998). The presence of GlyT2 or GAD, or both, is taken as a Gephyrin is a glycine receptor (GlyR)-tubulin-bridging mol- criterion to assign a transmitter phenotype to presynaptic termi- ecule, initially purified in association with the GlyR ␤ subunit. It nals. In spinal cord neurons (SCNs), inhibitory terminals release is composed of two domains that are homologous to the bacterial either glycine or GABA, or both transmitters (Jonas et al., 1998). MogA and MoeA proteins (see Fig. 1A). A high degree of gephy- Rostral to the medulla, the predominant neurotransmitter is rin diversity (see Fig. 1B) is generated by insertion of cassettes GABA (Luhmann and Prince, 1991; Beaulieu et al., 1994; Zafra et C1–C6 (Meier et al., 2000a; David-Watine, 2001; Reiss and John- al., 1995a). son, 2003). The resulting functional diversity of gephyrins has As a rule, postsynaptic accumulation of neurotransmitter re- recently attracted considerable attention (Butler et al., 2000; Reiss et al., 2001; Rees et al., 2003). In developing collicular cultures, Received June 19, 2003; revised Dec. 10, 2003; accepted Dec. 10, 2003. the disappearance of GlyRs from inhibitory synapses was associ- This work was supported by the Deutsche Forschungsgemeinschaft (Grant SFB 515 B2 to R.G.). We express our gratitude to our colleagues H. Betz and A. Rodriguez-Tebar for valuable suggestions and critical reading of this ated with increased expression of gephyrin isoforms containing manuscript. We thank U. Neumann for excellent technical assistance. the cassette C5 (C5-gephyrins). Glutathione S-transferase pull- CorrespondenceshouldbeaddressedtoDr.JochenMeier,DevelopmentalPhysiology,JohannesMu¨llerInstitute, down assays showed that C5-gephyrins failed to interact with the Humboldt University Medical School (Charite´), Tucholskystrasse 2, D-10117 Berlin, Germany. E-mail: gephyrin-binding loop of the GlyR ␤ subunit (Meier et al., [email protected]. DOI:10.1523/JNEUROSCI.4260-03.2004 2000a); however, the MogA-homologous domain, where C5 is Copyright © 2004 Society for Neuroscience 0270-6474/04/241398-08$15.00/0 inserted, may not be involved directly in GlyR ␤ subunit binding Meier and Grantyn • Transmitter-Appropriate Postsynaptic GlyR Anchoring J. Neurosci., February 11, 2004 • 24(6):1398–1405 • 1399 (Sola et al., 2001). This is consistent with the location of the GlyR tides were designed according to the complementary cDNA sequence. ␤ subunit binding domain within the C-terminal part (see Fig. Oligonucleotides were tetramethylrhodamine-5-(and-6-)isothiocy- 1A) of gephyrin (Rees et al., 2003). The MogA-homologous do- anate(TRITC) labeled at 5Ј, ensuring that only sense or antisense oligo- main triggers trimerization, whereas the MoeA-homologous re- nucleotide-containing neurons were visualized. Three concentrations gion mediates assembly into dimers (Xiang et al., 2001). To- (5, 50, and 500 nM) of sense or antisense oligonucleotides were applied to co-transfect neurons together with GFP::␤L. Finally, the effect of C5 gether, the MogA- and MoeA-homologous domains orchestrate antisense co-transfection on C5-mRNA depletion was verified by the assembly of a highly ordered hexagonal protein lattice struc- RT-PCR. ture (Xiang et al., 2001). Antibodies. The monoclonal antibodies (mAbs) used in this study rec- Depending on the actual pattern of gephyrin isoforms in the ognized gephyrin [mAb7a, 1:200 (Pfeiffer et al., 1984); Alexis Biochemi- postsynaptic neurons, GlyR stabilization might be either pro- cals, San Diego, CA], GAD65 [1:100 (Gottlieb et al., 1986); Chemicon, moted or hindered; however, the possibility of a dual regulation Temecula, CA], and GlyRs [mAb2b, 1:50, mAb4a, 1:50; Alexis Biochemi- of receptor access to postsynaptic densities has not yet received cals]. The polyclonal antibodies (pAbs) were guinea pig anti-VIAAT much consideration. Therefore the aim of the present study was [1:800 (Dumoulin et al., 1999); Chemicon], sheep anti-GlyT2 [1:200 (1) to further clarify the function of C5-gephyrins at inhibitory (Zafra et al., 1995a); Acris GmbH, Hiddenhausen, Germany], and rabbit synapses and (2) to test the hypothesis that, depending on its anti-GAD65/67 [1:500, Chemicon]. For double- and triple-labeling ex- periments, mAbs and pAbs were always combined. Secondary antibodies molecular structure, postsynaptic gephyrins may either facilitate were carboxymethyl indocyanine, fluorescein isothiocyanate, or Alexa or suppress GlyR binding and in this way contribute to Fluor 350 coupled and purchased from Jackson ImmunoResearch Lab- transmitter-appropriate GlyR localization. oratories (West Grove, PA), and Molecular Probes (Eugene, OR), respectively. Materials and Methods Immunocytochemistry and quantification. Immunofluorescence was cDNA constructs. Total RNA and cDNA were obtained as described performed as described previously (Meier et al., 2002). Images were ac- ϫ (Meier et al., 2002). For the green fluorescent protein (GFP)-tagged quired using a standard epifluorescence microscope (objective 100 ; gephyrin-binding loop of the GlyR ␤ subunit construct (GFP::␤L), PCR Axiovert, Carl Zeiss, Oberkochen, Germany), a 12-bit cooled CCD cam- amplimers corresponding to the gephyrin-binding loop of the GlyR ␤ era (Ch250, Photometrics, Tucson, AZ), and the software PMIS 4.1.4 subunit (␤L) were prepared from rat spinal cord cDNA using oligo- (Remington, Munich, Germany). Appropriate filters (XF22, XF32, nucleotides (5Ј-3Ј) GGGAGATCTAAAAGGGTTGAAGCTGAG and XF110–2, XF136–2; Omega Optical Inc., Brattleboro, VT) allowed the GGGGAATTCTCATCTTGCATAGAGGTCAATGC. After subcloning detection and separation of fluorescent signals. To show that the labeling (using BglII and EcoRI) into the plasmids (Clontech, Palo Alto, CA) was caused specifically by the primary antibody, we replaced it with pEGFP-C1 and pDsRed2-C1, respectively, the final constructs were ver- similarly diluted normal serum from the same species. To distinguish ified by DNA sequencing. The GFP-tagged

Load more