DOCSLIB.ORG

The Endosome Is a Master Regulator of Plasma Membrane Collagen Fibril Assembly

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Endosome Is a Master Regulator of Plasma Membrane Collagen Fibril Assembly bioRxiv preprint doi: https://doi.org/10.1101/2021.03.25.436925; this version posted March 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The endosome is a master regulator of plasma membrane collagen fibril assembly 1Joan Chang*, 1Adam Pickard, 1Richa Garva, 1Yinhui Lu, 2Donald Gullberg and 1Karl E. Kadler* 1Wellcome Centre for Cell-Matrix Research, Faculty of Biology, Medical and Health, University of Manchester, Michael Smith Building, Oxford Road, Manchester M13 9PT UK, 2Department of Biomedicine and Center for Cancer Biomarkers, Norwegian Center of Excellence, University of Bergen, Norway. * Co-corresponding authors: JC email: [email protected] (orcid.org/0000-0002-7283- 9759); KEK email: [email protected] (orcid.org/0000-0003-4977-4683) Keywords: collagen-I, endocytosis, extracellular matrix, fibril, fibrillogenesis, integrin-a11, trafficking, VPS33b, [abstract] [149 word max] Collagen fibrils are the principal supporting elements in vertebrate tissues. They account for 25% of total protein mass, exhibit a broad range of size and organisation depending on tissue and stage of development, and can be under circadian clock control. Here we show that the remarkable dynamic pleomorphism of collagen fibrils is underpinned by a mechanism that distinguishes between collagen secretion and initiation of fibril assembly, at the plasma membrane. Collagen fibrillogenesis occurring at the plasma membrane requires vacuolar protein sorting (VPS) 33b (which is under circadian clock control), collagen-binding integrin-a11 subunit, and is reduced when endocytosis is inhibited. Fibroblasts lacking VPS33b secrete soluble collagen without assembling fibrils, whereas constitutive over-expression of VPS33b increases fibril number with loss of fibril rhythmicity. In conclusion, our study has identified the mechanism that switches secretion of collagen (without forming new fibrils) to new collagen fibril assembly, at the plasma membrane. A primary function of vertebrate cells is to synthesise the matrisome, which is an ensemble of 1000+ genes encoding extracellular matrix (ECM) and ECM-associated proteins 1. The ECM, which can account for up to 70% of the mass of vertebrates, is essential for metazoan development because it provides attachment sites for cell migration and provides biomechanical support and protection against crushing and tensile forces. However, synthesis of the matrisome is, in itself, insufficient to generate a functional ECM; scaffolding proteins, such as collagens, are assembled into defined numbers of elongated fibrils that are organised into precise three-dimensional architectures 2-4 to give tissues and organs their physical form, polarity, mechanical properties, and adaptability to environmental stimuli. Collagen fibrils are the largest (up to centimetres in length5) protein polymers in vertebrates and account for ~25% of total body protein mass 6. They exhibit a characteristic D- periodic axial banding pattern (where D = 67 nm) 7, are roughly circular in cross section, range in diameter from ~12 nm to ~500 nm 8, and grow in length from their two pointed tips 9,10. Studies in tendon and cartilage have shown that collagen fibrils are synthesised during development 4 and persist throughout life without turnover (in humans 11 and mice 12). Therefore, having the right number, length and organisation of collagen fibrils is critical for normal cell behaviour and tissue health. Collagen can be purified from tissues and reconstituted in neutral buffers to generate fibrils with the same D-periodicity as those that occur in vivo 7. However, the fibrils lack a preferred orientation and the control of fibril number and diameter distribution is lost. Collagen fibril length is difficult to ascertain, either in vivo or in vitro; therefore, it is unknown if the centimetre lengths that are attained in vivo are reproduced in vitro. Considering that collagen can self-assemble into fibrils, but that higher- order assemblies are lost in vitro, implies that cells exert control over the fibril assembly process to 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.25.436925; this version posted March 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. produce tissue-specific matrices. We hypothesised that the endosomal system, with its complex collection of vesicles trafficking between the Golgi and the plasma membrane, could contribute to such a mechanism. Support for this hypothesis comes from a previous report that the assembly of collagen fibrils is under the control of the circadian clock 13 and that vacuolar protein sorting (VPS) 33b (a regulator of SNARE-dependent membrane fusion in the endocytic pathway) is circadian clock regulated. VPS33b forms a distinct complex with VIPAS39 (also known as VIPAR) 14, and mutations in the VPS33B gene cause arthrogryposis-renal dysfunction-cholestasis (ARC) syndrome 15, with death usually occurring within the first year of birth with renal insufficiency, jaundice, multiple congenital anomalies, predisposition to infection, and failure to thrive 16. One proposed disease-causing mechanism is abnormal post-Golgi trafficking of lysyl hydroxylase 3 (LH3, PLOD3), which is essential for collagen homeostasis during development 17. Additional support for tight cellular control of collagen fibril formation comes from electron microscope observations of collagen fibrils at the plasma membrane of embryonic avian and rodent tendon fibroblasts 18,19. Here, one of the two tips of newly-formed collagen fibrils is enclosed within a plasma membrane invagination termed a fibripositor 20. The second tip protrudes into the extracellular matrix. One way in which cells could exert control over collagen fibrillogenesis is by separating initiation of fibril formation (nucleation at the plasma membrane) from longitudinal growth. Nucleation at the plasma membrane would give precise control of fibril number whereas propagation (involving either the proximal or distal tip) would contribute to tissue expansion. However, despite ultrastructural observations, direct mechanistic support for these observations was lacking. Here, we showed that cells lacking VPS33b did not exhibit fibripositors and could not assemble collagen fibrils, which was in contrast to control cells that exhibited fibripositors and assembled fibrils at their plasma membrane. Instead, VPS33B knockout cells secreted soluble collagen and accumulated collagen in intracellular puncta. Using a split-GFP approach, we showed that collagen-I and VPS33b were contained in vesicles below the plasma membrane. We showed using biotin-surface labelling that col5a1 (a critical chain of collagen-V) and integrin-a11 subunit (a collagen-binding integrin involved in collagen reorganisation 21) are absent from the surface of VPS33b knockout cells. Together, these results provide insights into the importance of the endosomal system in orchestrating and regulating the assembly of collagen fibrils at the plasma membrane. Results Collagen-I is endocytosed and reassembled into fibrils As a first experiment, we made Cy3 labelled collagen-I (Cy3-colI) using previously described methods 22 and incubated it with freshly isolated tail tendons for 3 days, then imaged the mid-section of the tendon (Figure 1A). Cells in tendon (nuclei marked with Hoechst stain) show a clear uptake of Cy3-colI within the cytoplasm (Figure 1A, yellow box and indicated by yellow arrowheads). Additionally, fibrillar Cy3 fluorescence signals that transverse between cells were also observed (Figure 1A, grey box and indicated by white arrows). Pulse-chase experiments were performed, where Cy3-colI was added to the tendons for 3 days, followed by 5FAM-colI for a further 2 days (Supplementary Figure 1A). The results confirmed that collagen-I can be taken up by cells regardless of the fluorophore used; additionally, there are distinct areas where only Cy3-positivity was observed (Supplementary 1A, yellow box). The persistence of Cy3-colI indicated that not all collagen endocytosed by cells is directed to degradation. 5FAM-positive fibril-like structures were also observed, suggesting that collagen-I taken up by cells is recycled to the matrix (Supplementary 1A, grey box). Next, we added Cy3-colI to 2 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.25.436925; this version posted March 25, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. cultured tendon fibroblasts. Immunofluorescence staining indicated co-localisation of endogenous collagen-I with Cy3-labelled collagen-I (Figure 1B). Therefore, endocytosed collagen can be repurposed into fibrils without being targeted for degradation. Taken together, these results demonstrated that exogenous collagen-I can be taken up by cells both in vitro and in tendon tissues ex vivo. We considered the possibility that the fluorescent fibril-like structures were the result of Cy3-colI attachment to pre-existing fibres in the extracellular matrix, or to spontaneous cell-free fibrillogenesis. Therefore, we incubated Cy3-colI at concentrations that spanned the 0.4 µg/mL critical concentration for cell-free in vitro fibril formation 23, in the presence and absence of cells (Figure 1C). In the absence of
Load more

Recommended publications
  • C8cc08685k1.Pdf
    Electronic Supplementary Material (ESI) for ChemComm. This journal is © The Royal Society of Chemistry 2018 Supporting Information Minimalist Linkers Suitable for Irreversible Inhibitors in Simultaneous Proteome Profiling, Live-Cell Imaging and Drug Screening Cuiping Guo,Yu Chang, Xin Wang, Chengqian Zhang, Piliang Hao*, Ke Ding and Zhengqiu Li* School of Pharmacy, Jinan University, Guangzhou, China 510632 *Corresponding author ([email protected]) 1. General Information All chemicals were purchased from commercial vendors and used without further purification, unless indicated otherwise. All reactions requiring anhydrous conditions were carried out under argon or nitrogen atmosphere using oven-dried glassware. AR-grade solvents were used for all reactions. Reaction progress was monitored by TLC on pre-coated silica plates (Merck 60 F254 nm, 0.25 µm) and spots were visualized by UV, iodine or other suitable stains. Flash column chromatography was carried out using silica gel (Qingdao Ocean). All NMR spectra (1H-NMR, 13C-NMR) were recorded on Bruker 300 MHz/400 MHz NMR spectrometers. Chemical shifts were reported in parts per million (ppm) referenced with respect to appropriate internal standards or residual solvent peaks (CDCl3 = 7.26 ppm, DMSO-d6 = 2.50 ppm). The following abbreviations were used in reporting spectra, br s (broad singlet), s (singlet), d (doublet), t (triplet), q (quartet), m (multiplet), dd (doublet of doublets). Mass spectra were obtained on Agilent LC-ESI-MS system. All analytical HPLC were carried out on Agilent system. Water with 0.1% TFA and acetonitrile with 0.1% TFA were used as eluents and the flow rate was 0.5 mL/min.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Reprogramming of Trna Modifications Controls the Oxidative Stress Response by Codon-Biased Translation of Proteins
    Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Chan, Clement T.Y. et al. “Reprogramming of tRNA Modifications Controls the Oxidative Stress Response by Codon-biased Translation of Proteins.” Nature Communications 3 (2012): 937. As Published http://dx.doi.org/10.1038/ncomms1938 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/76775 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins Clement T.Y. Chan,1,2 Yan Ling Joy Pang,1 Wenjun Deng,1 I. Ramesh Babu,1 Madhu Dyavaiah,3 Thomas J. Begley3 and Peter C. Dedon1,4* 1Department of Biological Engineering, 2Department of Chemistry and 4Center for Environmental Health Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139; 3College of Nanoscale Science and Engineering, University at Albany, SUNY, Albany, NY 12203 * Corresponding author: PCD, Department of Biological Engineering, NE47-277, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139; tel 617-253-8017; fax 617-324-7554; email [email protected] 2 ABSTRACT Selective translation of survival proteins is an important facet of cellular stress response. We recently demonstrated that this translational control involves a stress-specific reprogramming of modified ribonucleosides in tRNA.
    [Show full text]
  • Dysregulated Hepatic Methionine
    Virginia Commonwealth University VCU Scholars Compass Internal Medicine Publications Dept. of Internal Medicine 2015 Dysregulated Hepatic Methionine Metabolism Drives Homocysteine Elevation in Diet-Induced Nonalcoholic Fatty Liver Disease Tommy Pacana Virginia Commonwealth University, [email protected] Sophie Cazanave Virginia Commonwealth University Aurora Verdianelli Virginia Commonwealth University See next page for additional authors Follow this and additional works at: http://scholarscompass.vcu.edu/intmed_pubs Part of the Medicine and Health Sciences Commons Copyright: © 2015 Pacana et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited Downloaded from http://scholarscompass.vcu.edu/intmed_pubs/98 This Article is brought to you for free and open access by the Dept. of Internal Medicine at VCU Scholars Compass. It has been accepted for inclusion in Internal Medicine Publications by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Authors Tommy Pacana, Sophie Cazanave, Aurora Verdianelli, Viashali Patel, Hae-Ki Min, Faridoddin Mirshahi, Eoin Quinlavin, and Arun J. Sanyal This article is available at VCU Scholars Compass: http://scholarscompass.vcu.edu/intmed_pubs/98 RESEARCH ARTICLE Dysregulated Hepatic Methionine Metabolism Drives Homocysteine Elevation in Diet-Induced Nonalcoholic Fatty
    [Show full text]
  • Global-Scale Analysis of the Dynamic Transcriptional Adaptations Within Skeletal Muscle During Hypertrophic Growth
    University of Kentucky UKnowledge Theses and Dissertations--Physiology Physiology 2015 GLOBAL-SCALE ANALYSIS OF THE DYNAMIC TRANSCRIPTIONAL ADAPTATIONS WITHIN SKELETAL MUSCLE DURING HYPERTROPHIC GROWTH Tyler Kirby University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Kirby, Tyler, "GLOBAL-SCALE ANALYSIS OF THE DYNAMIC TRANSCRIPTIONAL ADAPTATIONS WITHIN SKELETAL MUSCLE DURING HYPERTROPHIC GROWTH" (2015). Theses and Dissertations--Physiology. 22. https://uknowledge.uky.edu/physiology_etds/22 This Doctoral Dissertation is brought to you for free and open access by the Physiology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Physiology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. I agree that the document mentioned above may be made available immediately for worldwide access unless an embargo applies.
    [Show full text]
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • The N-Cadherin Interactome in Primary Cardiomyocytes As Defined Using Quantitative Proximity Proteomics Yang Li1,*, Chelsea D
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs221606. doi:10.1242/jcs.221606 TOOLS AND RESOURCES The N-cadherin interactome in primary cardiomyocytes as defined using quantitative proximity proteomics Yang Li1,*, Chelsea D. Merkel1,*, Xuemei Zeng2, Jonathon A. Heier1, Pamela S. Cantrell2, Mai Sun2, Donna B. Stolz1, Simon C. Watkins1, Nathan A. Yates1,2,3 and Adam V. Kwiatkowski1,‡ ABSTRACT requires multiple adhesion, cytoskeletal and signaling proteins, The junctional complexes that couple cardiomyocytes must transmit and mutations in these proteins can cause cardiomyopathies (Ehler, the mechanical forces of contraction while maintaining adhesive 2018). However, the molecular composition of ICD junctional homeostasis. The adherens junction (AJ) connects the actomyosin complexes remains poorly defined. – networks of neighboring cardiomyocytes and is required for proper The core of the AJ is the cadherin catenin complex (Halbleib and heart function. Yet little is known about the molecular composition of the Nelson, 2006; Ratheesh and Yap, 2012). Classical cadherins are cardiomyocyte AJ or how it is organized to function under mechanical single-pass transmembrane proteins with an extracellular domain that load. Here, we define the architecture, dynamics and proteome of mediates calcium-dependent homotypic interactions. The adhesive the cardiomyocyte AJ. Mouse neonatal cardiomyocytes assemble properties of classical cadherins are driven by the recruitment of stable AJs along intercellular contacts with organizational and cytosolic catenin proteins to the cadherin tail, with p120-catenin β structural hallmarks similar to mature contacts. We combine (CTNND1) binding to the juxta-membrane domain and -catenin β quantitative mass spectrometry with proximity labeling to identify the (CTNNB1) binding to the distal part of the tail.
    [Show full text]
  • Ahnaks Are a Class of Giant Propeller-Like Proteins That Associate with Calcium Channel Proteins of Cardiomyocytes and Other Cells
    The AHNAKs are a class of giant propeller-like proteins that associate with calcium channel proteins of cardiomyocytes and other cells Akihiko Komuro*, Yutaka Masuda*, Koichi Kobayashi, Roger Babbitt, Murat Gunel, Richard A. Flavell, and Vincent T. Marchesi† Departments of Pathology and Immunobiology, Boyer Center for Molecular Medicine, Yale University School of Medicine, New Haven, CT 06510 Contributed by Vincent T. Marchesi, December 31, 2003 To explore the function of the giant AHNAK molecule, first de- mechanisms, one operating at the cell surface in collaboration with scribed in 1992 [Shtivelman, E., Cohen, F. E. & Bishop, J. M. (1992) calcium channels, and the second, PLC activation, which is a process Proc. Natl. Acad. Sci. USA 89, 5472–5476], we created AHNAK null that could potentially take place at multiple points throughout the mice by homologous recombination. Homozygous knockouts cell. showed no obvious phenotype, but revealed instead a second The arrangement of channel proteins at the cell surface is AHNAK-like molecule, provisionally designated AHNAK2. Like the believed to be controlled by multidomain polypeptides known as original AHNAK, AHNAK2 is a 600-kDa protein composed of a large scaffolding proteins that link together activated channels at specific number of highly conserved repeat segments. Structural predic- points on the membrane surface. Scaffolding proteins also coordi- tions suggest that the repeat segments of both AHNAKs may have nate the activities of multienzyme complexes by physically linking as their basic framework a series of linked, antiparallel ␤-strands them together, and as in the case with AHNAK, they are often similar to those found in ␤-propeller proteins.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Mechanisms of Synaptic Plasticity Mediated by Clathrin Adaptor-Protein Complexes 1 and 2 in Mice
    Mechanisms of synaptic plasticity mediated by Clathrin Adaptor-protein complexes 1 and 2 in mice Dissertation for the award of the degree “Doctor rerum naturalium” at the Georg-August-University Göttingen within the doctoral program “Molecular Biology of Cells” of the Georg-August University School of Science (GAUSS) Submitted by Ratnakar Mishra Born in Birpur, Bihar, India Göttingen, Germany 2019 1 Members of the Thesis Committee Prof. Dr. Peter Schu Institute for Cellular Biochemistry, (Supervisor and first referee) University Medical Center Göttingen, Germany Dr. Hans Dieter Schmitt Neurobiology, Max Planck Institute (Second referee) for Biophysical Chemistry, Göttingen, Germany Prof. Dr. med. Thomas A. Bayer Division of Molecular Psychiatry, University Medical Center, Göttingen, Germany Additional Members of the Examination Board Prof. Dr. Silvio O. Rizzoli Department of Neuro-and Sensory Physiology, University Medical Center Göttingen, Germany Dr. Roland Dosch Institute of Developmental Biochemistry, University Medical Center Göttingen, Germany Prof. Dr. med. Martin Oppermann Institute of Cellular and Molecular Immunology, University Medical Center, Göttingen, Germany Date of oral examination: 14th may 2019 2 Table of Contents List of abbreviations ................................................................................. 5 Abstract ................................................................................................... 7 Chapter 1: Introduction ............................................................................
    [Show full text]