DOCSLIB.ORG

Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, And

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, And Volume 86 • Number 12 Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, and Receptor Activator of Nuclear Factor-kB Ligand in Periodontitis Umut Balli,* Ahmet Aydogdu,† Figen Ongoz Dede,* Cigdem Coskun Turer,* and Berrak Guven‡ Background: To investigate changes in the levels and rel- ative ratios of sclerostin, osteoprotegerin (OPG), and recep- tor activator of nuclear factor-kB ligand (RANKL) in the gingival crevicular fluid (GCF) of patients with periodontitis after non-surgical periodontal treatment. Methods: Fifty-four individuals (27 healthy controls and 27 patients with chronic periodontitis [CP]) were enrolled in eriodontal disease is a complex the study. Periodontitis patients received non-surgical peri- biologic process related to the in- odontal therapy. GCF sampling and clinical periodontal pa- Pteraction between groups of mi- rameters were assessed before and 6 weeks after therapy. croorganisms and the host immune/ Sclerostin, OPG, and RANKL levels were measured by enzyme- inflammatory response.1 When the bal- linked immunosorbent assay, and their relative ratios were ance between microbial challenge and calculated. host response is disturbed, periodontal Results: Total amounts and concentrations of sclerostin breakdown (clinical attachment loss [AL] were significantly higher in patients with CP than in healthy and alveolar bone resorption) can oc- individuals (P <0.025) and decreased after treatment cur.1,2 Microorganisms and their prod- (P <0.05). The RANKL/OPG ratio was significantly lower in ucts are the primary etiologic factors that healthy individuals than in patients with periodontitis before directly initiate periodontal disease. and after treatment (P <0.025), but no significant difference However, the majority of periodontal was observed in patients with periodontitis after treatment breakdown is caused by endogenous (P >0.05). The sclerostin/OPG and sclerostin/RANKL ratios proteases (matrix metalloproteinases) were significantly lower in healthy individuals than in patients and inflammatory mediators, such as < with periodontitis before and after treatment (P 0.025) prostaglandin E2 and tumor necrosis anddecreasedinpatientswithperiodontitisaftertreatment factor (TNF)-a, resulting in activation of (P <0.05). the bone resorption mechanism.2,3 The Conclusions: The GCF sclerostin level may be more reli- regulation of bone metabolism is a com- able than the RANKL/OPG ratio as a diagnostic and prognos- plicated process involving diverse signal tic marker of periodontal disease and treatment outcome. transduction pathways.4,5 Clarifying the Regulation of sclerostin levels may aid the development of different mechanisms of coupling be- new therapeutic strategies for the treatment of periodontal tween bone resorption and formation is disease. J Periodontol 2015;86:1396-1404. important for understanding and manag- KEY WORDS ing periodontal disease. The pathway of osteoclast-mediated Gingival crevicular fluid; osteoprotegerin; periodontal bone resorption is closely related to in- diseases; RANK ligand. teraction of the TNF superfamily: 1) re- ceptor activator of nuclear factor-kBligand * Department of Periodontology, Faculty of Dentistry, Bulent Ecevit University, Zonguldak, (RANKL); 2) its receptor, RANK; and 3) its Turkey. † Department of Periodontology, Faculty of Dentistry, Biruni University, Istanbul, Turkey. decoy receptor, osteoprotegerin (OPG). ‡ Department of Medical Biochemistry, Faculty of Medicine, Bulent Ecevit University. RANK is a cell-surface receptor expressed on osteoclast precursors and osteoclasts.4 RANKL is a potent osteoclastogenic factor doi: 10.1902/jop.2015.150270 1396 J Periodontol • December 2015 Balli, Aydogdu, Ongoz Dede, Coskun Turer, Guven expressed in osteoblasts, fibroblasts, lymphocytes, and ratio as a biomarker for periodontal disease activity osteocytes.4-6 It binds directly to RANK on osteoclast and treatment outcomes. The correlations between lineage cells, resulting in osteoclast differentiation and biochemical markers and clinical parameters were activation and thus activating bone resorption.5,6 also tested. The primary efficacy variables were RANKL activity is regulated by OPG produced by bone changes in sclerostin, RANKL, and OPG levels and marrow stromal cells, osteoblasts, and osteocytes.4-6 the RANKL/OPG, sclerostin/OPG, and sclerostin/ OPG acts by binding to RANKL and preventing it from RANKL ratios after periodontal treatment. Second- binding to RANK, thereby inhibiting osteoclastogenesis ary outcome variables were probing depth (PD), and bone resorption.5,6 clinical attachment level (CAL), gingival index (GI), Bone metabolism is also regulated by the Wnt andbleedingonprobing(BOP). (wingless-type MMTV integration site family) signaling pathway, which is composed of 19 secreted glyco- MATERIALS AND METHODS proteins.7,8 The Wnt pathway increases bone forma- Study Population tion and regeneration via stimulation of osteoblast From December 2013 to October 2014, 54 in- development.9,10 Regulation of Wnt signaling is me- dividuals (25 males and 29 females; aged 25 to 49 diated through posttranslational modification of Wnts, years; mean age: 37.59 – 5.30 years) admitted to the receptor regulation, and antagonist binding.11,12 Periodontology Department, Faculty of Dentistry of Sclerostin, a product of the SOST gene, is a secreted Bulent Ecevit University, were enrolled in this study. glycoprotein that binds low-density lipoprotein All individuals provided written informed consent, and receptor-related protein 5 and blocks the Wnt sig- the study protocol was approved by the Ethics naling pathway.13,14 Its expression, which suppresses Committee of Bulent Ecevit University, Zonguldak, osteoblastogenesis and reduces the viability of oste- Turkey (2013-112-01/10). This study is registered at oblasts and osteocytes, leads to unbalanced bone ClinicalTrials.gov as NCT02390479. turnover in favor of bone resorption not only by an- Clinical Examinations and Intraexaminer tagonizing Wnt but also by blocking bone morpho- Reproducibility genetic protein signaling.15,16 A deficiency of PD and CAL were measured, and plaque index (PI), sclerostin leads to sclerosteosis and van Buchem GI, and BOP scores were recorded using a periodontal disease, characterized by high bone mass. Sclerostin probe.§ All clinical examinations (at six different sites is produced by osteocytes, as OPG and RANKL.14 In around each tooth: mesio-buccal, disto-buccal, a broader context, osteocytes are naturally occurring mid-buccal, mesio-lingual, disto-lingual, and mid- modulators of bone metabolism that regulate the lingual), group allocations, sampling site selections, balance between osteoclastic and osteoblastic activ- and GCF collections were performed by the same ity. Sclerostin is a marker of mature osteocytes and investigator (FOD), who was masked with respect to affects bone metabolism by inhibiting osteoblast dif- the study design. Before the actual measurement, ferentiation.17,18 It is believed to act by promoting 10 individuals were selected randomly and used to osteoclast formation via a RANKL-dependent path- calibrate the investigator. The investigator evalu- way and by interacting with osteoblasts.19 At the ated the individuals on two separate occasions, 48 molecular level, osteocytes regulate bone homeo- hours apart. The investigator’s measurements were stasis through at least three key molecules: 1) scle- considered sufficiently reproducible if those taken at rostin; 2) OPG; and 3) RANKL.6,9,20,21 baseline and at 48 hours differed by no more than The roles of OPG and RANKL in periodontal 10% at the millimeter level.22 diseasehavebeenstudiedwidely. However, to the best of the authors’ knowledge, no studies have Inclusion and Exclusion Criteria evaluated changes in sclerostin levels in the gingival Diagnoses were based on the International World crevicular fluid (GCF) of patients with chronic Workshop for a Classification of Periodontal Disease periodontitis (CP) after non-surgical therapy or have and Conditions.23 The selected individuals had investigated the relationship between the RANKL/ a minimum of 20 natural teeth, excluding third mo- OPG ratio and sclerostin in periodontal disease. lars. All individuals underwent radiography and a full- Therefore, the primary objective in this case- mouth periodontal examination including PD, CAL, control intervention study is to explore the effect PI,24 GI,25 and BOP.26 Individuals were categorized of non-surgical periodontal therapy on the GCF into two groups: 1) individuals with a clinically levels of sclerostin in patients with CP to deter- healthy periodontium (group 1; n = 27; 12 males and mine the usefulness of sclerostin as a diagnostic 15 females; aged 35.63 – 4.86 years) and 2) patients and prognostic biomarker of periodontal disease. with generalized CP (group 2A; n = 27; 13 males and As secondary objective, it was examined whether sclerostin was more reliable than the RANKL/OPG § Williams periodontal probe, Hu-Friedy, Chicago, IL. 1397 Sclerostin Levels in Periodontal Health and Disease Volume 86 • Number 12 14 females; aged 39.56 – 5.07 years). After the patients with CP had been treated with scaling and (0) (0) † † root planing (SRP), they were considered as group BOP (%) 2B. Inclusion criteria for the healthy group were GI = 0, PD £3 mm, and no signs of AL and bone loss * by clinical and radiographic examination. Inclusion PI criteria for the CP group were clinical signs of in- flammation (red color and swelling of the gingival margin),
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling
    Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling Maarten van Dinther1, Juan Zhang1, Stella E. Weidauer2, Verena Boschert2, Eva-Maria Muth2, Achim Knappik3, David J. J. de Gorter1, Puck B. van Kasteren1¤, Christian Frisch3, Thomas D. Mueller2, Peter ten Dijke1* 1 Department of Molecular Cell Biology and Centre for Biomedical Genetics, Leiden University Medical Center, Leiden, The Netherlands, 2 Department of Molecular Plant Physiology and Biophysics, Julius-von-Sachs Institut, Wuerzburg, Germany, 3 AbD Serotec, a Bio-Rad company, Puchheim, Germany Abstract Sclerosteosis is a rare high bone mass disease that is caused by inactivating mutations in the SOST gene. Its gene product, Sclerostin, is a key negative regulator of bone formation and might therefore serve as a target for the anabolic treatment of osteoporosis. The exact molecular mechanism by which Sclerostin exerts its antagonistic effects on Wnt signaling in bone forming osteoblasts remains unclear. Here we show that Wnt3a-induced transcriptional responses and induction of alkaline phosphatase activity, an early marker of osteoblast differentiation, require the Wnt co-receptors LRP5 and LRP6. Unlike Dickkopf1 (DKK1), Sclerostin does not inhibit Wnt-3a-induced phosphorylation of LRP5 at serine 1503 or LRP6 at serine 1490. Affinity labeling of cell surface proteins with [125I]Sclerostin identified LRP6 as the main specific Sclerostin receptor in multiple mesenchymal cell lines. When cells were challenged with Sclerostin fused to recombinant green fluorescent protein (GFP) this was internalized, likely via a Clathrin-dependent process, and subsequently degraded in a temperature and proteasome-dependent manner. Ectopic expression of LRP6 greatly enhanced binding and cellular uptake of Sclerostin- GFP, which was reduced by the addition of an excess of non-GFP-fused Sclerostin.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • The Role of BMP Signaling in Osteoclast Regulation
    Journal of Developmental Biology Review The Role of BMP Signaling in Osteoclast Regulation Brian Heubel * and Anja Nohe * Department of Biological Sciences, University of Delaware, Newark, DE 19716, USA * Correspondence: [email protected] (B.H.); [email protected] (A.N.) Abstract: The osteogenic effects of Bone Morphogenetic Proteins (BMPs) were delineated in 1965 when Urist et al. showed that BMPs could induce ectopic bone formation. In subsequent decades, the effects of BMPs on bone formation and maintenance were established. BMPs induce proliferation in osteoprogenitor cells and increase mineralization activity in osteoblasts. The role of BMPs in bone homeostasis and repair led to the approval of BMP 2 by the Federal Drug Administration (FDA) for anterior lumbar interbody fusion (ALIF) to increase the bone formation in the treated area. However, the use of BMP 2 for treatment of degenerative bone diseases such as osteoporosis is still uncertain as patients treated with BMP 2 results in the stimulation of not only osteoblast mineralization, but also osteoclast absorption, leading to early bone graft subsidence. The increase in absorption activity is the result of direct stimulation of osteoclasts by BMP 2 working synergistically with the RANK signaling pathway. The dual effect of BMPs on bone resorption and mineralization highlights the essential role of BMP-signaling in bone homeostasis, making it a putative therapeutic target for diseases like osteoporosis. Before the BMP pathway can be utilized in the treatment of osteoporosis a better understanding of how BMP-signaling regulates osteoclasts must be established. Keywords: osteoclast; BMP; osteoporosis Citation: Heubel, B.; Nohe, A. The Role of BMP Signaling in Osteoclast Regulation.
    [Show full text]
  • Regulation of Osteoblast Differentiation by Micrornas
    MQP-BIO-DSA-7214 REGULATION OF OSTEOBLAST DIFFERENTIATION BY MICRORNAS A Major Qualifying Project Report Submitted to the Faculty of the WORCESTER POLYTECHNIC INSTITUTE in partial fulfillment of the requirements for the Degree of Bachelor of Science in Biology and Biotechnology by _________________________ Mohammad Jafferji April 30, 2009 APPROVED: _________________________ _________________________ Jane Lian, Ph.D. David Adams, Ph.D. Cell Biology Biology and Biotechnology Umass Medical Center WPI Project Advisor Major Advisor i ABSTRACT MicroRNAs (miRs) are non-coding ~22 nucleotide RNAs which attenuate protein levels in the cell and have been shown to be important in regulating mammalian embryo development, tissue morphogenesis, cell growth, and differentiation. Very few studies have examined miRs during bone formation in vivo or during development of the osteoblast phenotype. Osteoblasts produce bone tissue matrix, secreting many proteins that support tissue mineralization. Here we identified and functionally characterized several microRNAs expressed during 3 stages of osteoblast differentiation: undifferentiated, osteoprogenitor, and most differentiated. Our results show that many miRs are gradually upregulated from growth to mineralization, with a more significant increase at the mineralization stage. Database analysis revealed that these miRs target well established pathways for bone formation including Wnt, BMP and MAPK pathways, which must be tightly regulated for normal osteoblast growth and differentiation. Our studies then focused on one representative microRNA, miR-218, which we found directly targets transducer of ERB1 (TOB1) and sclerostin (SOST) (both are negative inhibitors of Wnt signaling) as shown by 3’UTR luciferase reporter assays of each target. This approach demonstrates that miR-218 binds to the complementary 3’ UTR sequence in each target to decrease reporter activity, providing evidence for miR-218 regulation of TOB1 and SOST.
    [Show full text]
  • Sclerostin in Oral Tissues: Distribution, Biological Functions and Potential Therapeutic Role
    Review Article Open Access Journal of Review Article Biomedical Science ISSN: 2690-487X Sclerostin in Oral Tissues: Distribution, Biological Functions and Potential Therapeutic Role Fangyuan Shuai1, Aileen To2, Yan Jing3 and Xianglong Han1* 1State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, China 2Texas A&M College of Dentistry, D3 dental student, USA 3Texas A&M College of Dentistry, Department of Orthodontics, USA ABSTRACT Sclerostin is a well-known osteogenic negative regulator whose biological functions have been widely studied in bone homeostasis. Targeting sclerostin via monoclonal antibodies was shown to be a powerful strategy for bone-related diseases. Traditionally, to osteocytes, there are other cell types in oral tissues that can produce sclerostin. Sclerostin regulates the formation of dental andsclerostin periodontal was known structures as an and osteocyte-specific is also involved inglycoprotein. various physiological However, andin recent pathological studies, events it has in been oral showntissues. thatThus, in sclerostin addition modulation has been determined as a possible treatment strategy for periodontium-related diseases. To develop the therapeutic oral tissues. In this review, we highlight the existing awareness of sclerostin’s functions in oral tissues; the roles it plays in dental and periodontalpotential of sclerostindiseases and and treatments; its antibodies and in the the therapeutic field of dentistry, potential researchers of sclerostin must and clearly its antibodies
    [Show full text]
  • Sostdc1 Regulates NK Cell Maturation and Cytotoxicity
    Published February 27, 2019, doi:10.4049/jimmunol.1801157 The Journal of Immunology Sostdc1 Regulates NK Cell Maturation and Cytotoxicity Alberto J. Millan,* Sonny R. Elizaldi,* Eric M. Lee,* Jeffrey O. Aceves,* Deepa Murugesh,* Gabriela G. Loots,*,† and Jennifer O. Manilay* NK cells are innate-like lymphocytes that eliminate virally infected and cancerous cells, but the mechanisms that control NK cell development and cytotoxicity are incompletely understood. We identified roles for sclerostin domain–containing-1 (Sostdc1)inNK cell development and function. Sostdc1-knockout (Sostdc12/2) mice display a progressive accumulation of transitional NK cells (tNKs) (CD27+CD11b+) with age, indicating a partial developmental block. The NK cell Ly49 repertoire in Sostdc12/2 mice is also changed. Lower frequencies of Sostdc12/2 splenic tNKs express inhibitory Ly49G2 receptors, but higher frequencies express activating Ly49H and Ly49D receptors. However, the frequencies of Ly49I+,G2+,H+, and D+ populations were universally decreased at the most mature (CD272CD11b+) stage. We hypothesized that the Ly49 repertoire in Sostdc12/2 mice would correlate with NK killing ability and observed that Sostdc12/2 NK cells are hyporesponsive against MHC class I–deficient cell targets in vitro and in vivo, despite higher CD107a surface levels and similar IFN-g expression to controls. Consistent with Sostdc1’s known role in Wnt signaling regulation, Tcf7 and Lef1 levels were higher in Sostdc12/2 NK cells. Expression of the NK development gene Id2 was decreased in Sostdc12/2 immature NK and tNK cells, but Eomes and Tbx21 expression was unaffected. Reciprocal bone marrow transplant experiments showed that Sostdc1 regulates NK cell maturation and expression of Ly49 receptors in a cell-extrinsic fashion from both nonhematopoietic and hematopoietic sources.
    [Show full text]
  • The Effect of Parathyroid Hormone on Osteogenesis Is Mediated Partly by Osteolectin Downloaded by Guest on September 28, 2021 INAUGURAL ARTICLE CELL BIOLOGY
    The effect of parathyroid hormone on osteogenesis is INAUGURAL ARTICLE mediated partly by osteolectin Jingzhu Zhanga, Adi Cohenb, Bo Shena, Liming Dua, Alpaslan Tasdogana, Zhiyu Zhaoa, Elizabeth J. Shaneb, and Sean J. Morrisona,c,d,1 aChildren’s Research Institute, University of Texas Southwestern Medical Center, Dallas, TX 75235; bDepartment of Medicine, Vagelos College of Physicians & Surgeons, Columbia University, New York, NY 10032; cHHMI, University of Texas Southwestern Medical Center, Dallas, TX 75235; and dDepartment of Pediatrics, University of Texas Southwestern Medical Center, Dallas, TX 75235 This contribution is part of the special series of Inaugural Articles by members of the National Academy of Sciences elected in 2020. Contributed by Sean J. Morrison, April 16, 2021 (sent for review December 19, 2020; reviewed by Hank Kronenberg, Noriaki Ono, and Joy Y. Wu) We previously described a new osteogenic growth factor, osteo- use (14). Existing therapies include antiresorptive agents that slow lectin/Clec11a, which is required for the maintenance of skeletal bone loss, such as bisphosphonates (15, 16) and estrogens (17), bone mass during adulthood. Osteolectin binds to Integrin α11 and anabolic agents that increase bone formation, such as para- (Itga11), promoting Wnt pathway activation and osteogenic dif- thyroid hormone (PTH) (18), PTH-related protein (19), and ferentiation by leptin receptor+ (LepR+) stromal cells in the bone sclerostin inhibitor (SOSTi) (20). While these therapies increase marrow. Parathyroid hormone (PTH) and sclerostin inhibitor bone mass and reduce fracture risk, they are not a cure. (SOSTi) are bone anabolic agents that are administered to patients PTH promotes both anabolic and catabolic bone remodeling with osteoporosis.
    [Show full text]
  • Circulating Sclerostin in Disorders of Parathyroid Gland Function
    ORIGINAL ARTICLE Endocrine Research Circulating Sclerostin in Disorders of Parathyroid Gland Function Aline G. Costa, Serge Cremers, Mishaela R. Rubin, Donald J. McMahon, James Sliney, Jr., Marise Lazaretti-Castro, Shonni J. Silverberg, and John P. Bilezikian Department of Medicine (A.G.C., S.C., M.R.R., D.J.M., J.S., S.J.S., J.P.B.), Division of Endocrinology, Metabolic Bone Diseases Unit, College of Physicians and Surgeons, Columbia University, New York, New Downloaded from https://academic.oup.com/jcem/article/96/12/3804/2834946 by guest on 26 September 2021 York 10032; and Department of Medicine (A.G.C., M.L.-C.), Division of Endocrinology, Sa˜ o Paulo Federal University, Sa˜ o Paulo 04044, Brazil Context: Sclerostin, a protein encoded by the SOST gene in osteocytes and an antagonist of the Wnt signaling pathway, is down-regulated by PTH administration. Disorders of parathyroid function are useful clinical settings to study this relationship. Objective: The objective of the study was to evaluate sclerostin in two different disorders of parathyroid function, primary hyperparathyroidism and hypoparathyroidism, and to analyze the relationship between sclerostin and PTH, bone markers, and bone mineral density. Design: This is a cross-sectional study. Setting: The study was conducted at a clinical research center. Patients: Twenty hypoparathyroid and 20 hyperparathyroid patients were studied and compared to a reference control group. Results: Serum sclerostin was significantly higher in hypoparathyroid subjects than in hyperparathy- roid subjects (P Ͻ 0.0001) and controls (P Ͻ 0.0001). PTH was negatively associated with sclerostin, achieving statistical significance in hypoparathyroidism (r ϭϪ0.545; P ϭ 0.02).
    [Show full text]
  • Role and Mechanism of Action of Sclerostin in Bone
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE HHS Public Access provided by IUPUIScholarWorks Author manuscript Author ManuscriptAuthor Manuscript Author Bone. Author Manuscript Author manuscript; Manuscript Author available in PMC 2018 March 01. Published in final edited form as: Bone. 2017 March ; 96: 29–37. doi:10.1016/j.bone.2016.10.007. Role and mechanism of action of Sclerostin in bone Jesus Delgado-Calle1,3, Amy Y. Sato1, and Teresita Bellido1,2,3,* 1Department of Anatomy and Cell Biology, Indiana University School of Medicine, Indianapolis, Indiana 2Department of Medicine, Division of Endocrinology, Indiana University School of Medicine, Indianapolis, Indiana 3Roudebush Veterans Administration Medical Center, Indianapolis, Indiana Abstract After discovering that lack of Sost/sclerostin expression is the cause of the high bone mass human syndromes Van Buchem disease and sclerosteosis, extensive animal experimentation and clinical studies demonstrated that sclerostin plays a critical role in bone homeostasis and that its deficiency or pharmacological neutralization increases bone formation. Dysregulation of sclerostin expression also underlies the pathophysiology of skeletal disorders characterized by loss of bone mass as well as the damaging effects of some cancers in bone. Thus, sclerostin has quickly become a promising molecular target for the treatment of osteoporosis and other skeletal diseases, and beneficial skeletal outcomes are observed in animal studies and clinical trials using neutralizing
    [Show full text]
  • Synthesis, Gene Regulation and Osteoblast Differentiation
    Curr. Issues Mol. Biol. 15: 7-18. Online journal at http://www.cimb.orgMicroRNAs 7 MicroRNAs: Synthesis, Gene Regulation and Osteoblast Differentiation S. Vimalraj and N. Selvamurugan* tissue. They have the potential to undergo multilineage differentiation, such as osteoblasts, chondrocytes, Department of Biotechnology, School of Bioengineering, adipocytes, and myoblasts. Regulation of differentiation SRM University, Kattankulathur 603 203, Tamil Nadu, India of MSCs into osteogenic lineage is critical for maintaining bone mass and is necessary for prevention of bone related diseases. It is now evident that osteoblast differentiation is Abstract tightly controlled by several regulators including miRNAs The central dogma of transfer of genetic information from (Abdallah and Kassem, 2008; Guo et al., 2008; Lian DNA to protein via mRNA is now challenged by small et al., 2012), and miRNAs can regulate expression of fragment of non coding RNAs typically 19-25 nucleotides genes during differentiation of MSCs towards osteoblastic in length namely microRNAs (miRNAs). miRNAs regulate cells, resulting in bone formation (Taipaleenma¨ki et al., expression of the protein coding genes by interfering in their 2012). In the current review we discuss and summarize mRNAs and, thus, act as key regulators of diverge cellular miRNAs’ synthesis including their genomic position, target activities. Osteoblast differentiation, a key step in skeletal recognition, and gene regulation, and control of MSCs development involves activation of several signalling differentiation
    [Show full text]