DOCSLIB.ORG

FDA Briefing Document Meeting of the Bone, Reproductive and Urologic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
FDA Briefing Document Meeting of the Bone, Reproductive and Urologic FDA Briefing Document Meeting of the Bone, Reproductive and Urologic Drugs Advisory Committee January 16, 2019 BLA 761062 Romosozumab Amgen, Inc Proposed Indication: Treatment of osteoporosis in postmenopausal women at high risk of fracture, defined as a history of osteoporotic fracture, multiple risk factors for fracture, or patients who have failed or are intolerant to other available osteoporosis therapy Prepared by: Division of Bone, Reproductive and Urologic Products Division of Cardiorenal Products Office of New Drugs Division of Biometrics III Division of Biometrics VII Office of Biostatistics Division of Epidemiology II Office of Surveillance and Epidemiology Division of Clinical Pharmacology III Office of Clinical Pharmacology 1 Disclaimer Statement The attached package contains background information prepared by the Food and Drug Administration (FDA) for the panel members of the advisory committee. The FDA background package often contains assessments and/or conclusions and recommendations written by individual FDA reviewers. Such conclusions and recommendations do not necessarily represent the final position of the individual reviewers, nor do they necessarily represent the final position of the Review Division or Office. We have brought a biologics license application (BLA 761062) for romosozumab injection intended for treatment of osteoporosis in postmenopausal women at high risk of fracture, defined as a history of osteoporotic fracture, multiple risk factors for fracture, or patients who have failed or are intolerant to other available osteoporosis therapy, sponsored by Amgen, Inc, to this Advisory Committee in order to gain the Committee’s insights and opinions. The background package may not include all issues relevant to the final regulatory recommendation and instead is intended to focus on issues identified by the Agency for discussion by the advisory committee. The FDA will not issue a final determination on the issues at hand until input from the advisory committee process has been considered and all reviews have been finalized. The final determination may be affected by issues not discussed at the advisory committee meeting. 2 Table of Contents EXECUTIVE SUMMARY ................................................................................................................................. 5 DRAFT POINTS TO CONSIDER ............................................................................................................................. 7 1. INTRODUCTION ...................................................................................................................................... 8 2. ROMOSOZUMAB CLINICAL DEVELOPMENT PROGRAM .......................................................... 9 2.1. TRIAL 20060326 ..................................................................................................................................10 2.2. TRIAL 20070337 ..................................................................................................................................10 2.3. TRIAL 20110142 ..................................................................................................................................11 2.4. TRIAL 20110174 ..................................................................................................................................12 3. CLINICAL PHARMACOLOGY OF ROMOSOZUMAB ....................................................................13 3.1. GENERAL PHARMACOKINETICS OF ROMOSOZUMAB .............................................................................13 3.2. INTRINSIC FACTORS AND SPECIFIC POPULATIONS.................................................................................13 4. CLINICAL EFFECTIVENESS OF ROMOSOZUMAB .......................................................................13 4.1. TRIAL 20060326 ..................................................................................................................................13 4.2. TRIAL 20070337 ..................................................................................................................................14 4.3. TRIAL 20110142 ..................................................................................................................................16 4.4. APPLICABILITY OF EFFICACY FINDINGS TO U.S. PATIENTS AND U.S. MEDICAL PRACTICE .................17 4.5. CONCLUSIONS ON SUBSTANTIAL EVIDENCE OF EFFECTIVENESS .........................................................18 5. GENERAL SAFETY OF ROMOSOZUMAB ........................................................................................20 5.1. OVERALL SAFETY OUTCOMES .............................................................................................................20 5.2. DEATHS ...............................................................................................................................................20 5.3. SERIOUS ADVERSE EVENTS .................................................................................................................21 5.4. ADVERSE EVENTS LEADING TO STUDY WITHDRAWAL .......................................................................22 5.5. ADVERSE EVENTS LEADING TO STUDY DRUG DISCONTINUATION ......................................................23 5.6. COMMON ADVERSE EVENTS ...............................................................................................................23 5.7. ADVERSE EVENTS OF INTEREST...........................................................................................................23 5.8. IMMUNOGENICITY ...............................................................................................................................28 6. CARDIOVASCULAR SAFETY OF ROMOSOZUMAB .....................................................................30 6.1. CLINICAL CARDIOVASCULAR EVALUATION ........................................................................................31 6.2. NONCLINICAL AND IN VITRO CARDIOVASCULAR EVALUATION ...........................................................37 6.3. CARDIOVASCULAR SUMMARY .............................................................................................................43 7. FURTHER EVALUATION OF THE CARDIOVASCULAR SIGNAL ..............................................44 7.1. CARDIOVASCULAR OUTCOMES TRIALS ...............................................................................................44 7.2. OBSERVATIONAL STUDIES ...................................................................................................................44 3 Table of Figures Figure 1: Annual Risk of Hip Fracture According to the Number of Risk Factors and Age-Specific Calcaneal Bone Density (source) .................................................................................................................. 9 Figure 2: Time to First Occurrence of Adjudicated MACE ....................................................................... 34 Figure 3:Subgroup Analysis by Geographic Region .................................................................................. 36 Table of Tables Table 1: Trial 20060326: Percent Change in Lumbar Spine BMD at Month 12, Linear Mixed Effect Model .......................................................................................................................................................... 14 Table 2: Trial 20070337: Fracture Endpoints ............................................................................................. 15 Table 3: Trial 20070337: Bone Mineral Density, Mean Percent Change, LOCF, ANCOVA ................... 15 Table 4: Trial 20110142: Percent Change in Bone Mineral Density .......................................................... 17 Table 5: Trial 20110142: Secondary Fracture Endpoints ........................................................................... 17 Table 6: Postmenopausal Osteoporosis Fracture Trials: New Morphometric Vertebral Fractures, Risk Reductions................................................................................................................................................... 19 Table 7: Safety Events in Trials 20070337 and 20110142 ......................................................................... 20 Table 8: Fatal Adverse Events in Trials 20070337 and 20110142 ............................................................. 21 Table 9: Serious Adverse Events in Trials 20070337 and 20110142 ......................................................... 22 Table 10: Common Adverse Events in Trials 20070337 and 20110142 .................................................... 23 Table 11: Neoplasm Events in Trials 20070337 and 20110142 ................................................................. 26 Table 12: Efficacy Parameters Based on Antibody Status .......................................................................... 30 Table 13: Baseline Cardiovascular Risk Characteristics (Trials 20070337 and 20110142) ....................... 32 Table 14: Adjudicated Major Adverse Cardiovascular Events (MACE), Cardiovascular (CV) Serious Adverse Events (SAEs) and Cardiovascular Deaths ................................................................................... 33 4 Executive Summary The Division of Bone, Reproductive and Urologic Products has convened this advisory committee meeting to discuss romosozumab for the treatment of osteoporosis in postmenopausal women at high risk of fracture, defined as a history of osteoporotic fracture,
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, And
    Volume 86 • Number 12 Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, and Receptor Activator of Nuclear Factor-kB Ligand in Periodontitis Umut Balli,* Ahmet Aydogdu,† Figen Ongoz Dede,* Cigdem Coskun Turer,* and Berrak Guven‡ Background: To investigate changes in the levels and rel- ative ratios of sclerostin, osteoprotegerin (OPG), and recep- tor activator of nuclear factor-kB ligand (RANKL) in the gingival crevicular fluid (GCF) of patients with periodontitis after non-surgical periodontal treatment. Methods: Fifty-four individuals (27 healthy controls and 27 patients with chronic periodontitis [CP]) were enrolled in eriodontal disease is a complex the study. Periodontitis patients received non-surgical peri- biologic process related to the in- odontal therapy. GCF sampling and clinical periodontal pa- Pteraction between groups of mi- rameters were assessed before and 6 weeks after therapy. croorganisms and the host immune/ Sclerostin, OPG, and RANKL levels were measured by enzyme- inflammatory response.1 When the bal- linked immunosorbent assay, and their relative ratios were ance between microbial challenge and calculated. host response is disturbed, periodontal Results: Total amounts and concentrations of sclerostin breakdown (clinical attachment loss [AL] were significantly higher in patients with CP than in healthy and alveolar bone resorption) can oc- individuals (P <0.025) and decreased after treatment cur.1,2 Microorganisms and their prod- (P <0.05). The RANKL/OPG ratio was significantly lower in ucts are the primary etiologic factors that healthy individuals than in patients with periodontitis before directly initiate periodontal disease. and after treatment (P <0.025), but no significant difference However, the majority of periodontal was observed in patients with periodontitis after treatment breakdown is caused by endogenous (P >0.05).
    [Show full text]
  • Denosumab Versus Romosozumab for Postmenopausal Osteoporosis Treatment
    www.nature.com/scientificreports OPEN Denosumab versus romosozumab for postmenopausal osteoporosis treatment Tomonori Kobayakawa1, Akiko Miyazaki2, Makoto Saito3, Takako Suzuki2,4, Jun Takahashi2 & Yukio Nakamura2* Denosumab and romosozumab, a recently approved new drug, are efective and widely known molecular-targeted drugs for postmenopausal osteoporosis treatment. However, no studies have directly compared their therapeutic efects or safety in postmenopausal osteoporosis. This retrospective observational registry study compared the efcacy of 12-month denosumab or romosozumab treatment in postmenopausal osteoporosis patients. The primary outcome was the change in bone mineral density (BMD) at the lumbar spine. Secondary outcomes included BMD changes at the total hip and femoral neck, changes in bone turnover markers, and adverse events. Propensity score matching was employed to assemble patient groups with similar baseline characteristics. Sixty-nine patients each received either denosumab or romosozumab for 12 months. The mean 12-month percentage change from baseline in lumbar spine BMD was 7.2% in the denosumab group and 12.5% in the romosozumab group, indicating a signifcant diference between the groups. The percentage changes in BMD at both the total hip and femoral neck were also signifcantly higher at 12 months in the romosozumab group than in the denosumab group. In denosumab patients, bone formation and bone resorption markers were signifcantly decreased at 6 and 12 months from baseline. In the romosozumab group, the bone formation marker was signifcantly increased at 6 months and then returned to baseline, while the bone resorption marker was signifcantly decreased at both time points. Adverse events were few and predominantly minor in both groups, with no remarkable diference in the incidence of new vertebral fractures.
    [Show full text]
  • Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling
    Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling Maarten van Dinther1, Juan Zhang1, Stella E. Weidauer2, Verena Boschert2, Eva-Maria Muth2, Achim Knappik3, David J. J. de Gorter1, Puck B. van Kasteren1¤, Christian Frisch3, Thomas D. Mueller2, Peter ten Dijke1* 1 Department of Molecular Cell Biology and Centre for Biomedical Genetics, Leiden University Medical Center, Leiden, The Netherlands, 2 Department of Molecular Plant Physiology and Biophysics, Julius-von-Sachs Institut, Wuerzburg, Germany, 3 AbD Serotec, a Bio-Rad company, Puchheim, Germany Abstract Sclerosteosis is a rare high bone mass disease that is caused by inactivating mutations in the SOST gene. Its gene product, Sclerostin, is a key negative regulator of bone formation and might therefore serve as a target for the anabolic treatment of osteoporosis. The exact molecular mechanism by which Sclerostin exerts its antagonistic effects on Wnt signaling in bone forming osteoblasts remains unclear. Here we show that Wnt3a-induced transcriptional responses and induction of alkaline phosphatase activity, an early marker of osteoblast differentiation, require the Wnt co-receptors LRP5 and LRP6. Unlike Dickkopf1 (DKK1), Sclerostin does not inhibit Wnt-3a-induced phosphorylation of LRP5 at serine 1503 or LRP6 at serine 1490. Affinity labeling of cell surface proteins with [125I]Sclerostin identified LRP6 as the main specific Sclerostin receptor in multiple mesenchymal cell lines. When cells were challenged with Sclerostin fused to recombinant green fluorescent protein (GFP) this was internalized, likely via a Clathrin-dependent process, and subsequently degraded in a temperature and proteasome-dependent manner. Ectopic expression of LRP6 greatly enhanced binding and cellular uptake of Sclerostin- GFP, which was reduced by the addition of an excess of non-GFP-fused Sclerostin.
    [Show full text]
  • Increased Bone Mineral Density for 1 Year of Romosozumab, Vs Placebo, Followed by 2 Years of Denosumab in the Japanese Subgroup
    Archives of Osteoporosis (2019) 14:59 https://doi.org/10.1007/s11657-019-0608-z ORIGINAL ARTICLE Increased bone mineral density for 1 year of romosozumab, vs placebo, followed by 2 years of denosumab in the Japanese subgroup of the pivotal FRAME trial and extension Akimitsu Miyauchi1 & Rajani V. Dinavahi2 & Daria B. Crittenden2 & Wenjing Yang2 & Judy C. Maddox2 & Etsuro Hamaya3 & Yoichi Nakamura3 & Cesar Libanati4 & Andreas Grauer2 & Junichiro Shimauchi3 Received: 1 March 2019 /Accepted: 18 May 2019 # The Author(s) 2019 Abstract Summary Romosozumab, which binds sclerostin, rebuilds the skeletal foundation before transitioning to antiresorptive treat- ment. This subgroup analysis of an international, randomized, double-blind study in postmenopausal women with osteoporosis showed efficacy and safety outcomes for romosozumab followed by denosumab in Japanese women were generally consistent with those for the overall population. Purpose In the international, randomized, double-blind, phase 3 FRActure study, in postmenopausal woMen with ostEoporosis (FRAME; NCT01575834), romosozumab followed by denosumab significantly improved bone mineral density (BMD) and reduced fracture risk. This report evaluates Japanese women in FRAME. Methods Postmenopausal women with osteoporosis (T-score − 3.5 to − 2.5 at total hip or femoral neck) received romosozumab 210 mg or placebo subcutaneously monthly for 12 months, then each group received denosumab 60 mg subcutaneously every 6 months for 24 months. The key endpoint for Japanese women was BMD change. Other endpoints included new vertebral, clinical, and nonvertebral fracture; the subgroup analysis did not have adequate power to demonstrate statistically significant reductions. Results Of 7180 enrolled subjects, 492 (6.9%) were Japanese (247 romosozumab, 245 placebo).
    [Show full text]
  • Denosumab, Raloxifene, Romosozumab and Teriparatide to Prevent Osteoporotic Fragility Fractures: a Systematic Review and Economic Evaluation
    Journals Library Health Technology Assessment Volume 24 • Issue 29 • June 2020 ISSN 1366-5278 Denosumab, raloxifene, romosozumab and teriparatide to prevent osteoporotic fragility fractures: a systematic review and economic evaluation Sarah Davis, Emma Simpson, Jean Hamilton, Marrissa Martyn-St James, Andrew Rawdin, Ruth Wong, Edward Goka, Neil Gittoes and Peter Selby DOI 10.3310/hta24290 Denosumab, raloxifene, romosozumab and teriparatide to prevent osteoporotic fragility fractures: a systematic review and economic evaluation Sarah Davis ,1* Emma Simpson ,1 Jean Hamilton ,1 Marrissa Martyn-St James ,1 Andrew Rawdin ,1 Ruth Wong ,1 Edward Goka ,1 Neil Gittoes 2 and Peter Selby 3 1Health Economics and Decision Science, School of Health and Related Research (ScHARR), University of Sheffield, Sheffield, UK 2University Hospitals Birmingham NHS Foundation Trust, Birmingham, UK 3School of Medical Sciences, University of Manchester, Manchester, UK *Corresponding author Declared competing interests of authors: Neil Gittoes reports personal fees for being a member of the advisory board to Union Chimique Belge (UCB) S.A. (Brussels, Belgium) and personal fees for contributing to educational meeting sponsored by Eli Lilly and Company (Indianapolis, IN, USA), outside the submitted work. He is also a trustee of the National Osteoporosis Society, a member of the advisory board of the National Osteoporosis Guideline Group and Deputy Chairperson of the Specialised Endocrinology Clinical Reference Group, NHS England. Published June 2020 DOI: 10.3310/hta24290 This report should be referenced as follows: Davis S, Simpson E, Hamilton J, James MM-S, Rawdin A, Wong R, et al. Denosumab, raloxifene, romosozumab and teriparatide to prevent osteoporotic fragility fractures: a systematic review and economic evaluation.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Congress Report
    ValEncia spain CONGRESS REPORT a proDucT of This publicaTion is supporTED by Foreword from Contents Anna Teti, ECTS president Progress for rare diseases at ECTS 1 ECTS 2018 supports Camurati- The ECTS 2018 congress was again Engelmann patients’ association 7 exciting and successful. Around ECTS perspectives on clinical hot topics 9 1000 delegates attended the Omics moving forward to practical translation 11 meeting in Valencia, for teaching and learning in a ECTS Steven Boonen Award 14 relaxed and lively atmosphere. Our pre-congress day Screening for fracture risk in osteoporosis 17 was also very successful and included the Mellanby training course, the first ECTS/ICCBH workshop on ECTS and ASBMR debate screening for fracture risk 19 Rare Bone Diseases, the East meets West events, 10 Bone and ageing 21 very successful Working Gro ups and the ECTS Risk factors for bone disease 24 Academy events. Scientists were able to take advantage of the networking opportunities, clinicians could hear Clinical weight loss and bone 28 about the latest developments and best clinical Management of clinical vertebral fractures 30 practice, and young investigators could benefit from Exploring the human microbiome 33 contact with experienced colleagues and opinion New data on efficacy of osteoporosis therapies 36 leaders, including through our Meet the Expert Advances in regenerative medicine 40 sessions. ECTS aims at promoting crosstalk between Fish as a model of skeletal diseases 42 the generations and we believe this goal was fully New insights into bone and cartilage biology 44 achieved in Valencia, particularly as a result of the Cancer and bone 48 tremendous efforts of our ECTS Academy members.
    [Show full text]
  • Immunfarmakológia Immunfarmakológia
    Gergely: Immunfarmakológia Immunfarmakológia Prof Gergely Péter Az immunpatológiai betegségek döntő többsége gyulladásos, és ennek következtében általában szövetpusztulással járó betegség, melyben – jelenleg – a terápia alapvetően a gyulladás csökkentésére és/vagy megszűntetésére irányul. Vannak kizárólag gyulladásgátló gyógyszereink és vannak olyanok, amelyek az immunreakció(k) bénításával (=immunszuppresszió révén) vagy emellett vezetnek a gyulladás mérsékléséhez. Mind szerkezetileg, mind hatástanilag igen sokféle csoportba oszthatók, az alábbi felosztás elsősorban didaktikus célokat szolgál. 1. Nem-szteroid gyulladásgátlók (‘nonsteroidal antiinflammatory drugs’ NSAID) 2. Kortikoszteroidok 3. Allergia-elleni szerek (antiallergikumok) 4. Sejtoszlás-gátlók (citosztatikumok) 5. Nem citosztatikus hatású immunszuppresszív szerek 6. Egyéb gyulladásgátlók és immunmoduláns szerek 7. Biológiai terápia 1. Nem-szteroid gyulladásgátlók (NSAID) Ezeket a vegyületeket, melyek őse a szalicilsav (jelenleg, mint acetilszalicilsav ‘aszpirin’ használatos), igen kiterjedten alkalmazzák a reumatológiában, az onkológiában és az orvostudomány szinte minden ágában, ahol fájdalom- és lázcsillapításra van szükség. Egyes felmérések szerint a betegek egy ötöde szed valamilyen NSAID készítményt. Szerkezetük alapján a készítményeket több csoportba sorolhatjuk: szalicilátok (pl. acetilszalicilsav) pyrazolidinek (pl. fenilbutazon) ecetsav származékok (pl. indometacin) fenoxiecetsav származékok (pl. diclofenac, aceclofenac)) oxicamok (pl. piroxicam, meloxicam) propionsav
    [Show full text]
  • The Two Tontti Tudiul Lui Hi Ha Unit
    THETWO TONTTI USTUDIUL 20170267753A1 LUI HI HA UNIT ( 19) United States (12 ) Patent Application Publication (10 ) Pub. No. : US 2017 /0267753 A1 Ehrenpreis (43 ) Pub . Date : Sep . 21 , 2017 ( 54 ) COMBINATION THERAPY FOR (52 ) U .S . CI. CO - ADMINISTRATION OF MONOCLONAL CPC .. .. CO7K 16 / 241 ( 2013 .01 ) ; A61K 39 / 3955 ANTIBODIES ( 2013 .01 ) ; A61K 31 /4706 ( 2013 .01 ) ; A61K 31 / 165 ( 2013 .01 ) ; CO7K 2317 /21 (2013 . 01 ) ; (71 ) Applicant: Eli D Ehrenpreis , Skokie , IL (US ) CO7K 2317/ 24 ( 2013. 01 ) ; A61K 2039/ 505 ( 2013 .01 ) (72 ) Inventor : Eli D Ehrenpreis, Skokie , IL (US ) (57 ) ABSTRACT Disclosed are methods for enhancing the efficacy of mono (21 ) Appl. No. : 15 /605 ,212 clonal antibody therapy , which entails co - administering a therapeutic monoclonal antibody , or a functional fragment (22 ) Filed : May 25 , 2017 thereof, and an effective amount of colchicine or hydroxy chloroquine , or a combination thereof, to a patient in need Related U . S . Application Data thereof . Also disclosed are methods of prolonging or increasing the time a monoclonal antibody remains in the (63 ) Continuation - in - part of application No . 14 / 947 , 193 , circulation of a patient, which entails co - administering a filed on Nov. 20 , 2015 . therapeutic monoclonal antibody , or a functional fragment ( 60 ) Provisional application No . 62/ 082, 682 , filed on Nov . of the monoclonal antibody , and an effective amount of 21 , 2014 . colchicine or hydroxychloroquine , or a combination thereof, to a patient in need thereof, wherein the time themonoclonal antibody remains in the circulation ( e . g . , blood serum ) of the Publication Classification patient is increased relative to the same regimen of admin (51 ) Int .
    [Show full text]
  • Romosozumab Monoclonal Antibody- Sclerostin
    ROMOSOZUMAB MONOCLONAL ANTIBODY- SCLEROSTIN JOSEPH M. LANE, MD HOSPITAL FOR SPECIAL SURGERY Weill Cornell Medicine NEW YORK, NY Disclosure Joseph M. Lane, MD CollPlant, Inc: Stock Options Merck: Research Support On Foundation: Consultant/Board Member Radius Health, Inc: Consultant Terumo BCT Consultant NIH Study Section Research Grants OSTEOPOROSIS Fragility (Iow energy) Fractures Hip Fracture Mortality (1 year) Female ~ 24% Male ~ 30% 70% Lose One Level Function ANTIRESORPTION Bisphosphonates ↓R ↓F Denosumab ↓R SERMS ↓R Only spine ANABOLIC Teriparatide ↑F Late ↑R Abaloparatide ↑F Late ↑R ROM0S0ZUMAB ↑F ↓R ROMOSOZUMAB SCLEROSTIN MONOCLONAL ANTIBODY WHAT DO WE KNOW ABOUT SCLEROSTIN? Odd diseases Wnt Bone Pathway SCLEROSTIOSIS Inactivating Mutation SOST (codes for sclerostin) van Buchan Disease less severe ↑ Bone Mass ↓ Fractures SCLEROSTIN Secreted By Osteocyte (low mechanical load) Binds to LRP 5/6 Inactivates Wnt Pathway Ceases Osteoblastic Bone Formation Shah AD et al. Int J Womens Health, 2015. Pre-Clinical Data Romosozumab Genetic Deficiency Sclerostin Rodents ↑Bone Mass ↑ Bone Formation Trabecular Cortical Normal Bone Quality ↑Bone Strength Normal Mineralization Lack of Brittleness Sclerostin Monoclonal Antibody Animals ↑ Trabecular/Cortical Thickness ↓ Cortical Porosity Corrected Ovariectomy ↑ Bone Density LS, FN, Prox Tib, Distal Radius RANKL INHIBITOR AMPLIFIED GAIN Comparison of Changes in Areal And Volumetric BMD 12 Months Romo vs Teriparatide Romo Teriparatide 210mg qm 20ug/d Areal BMD (DXA) L-Spine 12.3%* 6.9%* Total Hip 3.9%* 0.8% Integral V-metric BMD (QCT) 17.7% * L-Spine 4.1% 12.9%* Total Hip 1.2% * p<.05 Genant JBMR 2017 Comparison of Changes in Estimated Bone Strength Finite Element Analyses Romo Teriparatide 210mg qm 20μg/d Estimated Bone Strength FEA by QCT 27.3%* 18.5% L-Spine 12.3%* 3.6%* 18.5% Total Hip -0.7% * p<.05 Keaveny JBMR 2017 Romosozumab vs.
    [Show full text]
  • Evenity® (Romosozumab)
    Evenity® (Romosozumab) Last Review Date: September 23, 2019 Number: MG.MM.PH.195 Medical Guideline Disclaimer Property of EmblemHealth. All rights reserved. The treating physician or primary care provider must submit to EmblemHealth the clinical evidence that the patient meets the criteria for the treatment or surgical procedure. Without this documentation and information, EmblemHealth will not be able to properly review the request for prior authorization. The clinical review criteria expressed below reflects how EmblemHealth determines whether certain services or supplies are medically necessary. EmblemHealth established the clinical review criteria based upon a review of currently available clinical information (including clinical outcome studies in the peer-reviewed published medical literature, regulatory status of the technology, evidence-based guidelines of public health and health research agencies, evidence-based guidelines and positions of leading national health professional organizations, views of physicians practicing in relevant clinical areas, and other relevant factors). EmblemHealth expressly reserves the right to revise these conclusions as clinical information changes, and welcomes further relevant information. Each benefit program defines which services are covered. The conclusion that a particular service or supply is medically necessary does not constitute a representation or warranty that this service or supply is covered and/or paid for by EmblemHealth, as some programs exclude coverage for services or supplies that EmblemHealth considers medically necessary. If there is a discrepancy between this guideline and a member's benefits program, the benefits program will govern. In addition, coverage may be mandated by applicable legal requirements of a state, the Federal Government or the Centers for Medicare & Medicaid Services (CMS) for Medicare and Medicaid members.
    [Show full text]