DOCSLIB.ORG

The Role of BMP Signaling in Osteoclast Regulation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of BMP Signaling in Osteoclast Regulation Journal of Developmental Biology Review The Role of BMP Signaling in Osteoclast Regulation Brian Heubel * and Anja Nohe * Department of Biological Sciences, University of Delaware, Newark, DE 19716, USA * Correspondence: [email protected] (B.H.); [email protected] (A.N.) Abstract: The osteogenic effects of Bone Morphogenetic Proteins (BMPs) were delineated in 1965 when Urist et al. showed that BMPs could induce ectopic bone formation. In subsequent decades, the effects of BMPs on bone formation and maintenance were established. BMPs induce proliferation in osteoprogenitor cells and increase mineralization activity in osteoblasts. The role of BMPs in bone homeostasis and repair led to the approval of BMP 2 by the Federal Drug Administration (FDA) for anterior lumbar interbody fusion (ALIF) to increase the bone formation in the treated area. However, the use of BMP 2 for treatment of degenerative bone diseases such as osteoporosis is still uncertain as patients treated with BMP 2 results in the stimulation of not only osteoblast mineralization, but also osteoclast absorption, leading to early bone graft subsidence. The increase in absorption activity is the result of direct stimulation of osteoclasts by BMP 2 working synergistically with the RANK signaling pathway. The dual effect of BMPs on bone resorption and mineralization highlights the essential role of BMP-signaling in bone homeostasis, making it a putative therapeutic target for diseases like osteoporosis. Before the BMP pathway can be utilized in the treatment of osteoporosis a better understanding of how BMP-signaling regulates osteoclasts must be established. Keywords: osteoclast; BMP; osteoporosis Citation: Heubel, B.; Nohe, A. The Role of BMP Signaling in Osteoclast Regulation. J. Dev. Biol. 2021, 9, 24. https://doi.org/10.3390/jdb9030024 1. Role of BMP in Bone Formation Bone is formed in two major ways: endochondral ossification and intramembranous Academic Editors: Robert W. ossification. The majority of the human skeleton is formed by endochondral ossification, Dettman, Kristin Bruk Artinger, excluding the flat bones of the skull, the mandible, and the clavicle [1]. Endochondral Eugenia C. Olesnicky and Simon ossification begins during week six and seven of embryonic development with the differen- J. Conway tiation and condensation of mesenchymal stem cells into chondrocytes [2]. Chondrocytes then lay down a framework for skeletal elements that is later mineralized by osteoblasts Received: 23 April 2021 and remodeled by osteoclasts (Figure1A,B). The initial mineralization takes place in the Accepted: 18 June 2021 primary ossification center near the middle region of the skeletal element, known as the Published: 28 June 2021 diaphysis (Figure1C). The mineralization and elongation of the skeletal element remains active after birth until 25 years of age [2]. Publisher’s Note: MDPI stays neutral Each stage of endochondral bone formation is regulated by BMPs, including the ac- with regard to jurisdictional claims in published maps and institutional affil- tivity of osteoclasts. In the initial stages of bone formation, BMP 2 and BMP7 stimulate iations. the proliferation and differentiation of mesenchymal stem cells into chondrocytes [3,4]. Later, the condensation process of chondrocytes is regulated by BMP-signaling transmitted through the phosphorylation and activation of SMADs [5,6]. Then, BMP-ERK1/2-signaling induces the proliferation and maturation of the chondrocyte condensation, encouraging these cells to grow into a proper framework for eventual bone formation through the Copyright: © 2021 by the authors. regulation of Indian hedgehog (IHH) and parathyroid hormone (PTH) expression gra- Licensee MDPI, Basel, Switzerland. dients [5,7,8]. Disruption in BMP-signaling during chondrocyte condensation results in This article is an open access article deformed cartilage growth zones and short limb phenotypes [9]. distributed under the terms and conditions of the Creative Commons After the framework of chondrocytes is formed, blood vessels invade the cartilage Attribution (CC BY) license (https:// through a process called angiogenesis (Figure1C). BMP-signaling further regulates this creativecommons.org/licenses/by/ process, as the absence of the BMP receptor type 1a (BMPRIa) gene in vivo leads to im- 4.0/). paired angiogenesis [10]. Once the blood vessels have penetrated the established cartilage, J. Dev. Biol. 2021, 9, 24. https://doi.org/10.3390/jdb9030024 https://www.mdpi.com/journal/jdb J. Dev. Biol. 2021, 9, 24 2 of 18 they bring in mature osteoblasts and osteoclasts, thus beginning the mineralization pro- cess [11–13]. Additionally, up to 60% of mature chondrocytes also transdifferentiate into osteoblasts themselves, adding to the mineralization of the extracellular matrix surrounding chondrocytes [14]. The transdifferentiation of chondrocytes is regulated by essential factor, J. Dev. Biol. 2021, 9, x FOR PEER REVIEWRunt-related transcription factor 2 (RUNX2), that acts down stream of BMP-signaling [152 ].of 18 Without proper of BMP-signaling chondrocyte transdifferentiation is lost in BMPRIa knock- out mice [16]. FigureFigure 1. Endochondral 1. Endochondral bone bone formation. formation. The phasesThe phases of bone of bone maturation maturation and remodeling. and remodeling. (A) condensation (A) condensation of mesenchymal of mesenchy- stemmal cells stem differentiating cells differentiating into chondrocytes. into chondrocytes. (B) Chondrocyte (B) Chondrocyte cells organize cells organize into ainto framework a framework for the for maturingthe maturing skeletal skeletal element.element. (C) ( InitialC) Initial vascularization vascularization beginning beginning primary primary ossification ossification at a at long a long bone bone diaphysis. diaphysis. (D) ( FormationD) Formation of secondary of secondary ossificationossification centers centers and and initiation initiation of osteoclast-driven of osteoclast-dri remodelingven remodeling of medullary of medullary cavity cavity and spongy and spongy bone. bone. (E) Mature (E) Mature skeletal skel- elementetal element with fully with formed fully trabecularformed trab boneecular structure bone structure and medullary and medullary cavity filled cavity with filled bone with marrow. bone marrow. WhileAfter the the mineralization framework of process chondrocytes takes place, is formed, osteoclasts blood work vessels to remodel invade the innercartilage bonethrough tissue a to process extend called a network angiogenesis of blood (Figure vessels. 1C). (Figure BMP-signaling1D). The networkfurther regulates of blood this vesselsprocess, within as the bone absence tissue of is the so extensiveBMP receptor that type it receives 1a (BMPRIa around) gene 10% in vivo of the leads total to cardiac impaired outputangiogenesis [17,18]. Due [10]. to Once this circulation the blood ofvessels blood have containing penetrated osteoclasts the established and osteoblasts, cartilage, bone they is capablebring in of mature remodeling osteoblasts its structure and andosteoclasts, repairing thus damage, beginning unlike the avascular mineralization cartilage process [19]. Once[11–13]. the primary Additionally, ossification up tocenter 60% of has mature formed, chondrocytes secondary also ossification transdifferentiate centers develop into oste- at eitheroblasts end themselves, of long bones adding within to the the mineralizati epiphysialon plates, of the effectivelyextracellular shutting matrix downsurrounding the growthchondrocytes zones by age[14]. 25, The preventing transdifferentiation further elongation of chondrocytes of skeletal is elements regulated [2 ,by20 ].essential The first fac- remodelingtor, Runt-related process transcription occurs at these factor ossification 2 (RUNX2), centers that asacts osteoclasts down stream resorb of BMP-signaling bone in the diaphysis.[15]. Without As a result,proper osteoclasts of BMP-signaling form a spacechondrocyte for bone transdifferentiation marrow to be stored, is lost known in BMPRIa as theknockout medullary mice cavity [16]. (Figure 1E) [ 21]. The administration of BMP 2 into the medullary cavity resultsWhile inthe an mineralization initial increase process in bone takes formation place, osteoclasts that is later work lost to [22 remodel]. The loss the ofinner bonebone density tissue is to attributed extend a network to the increase of blood in ve absorptionssels. (Figure activity 1D). of The osteoclast, network indicatingof blood ves- a dualsels rolewithin of BMPbone tissue 2 in bone is so homeostasis. extensive that With it receives the emerging around role10% ofof BMP-signalingthe total cardiac in out- osteoclastput [17,18]. differentiation, Due to this circulation the same focus of blood given containing to osteoprogenitors osteoclasts and should osteoblasts, be given bone to is osteoclastcapable progenitors.of remodeling This its structure is highlighted and repairing by the BMP-dependent damage, unlike ERK1/2avascular signaling cartilage in [19]. bothOnce osteoprogenitors the primary ossification and osteoclast center progenitors. has formed, secondary ossification centers develop atFurthermore, either end of itlong is has bones been within established the epip thathysial ERK1/2 plates, phosphorylation effectively shutting leads down to an the increasegrowth in zones mesenchymal by age 25, stem preventing cell proliferation further elon [23gation–25]. However,of skeletal activationelements [2,20]. of ERK1/2 The first alsoremodeling leads to an process increase occurs in proliferation
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, And
    Volume 86 • Number 12 Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, and Receptor Activator of Nuclear Factor-kB Ligand in Periodontitis Umut Balli,* Ahmet Aydogdu,† Figen Ongoz Dede,* Cigdem Coskun Turer,* and Berrak Guven‡ Background: To investigate changes in the levels and rel- ative ratios of sclerostin, osteoprotegerin (OPG), and recep- tor activator of nuclear factor-kB ligand (RANKL) in the gingival crevicular fluid (GCF) of patients with periodontitis after non-surgical periodontal treatment. Methods: Fifty-four individuals (27 healthy controls and 27 patients with chronic periodontitis [CP]) were enrolled in eriodontal disease is a complex the study. Periodontitis patients received non-surgical peri- biologic process related to the in- odontal therapy. GCF sampling and clinical periodontal pa- Pteraction between groups of mi- rameters were assessed before and 6 weeks after therapy. croorganisms and the host immune/ Sclerostin, OPG, and RANKL levels were measured by enzyme- inflammatory response.1 When the bal- linked immunosorbent assay, and their relative ratios were ance between microbial challenge and calculated. host response is disturbed, periodontal Results: Total amounts and concentrations of sclerostin breakdown (clinical attachment loss [AL] were significantly higher in patients with CP than in healthy and alveolar bone resorption) can oc- individuals (P <0.025) and decreased after treatment cur.1,2 Microorganisms and their prod- (P <0.05). The RANKL/OPG ratio was significantly lower in ucts are the primary etiologic factors that healthy individuals than in patients with periodontitis before directly initiate periodontal disease. and after treatment (P <0.025), but no significant difference However, the majority of periodontal was observed in patients with periodontitis after treatment breakdown is caused by endogenous (P >0.05).
    [Show full text]
  • STIM1 Controls Calcineurin/Akt/Mtor/NFATC2‑Mediated Osteoclastogenesis Induced by RANKL/M‑CSF
    736 EXPERIMENTAL AND THERAPEUTIC MEDICINE 20: 736-747, 2020 STIM1 controls calcineurin/Akt/mTOR/NFATC2‑mediated osteoclastogenesis induced by RANKL/M‑CSF YANJIAO HUANG1, QIANG LI2, ZUNYONG FENG3 and LANRONG ZHENG1 Departments of 1Pathological Anatomy, 2Anatomy and 3Forensic Medicine, Wannan Medical College, Wuhu, Anhui 241002, P.R. China Received October 15, 2018; Accepted June 20, 2019 DOI: 10.3892/etm.2020.8774 Abstract. Store-operated Ca2+ entry (SOCE) is the stable (p.E136X, p.R429C) or constitutively activated (p.R304W) calcium channel influx in most cells. It consists of the SOCE, failed to respond to RANKL/M-CSF-mediated induc- cytoplasmic ion channel ORAI and endoplasmic reticulum tion of normal osteoclastogenesis. In addition, activation of the receptor stromal interaction molecule 1 (STIM1). Abolition calcineurin/Akt/mTOR/NFATC2 signalling cascade induced of SOCE function due to ORAI1 and STIM1 gene defects by RANKL/M-CSF was abnormal in the BMDMs with may cause non-perspiration, ectoderm dysplasia and STIM1 mutants compared with that in BMDMs from healthy skeletal malformations with severe combined immunodefi- subjects. In addition, overexpression of wild-type STIM1 ciency (CID). Calcineurin/mammalian target of rapamycin restored SOCE in p.R429C- and p.E136X-mutant BMDMs, but (mTOR)/nuclear factor of activated T cells 2 (NFATC2) is not in p.R304W-mutant BMDMs. Of note, calcineurin, cyclo- an important signalling cascade for osteoclast development. sporin A, mTOR inhibitor rapamycin and NFATC2‑specific Calcineurin is activated by Ca2+ via SOCE during osteoclas- small interfering RNA restored the function of SOCE in togenesis, which is induced by receptor activator of NF-κB p.R304W-mutant BMDMs.
    [Show full text]
  • An Update on Dual-Energy X-Ray Absorptiometry Glen M
    An Update on Dual-Energy X-Ray Absorptiometry Glen M. Blake, PhD, and Ignac Fogelman, MD Dual-energy x-ray absorptiometry (DXA) scans to measure bone mineral density at the spine and hip have an important role in the evaluation of individuals at risk of osteoporosis, and in helping clinicians advise patients about the appropriate use of antifracture treat- ment. Compared with alternative bone densitometry techniques, hip and spine DXA exam- inations have several advantages that include a consensus that bone mineral density results should be interpreted using the World Health Organization T score definition of osteoporosis, a proven ability to predict fracture risk, proven effectiveness at targeting antifracture therapies, and the ability to monitor response to treatment. This review dis- cusses the evidence for these and other clinical aspects of DXA scanning. Particular attention is directed at the new World Health Organization Fracture Risk Assessment Tool (FRAX) algorithm, which uses clinical risk factors in addition to a hip DXA scan to predict a patient’s 10-year probability of suffering an osteoporotic fracture. We also discuss the recently published clinical guidelines that incorporate the FRAX fracture risk assessment in decisions about patient treatment. Semin Nucl Med 40:62-73 © 2010 Elsevier Inc. All rights reserved. steoporosis is widely recognized as an important public porosis before fractures occur and the development of effec- Ohealth problem because of the significant morbidity, tive treatments. Measurements of bone mineral
    [Show full text]
  • Parathyroid Hormone Stimulates Bone Formation and Resorption In
    Proc. Nati. Acad. Sci. USA Vol. 78, No. 5, pp. 3204-3208, May 1981 Medical Sciences Parathyroid hormone stimulates bone formation and resorption in organ culture: Evidence for a coupling mechanism (endocrine/mineralization/bone metabolism/cartilage/regulation) GuY A. HOWARD, BRIAN L. BOTTEMILLER, RUSSELL T. TURNER, JEANNE I. RADER, AND DAVID J. BAYLINK American Lake VA Medical Center, Tacoma, Washington 98493; and Department of Medicine, University of Washington, Seattle, Washington 98195 Communicated by Clement A. Finch, January 26, 1981 ABSTRACT We have developed an in vitro system, using em- growing rats with PTH results in an increase in formation and bryonic chicken tibiae grown in a serum-free medium, which ex- resorption (4) and a net gain in bone volume (10-12). We have hibits simultaneous bone formation and resorption. Tibiae from recently obtained similar results in vitro for the acute and 8-day embryos increased in mean (±SD) length (4.0 ± 0.4 to 11.0 chronic effects of PTH (13). Moreover, as reported earlier for ± 0.3 mm) and dry weight (0.30 ± 0.04 to 0.84 ± 0.04 mg) during resorption in rat bone (14), the in vitro effect of PTH in our 12 days in vitro. There was increased incorporation of [3H]proline system is an inductive one in that the continued presence of into hydroxyproline (120 ± 20 to 340 ± 20 cpm/mg of bone per PTH is unnecessary for bone resorption and bone formation to 24 hr) as a measure of collagen synthesis, as well as a 62 ± 5% increase in total calcium and 45Ca taken up as an indication of ac- be stimulated for several days (13).
    [Show full text]
  • Helping Physicians Succeed with ICD-10-CM January 24, 2014
    Helping Physicians Succeed with ICD-10-CM January 24, 2014 Paul Belton, Vice President Corporate Compliance Agenda • Executive Summary • Clinical Roots of ICD-10 • Why physicians should care • How ICD-10 will benefit physicians • Taking control of ICD-10 • Personal Learning Experiences and Goals • ICD-10 Resources 2 Last Call for ICD-9-CM October 1, 2013 could be a day sentimental HIM Veterans raise a glass to a longtime friend – or perhaps foe. For October 1 signifies the end of an era; it is the effective date of the final ICD-9-CM update before ICD-10-CM/PCS codes kick in on October 1, 2014. TOP MOVIES THE AVERAGE INCLUDED: COST OF A SUPERMAN THE NEW HOUSE MOVIE, THE DEER WAS $58,000 HUNTER, THE MUPPET MOVIE, ROCKY II “For those of us who have THE AVERAGE INCOME WAS MARGARET THATCHER WS been maintaining ICD-9-CM $17,500 ELECTED PRIM MINISTER IN since the code set’s THE UK implementation in 1979, this THE BOARD GAM TRIVIIAL THE SONY PURSUIT WAS LAUNCHED WALKMAN final ICD-9-CM code update is DEBUTED, VISICALC BECAME In 1979: RETAILING a historic occasion.” ICD-9-CM THE FIRST FOR $200 has one more year’s worth of SPREADSHEET PROGRAM POPULAR SONGS last calls, with coders using INCLUDED: “MY AVERAGE SHARONA” BY THE MONTHLY this latest and last code set KNACK; “HOT STUFF” AND A GALLON RENT WAS “BAD GIRLS BY GLORIA OF GAS $280 update until next October. A GAYNOR; PINK FLOYD WAS 86 RELEASED “THE WALL” CENTS reflective toast to ICD-9-CM.
    [Show full text]
  • Denosumab and Anti-Angiogenetic Drug-Related Osteonecrosis of the Jaw: an Uncommon but Potentially Severe Disease
    ANTICANCER RESEARCH 33: 1793-1798 (2013) Denosumab and Anti-angiogenetic Drug-related Osteonecrosis of the Jaw: An Uncommon but Potentially Severe Disease STEFANO SIVOLELLA1, FRANCO LUMACHI2, EDOARDO STELLINI1 and LORENZO FAVERO1 Departments of 1Neurosciences, Section of Dentistry and 2Surgery, Oncology and Gastroenterology, University of Padua, School of Medicine, Padova, Italy Abstract. Osteonecrosis of the jaw (ONJ) is a rare but bone exposure in the oral cavity (1). Experimental radio-ONJ serious lesion of the jaw characterized by exposed necrotic was first reported in the 1960s and better-described by Zach bone and is related to several drugs usually used for treating et al. (2, 3). Currently, ONJ may represent a serious problem patients with advanced malignancies. Common therapies in patients irradiated for head and neck carcinomas, but may inducing ONJ are nitrogen-containing bisphosphonates (BPs), also be an uncommon complication of cancer chemotherapy the human monoclonal antibody to the receptor activator of (4, 5). Other causes of ONJ are local malignancy, periodontal nuclear factor-kappa B ligand denosumab and some anti- disease, trauma, and long-term glucocorticoid or angiogenic drugs, alone or in combination with BPs. The real bisphosphonate (BP) therapy (6). ONJ is a potentially incidence of ONJ is unknown. Several cases of ONJ in patients debilitating disease, which occurs in approximately 5% of with cancer who underwent denosumab therapy have been patients with myeloma or bone metastases from breast cancer reported and it seems that the overall incidence of denosumab- (BC) or prostate cancer receiving high-dose intravenous BPs related ONJ is similar to that for BP-related in this (7).
    [Show full text]
  • Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling
    Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling Maarten van Dinther1, Juan Zhang1, Stella E. Weidauer2, Verena Boschert2, Eva-Maria Muth2, Achim Knappik3, David J. J. de Gorter1, Puck B. van Kasteren1¤, Christian Frisch3, Thomas D. Mueller2, Peter ten Dijke1* 1 Department of Molecular Cell Biology and Centre for Biomedical Genetics, Leiden University Medical Center, Leiden, The Netherlands, 2 Department of Molecular Plant Physiology and Biophysics, Julius-von-Sachs Institut, Wuerzburg, Germany, 3 AbD Serotec, a Bio-Rad company, Puchheim, Germany Abstract Sclerosteosis is a rare high bone mass disease that is caused by inactivating mutations in the SOST gene. Its gene product, Sclerostin, is a key negative regulator of bone formation and might therefore serve as a target for the anabolic treatment of osteoporosis. The exact molecular mechanism by which Sclerostin exerts its antagonistic effects on Wnt signaling in bone forming osteoblasts remains unclear. Here we show that Wnt3a-induced transcriptional responses and induction of alkaline phosphatase activity, an early marker of osteoblast differentiation, require the Wnt co-receptors LRP5 and LRP6. Unlike Dickkopf1 (DKK1), Sclerostin does not inhibit Wnt-3a-induced phosphorylation of LRP5 at serine 1503 or LRP6 at serine 1490. Affinity labeling of cell surface proteins with [125I]Sclerostin identified LRP6 as the main specific Sclerostin receptor in multiple mesenchymal cell lines. When cells were challenged with Sclerostin fused to recombinant green fluorescent protein (GFP) this was internalized, likely via a Clathrin-dependent process, and subsequently degraded in a temperature and proteasome-dependent manner. Ectopic expression of LRP6 greatly enhanced binding and cellular uptake of Sclerostin- GFP, which was reduced by the addition of an excess of non-GFP-fused Sclerostin.
    [Show full text]
  • Direct Measurement of Bone Resorption and Calcium
    Proc. Natl. Acad. Sci. USA Vol. 77, No. 4, pp. 1818-1822, April 1980 Biochemistry Direct measurement of bone resorption and calcium conservation during vitamin D deficiency or hypervitaminosis D ([3Hltetracycline/collagen/chicks/growth modeling/kinetics) LEROY KLEIN Departments of Orthopaedics, Biochemistry, and Macromolecular Science, Case Western Reserve University, Cleveland, Ohio 44106 Communicated by Oscar D. Ratnoff, December 20,1979 ABSTRACT When bone is remodeled during the growth of complication, various workers (11, 12) have expressed the need a given size bone to a larger size, some bone is resorbed and for a more direct measurement of bone turnover. In addition, some is deposited. Much of the resorbed bone mineral, calcium, tracer methods for calcium kinetics involve only plasma tracer can be reutilized during bone formation. The net and absolute effects of normal growth, vitamin D deficiency, or vitamin D concentrations and focus on net pool turnover rather than on excess were compared on bone resortion, bone formation, and more absolute measurements of bone turnover (13). calcium reutilization. Growing chic were relabeled exten- Bone resorptiont has been observed directly by using histo- sively with three isotopes: 45Ca, [3Htetracycline, and [3H]pro- logical measurements of the increase in diameter of the bone line. Data were obtained weekly during 3 weeks of control marrow space in rapidly growing rats (14). Resorption has been growth, vitamin D deficiency, or vitamin D overdosage while measured kinetically by either 45Ca under steady-state condi- on a nonradioactive diet. Bone resorption as measured by in- creases in the marrow (inner) diameter of the midshaft of the tions in adult rats (15) or 40Ca dilution of the natural isotope femur and humerus and by the weekly losses of total [3Hjtetra- 48Ca in human subjects (16).
    [Show full text]
  • Managing Osteoporosis and Joint Damage in Patients with Rheumatoid Arthritis: an Overview
    Journal of Clinical Medicine Review Managing Osteoporosis and Joint Damage in Patients with Rheumatoid Arthritis: An Overview Yoshiya Tanaka The First Department of Internal Medicine, School of Medicine, University of Occupational and Environmental Health, 1-1, Iseigaoka, Kitakyushu 807-8555, Japan; [email protected]; Tel.: +81-93-603-1611; Fax: +81-93-691-7580 Abstract: In rheumatoid arthritis, a representative systemic autoimmune disease, immune abnor- mality and accompanying persistent synovitis cause bone and cartilage destruction and systemic osteoporosis. Biologics targeting tumor necrosis factor, which plays a central role in the inflammatory process, and Janus kinase inhibitors have been introduced in the treatment of rheumatoid arthritis, making clinical remission a realistic treatment goal. These drugs can prevent structural damage to bone and cartilage. In addition, osteoporosis, caused by factors such as menopause, aging, immobility, and glucocorticoid use, can be treated with bisphosphonates and the anti-receptor activator of the nuclear factor-κB ligand antibody. An imbalance in the immune system in rheumatoid arthritis induces an imbalance in bone metabolism. However, osteoporosis and bone and cartilage destruction occur through totally different mechanisms. Understanding the mechanisms underlying osteo- porosis and joint destruction in rheumatoid arthritis leads to improved care and the development of new treatments. Keywords: rheumatoid arthritis; osteoporosis; joint destruction; DMARD; biologics Citation: Tanaka, Y. Managing Osteoporosis and Joint Damage in Patients with Rheumatoid Arthritis: An Overview. J. Clin. Med. 2021, 10, 1. Introduction 1241. https://doi.org/10.3390/ Rheumatoid arthritis is a systemic autoimmune disease characterized by inflammatory jcm10061241 polyarthritis. It occurs commonly in women in their 30s to 60s, and often causes organ disorders.
    [Show full text]
  • National Health and Nutrition Examination Survey Flyer (12/02)
    Osteoporosis Introduction Figure 1. Prevalence of low femur bone density: Osteoporosis is a skeletal disorder in which bones United States 1988–94 weaken and risk of fracture is increased. While any fracture is a serious occurrence, hip fractures are of greatest public health concern because the consequences are often devastating. For example, those who experience hip fractures have an increased risk of death during the first 12 months after the fracture. Among those who survive, many experience loss of mobility and may have to enter long-term care facilities. Finally, hip fractures cost more to repair than any other type of osteoporotic fracture. Defining osteoporosis Bone strength is determined by the amount of bone mass or bone mineral density (BMD) and its quality and microarchitecture. The latter two qualities are not easy to measure, but methods to accurately assess BMD, such as dual-energy x-ray absorptiometry (DXA), are available. In prevalence of low total femur BMD among older U.S. adults 1994, an expert panel convened by the World Health were calculated using the WHO definitions. For this Organization (WHO) developed diagnostic criteria for analysis, BMD values of white women 50 years of age and osteoporosis and reduced bone density in white women. older were compared with those of 20–29-year-old non- These definitions are based on a comparison of the Hispanic white women. There is no consensus at this time individual’s BMD value with those of a young adult concerning the definition of low bone density in groups reference group. Two levels of reduced BMD were defined: other than white women; however, it is clear that osteopenia, which is a mild reduction in BMD, and osteoporosis is not solely a disease of white women.
    [Show full text]
  • Bisphosphonates Can Be Safely Given to Patients with Hypercalcemia And
    Clinical Research in Practice: The Journal of Team Hippocrates Volume 5 | Issue 1 Article 11 2019 Bisphosphonates can be safely given to patients with hypercalcemia and renal insufficiency secondary to multiple myeloma Matthew .J Miller Wayne State University School of Medicine, [email protected] Follow this and additional works at: https://digitalcommons.wayne.edu/crp Part of the Endocrinology, Diabetes, and Metabolism Commons, Medical Education Commons, Nephrology Commons, and the Translational Medical Research Commons Recommended Citation MILLER MJ. Bisphosphonates can be safely given to patients with hypercalcemia and renal insufficiency secondary to multiple myeloma. Clin. Res. Prac. 2019 Mar 14;5(1):eP1846. doi: 10.22237/crp/1552521660 This Critical Analysis is brought to you for free and open access by the Open Access Journals at DigitalCommons@WayneState. It has been accepted for inclusion in Clinical Research in Practice: The ourJ nal of Team Hippocrates by an authorized editor of DigitalCommons@WayneState. VOL 5 ISS 1 / eP1846 / MARCH 14, 2019 doi: 10.22237/crp/1552521660 Bisphosphonates can be safely given to patients with hypercalcemia and renal insufficiency secondary to multiple myeloma MATTHEW J. MILLER, B.S., Wayne State University School of Medicine, [email protected] ABSTRACT A critical appraisal and clinical application of Itou K, Fukuyama T, Sasabuchi Y, et al. Safety and efficacy of oral rehydration therapy until 2 h before surgery: a multicenter randomized controlled trial. Journal of Anesthesia. 2012;26(1):20-27. doi: 10.1007/s00540-011-1261-x. Keywords: bisphosphonates, nephrotoxicity, safety, renal insufficiency, renal failure, multiple myeloma, pamidronate, ibandronate, zaledronic acid Clinical Context An 83-year-old African-American female with a history of multiple vertebral compression fractures and gastritis presented for the second time in two weeks with symptoms of hypercalcemia.
    [Show full text]