DOCSLIB.ORG

The Role of Exoribonucleases in Human Cells Using Osteosarcoma As a Model Amy Louise Pashler

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Exoribonucleases in Human Cells Using Osteosarcoma As a Model Amy Louise Pashler The Role of Exoribonucleases in Human Cells using Osteosarcoma as a Model Amy Louise Pashler A thesis submitted in partial fulfilment of the requirements of the University of Brighton and the University of Sussex for the degree of Doctor of Philosophy April 2019 1 Abstract Post-transcriptional control of gene expression is a critical level of regulation in the Central Dogma. One of many layers is control of RNA turnover and metabolism which are vital to maintain cellular homeostasis. In RNA processing, the role of RNA stability is essential in determining how long a species of RNA is able to function within the cell. In addition, RNA stability is central to the process of translation of RNAs, as well as the ability of regulatory RNAs to inhibit or repress their target mRNAs. This thesis focuses on the function of exoribonucleases within human cells and their role in regulating gene expression. Exoribonucleases are key enzymes in RNA degradation, which degrade RNA in either the 5’ – 3’ direction, or in the 3’ – 5’ direction. There is particular focus on the role of the 5’ – 3’ exoribonuclease, XRN1, and how defects in 5’ – 3’ RNA decay can result in defective protein expression, and the onset of disease. This thesis characterises the expression of XRN1 in human bone cancer cell lines, and compares expression to that of a non-cancer cell line control. In doing so, the elucidation of XRN1 as a potential tumour suppressor gene in the progression of the most common bone cancer, osteosarcoma is investigated, alongside characterisation of the expression of the 3’ – 5’ exoribonucleases, DIS3, DIS3L1 and DIS3L2. DIS3 and DIS3L2 have each been previously implicated in the progression of human disease: mutations in DIS3 have been associated with a variety of leukaemias, whereas mutations in DIS3L2 have been associated with congenital overgrowth syndromes and also Wilms’ Tumour of the kidney. This thesis shows that alongside XRN1, DIS3L2 may DIS3L2 also changes in expression in osteosarcoma. This thesis also elucidates phenotypic changes in cells where XRN1 has been knocked down by a lipid-based RNAi transfection system. Using the osteosarcoma cells as a model, XRN1 was knocked down over a period of time, with cellular effects being observed over a time course. With regards to fundamental cellular pathways of proliferation, viability, translation and apoptosis, phenotypic changes in the behaviour of the cell lines were not observed. In contrast, knock down of DIS3L2 in a human embryonic kidney cell line, HEK-293T, resulted in hyper- proliferation, but this effect was not observed in the osteosarcoma cell lines, demonstrating a tissue specific effect for this gene in humans. The existence of synergism between the major exoribonucleases was also studied in this thesis, which found that there may be co-ordinate regulation occurring between XRN1 and DIS3L2, but not with DIS3 and DIS3L1. Finally, this thesis shows the transcriptional changes in SAOS-2 cells when XRN1 is knocked down, in comparison with a control, using RNA sequencing technology to ascertain which pathways this enzyme functions to regulate. RNA sequencing was performed in a global approach to identify transcriptional targets of XRN1 in osteosarcoma cells. In doing so, it was 2 shown that XRN1 is involved in a multitude of cellular processes, such as cellular migration and adhesion, and also may function in the EGF pathway, a known oncogenic pathway. It also became clear that XRN1 targets transcripts with similar motifs in the 3’ UTR, and that transcript targets are conserved across more than one cell line. This thesis marks the stepping stone to elucidating the role of XRN1 in human cells, and serves as an introduction to the function of XRN1 in human disease to pave the way for future research. 3 Table of Contents Abstract .............................................................................................................................. 2 Commonly used abbreviations .......................................................................................... 12 Acknowledgements ........................................................................................................... 15 Candidate’s declaration ..................................................................................................... 16 Chapter 1 .......................................................................................................................... 17 Introduction ...................................................................................................................... 17 1.1 The Central Dogma ........................................................................................................... 17 1.1.2 A Brief Overview of Transcription .............................................................................. 19 1.1.3 A Brief Overview of Translation ................................................................................. 23 1.2 Control of Gene Expression .............................................................................................. 27 1.2.1 Transcriptional control of gene expression ............................................................... 27 1.2.2 Post-transcriptional control of gene expression ........................................................ 28 1.2.3 Translational control of gene expression ................................................................... 29 1.2.4 Post-translational control of gene expression ........................................................... 30 1.3 A description of different RNA species ............................................................................. 31 1.3.1 RNAs involved in protein synthesis ............................................................................ 31 1.3.2 RNAs involved in post-transcriptional modification .................................................. 33 1.3.3 RNAs involved in gene regulation .............................................................................. 33 1.4 The Mechanisms and Roles of RNA Stability .................................................................... 39 1.4.1 RNA stability ............................................................................................................... 39 1.4.2 Regulation of gene expression by 3’ tailing ............................................................... 40 1.5 Mammalian exoribonucleases and how they function..................................................... 40 1.5.1 XRN1: Structure and functions ................................................................................... 41 1.5.2 XRN2: Structure and Functions .................................................................................. 45 1.5.3 DIS3L2: Structure and functions ................................................................................ 47 1.5.4 DIS3 and DIS3L1: Structures and functions ................................................................ 49 1.6 Pathways of RNA Decay .................................................................................................... 53 1.6.1 Summary of 5’ – 3’ RNA decay ................................................................................... 53 1.6.2 Summary of 3’ – 5’ RNA decay ................................................................................... 56 1.6.3 Summary of Nonsense-Mediated Decay ................................................................... 59 1.6.4 Summary of microRNA-mediated decay .................................................................... 62 1.7 RNA stability: implications in human disease ................................................................... 70 1.7.1 Pathologies generally associated with RNA stability and decay ................................ 70 1.7.2 Human diseases associated with XRN1...................................................................... 72 1.7.3 Human pathologies associated with DIS3L2 .............................................................. 77 4 1.8 An overview of Osteosarcoma and Ewing sarcoma .......................................................... 80 1.8.1 Treatments and pathology of osteosarcoma ............................................................. 80 1.8.2 Molecular pathology of the development of osteosarcoma ..................................... 81 1.8.3 A brief overview of Ewing sarcoma............................................................................ 82 1.8.4 Existing RNA studies of OS ......................................................................................... 83 1.9 Preliminary work and previous publications .................................................................... 85 1.10 Project aims and brief results chapter overviews ........................................................... 86 1.10.1 Chapter 3: Characterisation of exoribonuclease expression in OS and EWS........... 86 1.10.2 Chapter 4: The Effects of Changing Exoribonuclease Expression in OS Cells using siRNA ................................................................................................................................... 87 1.10.3 Chapter 5: Identifying Potential Transcript Targets of XRN1 using RNA Sequencing ............................................................................................................................................ 88 Chapter 2 .......................................................................................................................... 89 Materials & Methods
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, And
    Volume 86 • Number 12 Gingival Crevicular Fluid Levels of Sclerostin, Osteoprotegerin, and Receptor Activator of Nuclear Factor-kB Ligand in Periodontitis Umut Balli,* Ahmet Aydogdu,† Figen Ongoz Dede,* Cigdem Coskun Turer,* and Berrak Guven‡ Background: To investigate changes in the levels and rel- ative ratios of sclerostin, osteoprotegerin (OPG), and recep- tor activator of nuclear factor-kB ligand (RANKL) in the gingival crevicular fluid (GCF) of patients with periodontitis after non-surgical periodontal treatment. Methods: Fifty-four individuals (27 healthy controls and 27 patients with chronic periodontitis [CP]) were enrolled in eriodontal disease is a complex the study. Periodontitis patients received non-surgical peri- biologic process related to the in- odontal therapy. GCF sampling and clinical periodontal pa- Pteraction between groups of mi- rameters were assessed before and 6 weeks after therapy. croorganisms and the host immune/ Sclerostin, OPG, and RANKL levels were measured by enzyme- inflammatory response.1 When the bal- linked immunosorbent assay, and their relative ratios were ance between microbial challenge and calculated. host response is disturbed, periodontal Results: Total amounts and concentrations of sclerostin breakdown (clinical attachment loss [AL] were significantly higher in patients with CP than in healthy and alveolar bone resorption) can oc- individuals (P <0.025) and decreased after treatment cur.1,2 Microorganisms and their prod- (P <0.05). The RANKL/OPG ratio was significantly lower in ucts are the primary etiologic factors that healthy individuals than in patients with periodontitis before directly initiate periodontal disease. and after treatment (P <0.025), but no significant difference However, the majority of periodontal was observed in patients with periodontitis after treatment breakdown is caused by endogenous (P >0.05).
    [Show full text]
  • Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling
    Anti-Sclerostin Antibody Inhibits Internalization of Sclerostin and Sclerostin-Mediated Antagonism of Wnt/ LRP6 Signaling Maarten van Dinther1, Juan Zhang1, Stella E. Weidauer2, Verena Boschert2, Eva-Maria Muth2, Achim Knappik3, David J. J. de Gorter1, Puck B. van Kasteren1¤, Christian Frisch3, Thomas D. Mueller2, Peter ten Dijke1* 1 Department of Molecular Cell Biology and Centre for Biomedical Genetics, Leiden University Medical Center, Leiden, The Netherlands, 2 Department of Molecular Plant Physiology and Biophysics, Julius-von-Sachs Institut, Wuerzburg, Germany, 3 AbD Serotec, a Bio-Rad company, Puchheim, Germany Abstract Sclerosteosis is a rare high bone mass disease that is caused by inactivating mutations in the SOST gene. Its gene product, Sclerostin, is a key negative regulator of bone formation and might therefore serve as a target for the anabolic treatment of osteoporosis. The exact molecular mechanism by which Sclerostin exerts its antagonistic effects on Wnt signaling in bone forming osteoblasts remains unclear. Here we show that Wnt3a-induced transcriptional responses and induction of alkaline phosphatase activity, an early marker of osteoblast differentiation, require the Wnt co-receptors LRP5 and LRP6. Unlike Dickkopf1 (DKK1), Sclerostin does not inhibit Wnt-3a-induced phosphorylation of LRP5 at serine 1503 or LRP6 at serine 1490. Affinity labeling of cell surface proteins with [125I]Sclerostin identified LRP6 as the main specific Sclerostin receptor in multiple mesenchymal cell lines. When cells were challenged with Sclerostin fused to recombinant green fluorescent protein (GFP) this was internalized, likely via a Clathrin-dependent process, and subsequently degraded in a temperature and proteasome-dependent manner. Ectopic expression of LRP6 greatly enhanced binding and cellular uptake of Sclerostin- GFP, which was reduced by the addition of an excess of non-GFP-fused Sclerostin.
    [Show full text]
  • The Role of Polyadenylation in the Induction of Inflammatory Genes
    The role of polyadenylation in the induction of inflammatory genes Raj Gandhi BSc & ARCS Thesis submitted for the degree of Doctor of Philosophy September 2016 Declaration Except where acknowledged in the text, I declare that this thesis is my own work and is based on research that was undertaken by me in the School of Pharmacy, Faculty of Science, The University of Nottingham. i Acknowledgements First and foremost, I give thanks to my primary supervisor Dr. Cornelia de Moor. She supported me at every step, always made time for me whenever I needed it, and was sympathetic during times of difficulty. I feel very, very fortunate to have been her student. I would also like to thank Dr. Catherine Jopling for her advice and Dr. Graeme Thorn for being so patient and giving me so much help in understanding the bioinformatics parts of my project. I am grateful to Dr. Anna Piccinini and Dr. Sadaf Ashraf for filling in huge gaps in my knowledge about inflammation and osteoarthritis, and to Dr. Sunir Malla for help with the TAIL-seq work. I thank Dr. Richa Singhania and Kathryn Williams for proofreading. Dr. Hannah Parker was my “big sister” in the lab from my first day, and I am very grateful for all her help and for her friendship. My project was made all the more enjoyable/bearable by the members of the Gene Regulation and RNA Biology group, especially Jialiang Lin, Kathryn Williams, Dr. Richa Singhania, Aimée Parsons, Dan Smalley, and Hibah Al-Masmoum. Barbara Rampersad was a wonderful technician. Mike Thomas, James Williamson, Will Hawley, Tom Upton, and Jamie Ware were some of the best of friends I could have hoped to make in Nottingham.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • The Chloroplast Epitranscriptome: Factors, Sites, Regulation, and Detection Methods
    G C A T T A C G G C A T genes Review The Chloroplast Epitranscriptome: Factors, Sites, Regulation, and Detection Methods Nikolay Manavski 1,† , Alexandre Vicente 1,†, Wei Chi 2 and Jörg Meurer 1,* 1 Plant Molecular Biology, Faculty of Biology, Ludwig-Maximilians-University Munich, Großhaderner Street 2-4, 82152 Planegg-Martinsried, Germany; [email protected] (N.M.); [email protected] (A.V.) 2 Photosynthesis Research Center, Key Laboratory of Photobiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China; [email protected] * Correspondence: [email protected]; Tel.: +49-89-218074556 † Both authors contributed equally to this work. Abstract: Modifications in nucleic acids are present in all three domains of life. More than 170 dis- tinct chemical modifications have been reported in cellular RNAs to date. Collectively termed as epitranscriptome, these RNA modifications are often dynamic and involve distinct regulatory pro- teins that install, remove, and interpret these marks in a site-specific manner. Covalent nucleotide modifications-such as methylations at diverse positions in the bases, polyuridylation, and pseu- douridylation and many others impact various events in the lifecycle of an RNA such as folding, localization, processing, stability, ribosome assembly, and translational processes and are thus cru- cial regulators of the RNA metabolism. In plants, the nuclear/cytoplasmic epitranscriptome plays important roles in a wide range of biological processes, such as organ development, viral infection, and physiological means. Notably, recent transcriptome-wide analyses have also revealed novel dynamic modifications not only in plant nuclear/cytoplasmic RNAs related to photosynthesis but Citation: Manavski, N.; Vicente, A.; especially in chloroplast mRNAs, suggesting important and hitherto undefined regulatory steps in Chi, W.; Meurer, J.
    [Show full text]
  • 1.2 Cis Elements …………………………………………………………………
    UC Irvine UC Irvine Electronic Theses and Dissertations Title Characterization of the Mammalian mRNA 3' Processing Complex Permalink https://escholarship.org/uc/item/0m16c8r4 Author Chan, Serena Leong Publication Date 2014 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, IRVINE Characterization of the Mammalian mRNA 3’ Processing Complex DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences by Serena Leong Chan Dissertation Committee: Professor Yongsheng Shi, Ph.D., Chair Professor Andrej Lupták, Ph.D. Professor Klemens J. Hertel, Ph.D. Professor Marian L. Waterman, Ph.D. 2014 1 Chapter 1 © 2010 John Wiley & Sons, Ltd. All Other Materials © 2014 Serena Leong Chan ii DEDICATION To my wonderful, loving mom for teaching me how to be a good person, for showing me the joys of life and for loving me for who I am. iii TABLE OF CONTENTS Page LIST OF FIGURES ……………………………….………………………………… v LIST OF TABLES ……………………………………..…………………………….. vii ACKNOWLEDGEMENTS ……………………………………………………….… viii CURRICULUM VITAE …………………………………………….………………... x ABSTRACT OF THE DISSERTATION …………………………………........... xiii Chapter 1. Introduction ………………………………………………………………… 1 1.1 Pre-mRNA 3’ Processing Components Overview ………………………… 4 1.2 Cis Elements ………………………………………………………………….. 4 1.3 Trans Factors ........................................................................................... 7 1.4 mRNA 3’ Processing Complex
    [Show full text]
  • The Role of DIS3L2 in the Degradation of the Uridylated RNA Species in Humans
    MASARYK UNIVERSITY Faculty of Science National Center for Biomedical Research Dmytro Ustianenko The role of DIS3L2 in the degradation of the uridylated RNA species in humans Ph.D. THESIS SUPERVISOR doc. Mgr. ŠTĚPÁNKA VAŇÁČOVÁ, Ph.D. BRNO, 2014 _______________________________ Cover: A schematic representation of the RNA degradation process which oc- curs in the cytoplasm. Copyright © 2014 Dmytro Ustianenko, Masaryk University, All rights reserved. _______________________________ Copyright © Dmytro Ustianenko, Masaryk University Bibliographic entry Author: Mgr. Dmytro Ustianenko Faculty of Science, Masaryk University National Centre for Biomolecular Research Central European Institute of Technology Title of Dissertation: The role of DIS3L2 in the degradation of the uridylat- ed RNA species in humans. Degree Programme: Biochemistry Field of Study: Biomolecular chemistry Supervisor: Doc. Mgr. Štěpánka Vaňáčová, Ph.D. Academic Year: 2014 Number of Pages: 131 Keywords: RNA degradation, DIS3L2, uridylation, humans, miRNA, let-7 Bibliografický záznam Autor: Mgr. Dmytro Ustianenko Přírodovědecká fakulta, Masarykova univerzita Národní centrum pro výzkum biomolekul Středoevropský technologický institut Název práce: The role of DIS3L2 in the degradation of the uridylat- ed RNA species in humans. Studijní program: Biochemie Studijní obor: Biomolekulární chemie Školitel: doc. Mgr. Štěpánka Vaňáčová, Ph.D. Akademický rok: 2014 Počet stran: 131 Klíčová slova: RNA degradace, DIS3L2, uridylace, mikro RNA, let-7 Acknowledgements I would like to thank to all the people who have contributed to this work. Foremost I would like to thank my supervisor Stepanka Vanacova for her enthusiasm, support and patience though all of my studies. I would like to acknowledge the members of the RNA processing and degradation group for their support and help in achieving this goal.
    [Show full text]
  • Systematic Analysis of Palatal Transcriptome to Identify Cleft Palate Genes Within Tgfβ3-Knockout Mice Alleles: RNA-Seq Analysis of Tgfβ3 Mice Ozturk Et Al
    Systematic analysis of palatal transcriptome to identify cleft palate genes within TGFβ3-knockout mice alleles: RNA-Seq analysis of TGFβ3 Mice Ozturk et al. Ozturk et al. BMC Genomics 2013, 14:113 http://www.biomedcentral.com/1471-2164/14/113 Ozturk et al. BMC Genomics 2013, 14:113 http://www.biomedcentral.com/1471-2164/14/113 RESEARCH ARTICLE Open Access Systematic analysis of palatal transcriptome to identify cleft palate genes within TGFβ3-knockout mice alleles: RNA-Seq analysis of TGFβ3 Mice Ferhat Ozturk1,4, You Li2, Xiujuan Zhu1, Chittibabu Guda2,3 and Ali Nawshad1* Abstract Background: In humans, cleft palate (CP) accounts for one of the largest number of birth defects with a complex genetic and environmental etiology. TGFβ3 has been established as an important regulator of palatal fusion in mice and it has been shown that TGFβ3-null mice exhibit CP without any other major deformities. However, the genes that regulate cellular decisions and molecular mechanisms maintained by the TGFβ3 pathway throughout palatogenesis are predominantly unexplored. Our objective in this study was to analyze global transcriptome changes within the palate during different gestational ages within TGFβ3 knockout mice to identify TGFβ3-associated genes previously unknown to be associated with the development of cleft palate. We used deep sequencing technology, RNA-Seq, to analyze the transcriptome of TGFβ3 knockout mice at crucial stages of palatogenesis, including palatal growth (E14.5), adhesion (E15.5), and fusion (E16.5). Results: The overall transcriptome analysis of TGFβ3 wildtype mice (C57BL/6) reveals that almost 6000 genes were upregulated during the transition from E14.5 to E15.5 and more than 2000 were downregulated from E15.5 to E16.5.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • The Role of BMP Signaling in Osteoclast Regulation
    Journal of Developmental Biology Review The Role of BMP Signaling in Osteoclast Regulation Brian Heubel * and Anja Nohe * Department of Biological Sciences, University of Delaware, Newark, DE 19716, USA * Correspondence: [email protected] (B.H.); [email protected] (A.N.) Abstract: The osteogenic effects of Bone Morphogenetic Proteins (BMPs) were delineated in 1965 when Urist et al. showed that BMPs could induce ectopic bone formation. In subsequent decades, the effects of BMPs on bone formation and maintenance were established. BMPs induce proliferation in osteoprogenitor cells and increase mineralization activity in osteoblasts. The role of BMPs in bone homeostasis and repair led to the approval of BMP 2 by the Federal Drug Administration (FDA) for anterior lumbar interbody fusion (ALIF) to increase the bone formation in the treated area. However, the use of BMP 2 for treatment of degenerative bone diseases such as osteoporosis is still uncertain as patients treated with BMP 2 results in the stimulation of not only osteoblast mineralization, but also osteoclast absorption, leading to early bone graft subsidence. The increase in absorption activity is the result of direct stimulation of osteoclasts by BMP 2 working synergistically with the RANK signaling pathway. The dual effect of BMPs on bone resorption and mineralization highlights the essential role of BMP-signaling in bone homeostasis, making it a putative therapeutic target for diseases like osteoporosis. Before the BMP pathway can be utilized in the treatment of osteoporosis a better understanding of how BMP-signaling regulates osteoclasts must be established. Keywords: osteoclast; BMP; osteoporosis Citation: Heubel, B.; Nohe, A. The Role of BMP Signaling in Osteoclast Regulation.
    [Show full text]